Natural salt-reducing polypeptide combination and its application

Abstract

The present invention discloses a natural salt-reducing polypeptide combination and its application, comprising at least two salt-reducing polypeptides, both of which are capable of binding to the TMC4 receptor and / or the ENaC receptor. The natural salt-reducing polypeptide combination of the present invention has a similar sensory experience of saltiness and taste as table salt, and while reducing salt concentration, the saltiness is not reduced. As a food additive in the future, it can enhance the health properties of food and meet consumers' expectations for food flavor. It also exhibits significant advantages in terms of salt reduction effect, taste, and food health, truly achieving the goal of "reducing salt without reducing saltiness."

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, relates to a polypeptide combination and application thereof, and specifically relates to a natural salt-reducing polypeptide combination and application thereof. Background Art

[0002] Taste is fundamental to how humans and animals identify and absorb nutrients. The human taste system interacts with flavor compounds in food through taste receptors in the mouth. The resulting stimulation is transmitted via gustatory nerves to the taste center in the brain, where it generates taste perception. Saltiness, as one of the essential human tastes, is crucial for the perception of food flavor. Global mortality statistics show that a high-salt diet is the number one risk factor for health. Numerous studies have confirmed that excessive salt intake can increase blood pressure. Furthermore, a long-term high-salt diet can increase the incidence of diseases such as gastric cancer, asthma, obesity, and kidney disease. Therefore, it is necessary to reduce dietary sodium intake. According to research from the European Society of Cardiology, the salt content in food should be reduced, with daily salt intake per person below 5.00g. my country's "Dietary Guidelines for Chinese Residents (2022)" recommends that Chinese adults consume no more than 5.00g of salt per day.

[0003] To implement the "Healthy China 2030" plan, numerous salt substitutes have emerged, including non-sodium salts, salty peptides, salty-enhancing peptides, and flavor modifiers. These have demonstrated promising salt-reduction effects in the laboratory. Non-sodium cation substitutes (potassium chloride, magnesium chloride, potassium lactate, etc.) are the most widely used solutions for reducing sodium intake. These metal salts, which impart a salty taste, are commercially available. However, they can only partially reduce the sodium content in food, generally no more than 15%, and other cation substitutes often have a distinctive flavor, limiting their application in food. Flavor modifiers can compensate for the reduced saltiness caused by salt reduction, but they must be used in combination with other salt substitutes. Optimizing the shape and size of salt crystals, reducing the uneven distribution of salt in the food matrix, and even restructuring the food matrix to enhance the salty perception are effective strategies for addressing unpleasant flavors. In comparison, salt-reducing peptides are a more ideal salt substitute, not only satisfying human taste needs but also supplementing essential amino acids, truly achieving "salt reduction without reducing saltiness."

[0004] Salt-reducing peptides are active peptides composed of amino acids extracted from protein-rich raw materials through processes such as enzymatic hydrolysis, and they have a salt-reducing effect. These peptides can be salty or not salty on their own, but when used with salt, they can reduce salt usage without reducing the saltiness. Based on their food source, they can be categorized as animal-, plant-, and yeast-derived. Food-derived salt-reducing peptides are derived from fungi and plant proteins and can be used in the field of food salt reduction. They offer advantages such as high safety, a wide range of applications, and improved digestibility by the human body, making them a highly promising food-based active peptide.

[0005] The molecular mechanisms of salt-reducing peptides are still not fully understood. Salty taste perception remains the least understood of all tastes. It relies on specific receptors or ion channels, which serve as the primary threshold for detecting salty substances. Currently, research focuses on two types of channels: the epithelial sodium channel (ENaC), transient receptor potential vanilloid 1 (TRPV1), and polycystic kidney disease-like ion channel (PKD2L1), which are examples of first-class receptors and ion channels. Transmembrane channel 4 (TMC4), TRPML3 (MCOLN3), and Kv3.2 have been identified as potential second-class channels for salty taste receptors. These can also be used to screen for salty enhancers. TMC4 is a novel chloride ion channel sensitive to high NaCl concentrations. This protein contains a transmembrane domain and is expressed in taste buds on the back of the tongue. While TMC4 is not a widely recognized receptor directly associated with taste, the activation of TMC4 by a substance demonstrates its ability to enhance saltiness, making it useful for identifying and screening salt enhancers.

[0006] Salty taste stimulants such as metal salts are mainly Na + , K + , Ca 2+ Mg 2+ The compounds composed of these types of cations are mainly salty. Among these salty ionic compounds, NaCl is the most common salty seasoning. It is dissolved in cooking oil or certain solutions to cover the surface of food or penetrate the internal tissues, and then during the chewing process, saliva is fully in contact with food debris, promoting the absorption of NaCl. + Released from food. Under the action of saliva, Na +The taste buds on the tongue surface stimulate the taste cells, causing nerve conduction to perceive salty taste. There are at least two salty taste transmission pathways, namely the amiloride-sensitive pathway and the amiloride-insensitive pathway, which have different characteristics. The amiloride-sensitive pathway is mainly mediated by the epithelial sodium ion channel (ENaC), which is cation-selective and is mainly activated by low concentrations of potassium and sodium ions. ENaC is a type of ion channel mainly composed of three different subunits (c-subunit, B-subunit and y-subunit). ENaC plays an important role in the perception of salty taste in rodents.

[0007] The mechanism of salt-reducing peptides can be elucidated to some extent through molecular docking. Molecular docking is typically used to obtain ligand-receptor complexes, which reflect a static binding mode. However, due to atomic perturbations, the binding of ligands and receptors is actually a constantly changing process. In addition, due to the limitations of the docking algorithms and scoring functions of existing docking programs, the resulting ligand-receptor complex structures are generally not stable structures and can only be used as initial conformations. Molecular dynamics simulations are required to obtain more reliable results. Molecular dynamics simulations are an important method for analyzing protein dynamics and can be used to verify and expand molecular docking results and mechanistic explanations of molecular dynamics.

[0008] Therefore, in response to the above technical problems, it is necessary to develop research on the mechanism of salt-reducing peptides, and screen and obtain a natural salt-reducing peptide combination based on the mechanism research, which will be more conducive to promoting related research on salt reduction effects and healthy foods. Summary of the Invention

[0009] The purpose of the present invention is to provide a natural salt-reducing polypeptide combination and its application, which finds a combination principle and combination method for significantly reducing the amount of salt used, thereby significantly reducing the amount of salt used while also showing obvious advantages in taste and food health, thereby realizing an application method for significantly reducing the amount of salt used.

[0010] In order to achieve the above object, a specific embodiment of the present invention provides the following technical solutions:

[0011] In one aspect, the present invention provides a natural salt-reducing polypeptide combination, comprising at least two salt-reducing polypeptides, both of which are salt-reducing polypeptides capable of binding to TMC4 receptors and / or ENaC receptors.

[0012] In one or more embodiments of the present invention, the salt-reducing polypeptide group includes salt-reducing polypeptides that strongly bind to the TMC4 receptor and salt-reducing polypeptides that strongly bind to the ENaC receptor.

[0013] In one or more embodiments of the present invention, the salt-reducing polypeptides are all salt-reducing polypeptides that can bind to TMC4 receptors and ENaC receptors, and when combined with different salt-reducing polypeptides, the binding ability of the salt-reducing polypeptides to TMC4 receptors and ENaC receptors has a binding preference.

[0014] In one or more embodiments of the present invention, the salt-reducing polypeptide is selected from EF 10、 At least two of PP9 and PQ5, the EF 10 The amino acid sequence of PP9 is shown in SEQ ID NO: 1: EDEGEQPRPF, the amino acid sequence of PP9 is shown in SEQ ID NO: 2: PKLLLLPKP, and the amino acid sequence of PQ5 is shown in SEQ ID NO: 3: PHEMQ.

[0015] Preferably, the EF10, PP9 and PQ5 are all expressed by protease-deficient Pichia pastoris. The correct folding and efficient secretion of the salt-reducing polypeptide in the protease-deficient yeast expression system enhance the expression of the salt-reducing polypeptide.

[0016] In one or more embodiments of the present invention, the EF 10 The gene sequence is shown in SEQ ID NO: 4: GAGGACGAAG GCGAGCAACC TAGACCTTTT; or

[0017] The gene sequence of the PP9 is shown in SEQ ID NO: 5: CCTAAATTATTGTTGTTGCC TAAACCA; or

[0018] The gene sequence of PQ5 is shown in SEQ ID NO: 6: CCCCATGAGATGCAA.

[0019] In one or more embodiments of the present invention, the natural salt-reducing polypeptide combination includes EF 10 and PP9, the EF 10 Strongly binds to the ENaC receptor, and the PP9 strongly binds to the TMC4 receptor;

[0020] Preferably, the natural salt-reducing polypeptide combination is EF 10 and PP9;

[0021] Further preferably, the EF 10 The weight ratio of PP9 is (1-3): (1-2), preferably 1:1.

[0022] In one or more embodiments of the present invention, the natural salt-reducing polypeptide combination is EF 10 and PQ5, the EF 10Strongly binds to ENaC receptors, and PQ5 assists in binding to TMC4 receptors; in this salt-reducing peptide combination, EF 10 The peptide has the property of strong binding to ENaC (epithelial sodium channel) receptor. This strong binding ability makes EF 10 It can effectively simulate and enhance the salty taste of food while reducing the salt concentration, thus meeting consumers' expectations for food flavor. PQ5 peptides can assist in binding with TMC4. This binding property of PQ5 may help regulate or enhance EF. 10 The salt-reducing effect can be further enhanced by affecting related taste or metabolic pathways to further improve the overall performance of the salt-reducing peptide combination.

[0023] Preferably, the EF 10 and PQ5 in a weight ratio of (1-3): (1-2), preferably 1:1; or

[0024] In one or more embodiments of the present invention, when the natural salt-reducing polypeptide combination is PP9 and PQ5, the PP9 strongly binds to the TMC4 receptor, and the PQ5 auxiliary binds to the TMC4 receptor; both polypeptides exhibit the ability to bind to the TMC4 receptor. Among them, the PP9 polypeptide has the characteristic of strong binding to the TMC4 receptor. This strong binding may enable PP9 to effectively simulate or enhance the salty taste perception of food while reducing the amount of salt used, thereby meeting consumers' demand for food flavor. The PQ5 polypeptide exhibits auxiliary binding characteristics with the TMC4 receptor. This auxiliary binding may help regulate or optimize the salt-reducing effect of PP9, and further enhance the overall performance of the salt-reducing polypeptide combination by affecting related taste or metabolic pathways. It should be noted that the auxiliary binding effect of PQ5 may not be limited to binding to the TMC4 receptor. It may also interact with other receptors or molecules to jointly promote the improvement of salt-reduction effects.

[0025] Furthermore, while one or more embodiments of the present invention mention a combination of PP9 and PQ5, this does not necessarily mean that the salt-reducing polypeptide combination of the present invention is limited to these two polypeptides. Depending on specific research and application requirements, other polypeptides with similar or complementary functions may be added to further enrich and enhance the performance and application scope of the salt-reducing polypeptide combination.

[0026] Preferably, the weight ratio of PP9 to PQ5 is (1-3):(1-2), preferably 1:1.

[0027] On the other hand, the present invention also provides a salt-reducing composition, comprising the above-mentioned salt-reducing polypeptide combination and edible salt, wherein the weight ratio of the edible salt to the salt-reducing polypeptide combination is (3-10):1.

[0028] In another aspect, the present invention further provides a use of the above-mentioned natural salt-reducing polypeptide combination or composition in the preparation of low-salt food or food additives, wherein the food additive is preferably a salt reducer or saltiness enhancer.

[0029] In another aspect, the present invention further provides a method for enhancing saltiness or reducing salt, comprising adding the above-mentioned natural salt-reducing polypeptide combination or composition to salt-containing food.

[0030] Compared with the prior art, the natural salt-reducing polypeptide combination and its application of the present invention utilize bioengineering methods to synthesize the salt-reducing polypeptide EF extracted from fermented tofu (FSC), yeast extract, and Stropharia rugosoannulata. 10 , PP9 and PQ5 were synthesized in multiple copies, and codon optimization was performed based on the Pichia pastoris host. 10 After codon optimization of PP9 and PQ5, EF with higher expression level was obtained. 10 , PP9 and PQ5 gene sequences, and constructing vectors with the optimized gene sequences, which were then expressed in Pichia pastoris receptor cells (protease-deficient strain MF001-143) to improve the secretion capacity of salt-reducing polypeptides;

[0031] By homology modeling, the optimal conformation obtained by molecular docking was used as the initial structure, and dynamic simulations were performed on the salt-reducing peptide to explore the salt-reducing peptide EF. 10 , the interaction between PP9 and PQ5 and ENaC and TMC4, the binding and dissociation process between the peptides and the receptors, and the stability of the system during the entire simulation process. Specifically, at least two of the three salt-reducing peptides were combined and molecularly docked on the ENaC sodium ion channel and TMC4 chloride ion channel protein, respectively, to study the interaction mechanism between the salt-reducing peptides and the sodium ion and chloride ion channel proteins.

[0032] The sensory evaluation of the combination of these salt-reducing peptides surprisingly revealed that these combinations of salt-reducing peptides had better salt-reducing effects than the individual salt-reducing peptides EF10, PP9, or PQ5. In addition, they also had a significant freshness-enhancing effect while reducing salt. 10 and PP9, PP9 and PQ5, and EF 10 Compared with the single peptides EF10, PP9 or PQ5, PP9 and PQ5 have significant differences in reducing salt and enhancing freshness, and have a synergistic effect; the combination of salt-reducing peptides EF 10Compared with the standard product, PP9 showed significant differences in salt reduction and freshness enhancement. 80% of the evaluators believed that the saltiness was significantly improved when the salt was reduced by 33.3%. Most importantly, we also found that when a combination of salt-reducing peptides was used, as long as there were both strong TMC4 receptor binding peptides and ENaC receptor binding peptides, it had the best salt reduction effect. Salt-reducing peptide EF 10 The combination of PP9 and the salt-reducing polypeptide combination can produce a significant synergistic effect. This shows that the salt-reducing polypeptide combination of the present invention can be used as a food additive in the future to significantly reduce the amount of salt in food and condiments, and has a good application prospect.

[0033] Therefore, the salt-reducing polypeptide combination of the present invention not only has a highly similar saltiness and taste to table salt, providing consumers with a virtually indistinguishable sensory experience, but also significantly reduces salt concentration while maintaining the original saltiness of the food, truly achieving the innovative goal of "reducing salt without reducing saltiness." This characteristic enables the polypeptide combination of the present invention to significantly enhance the health properties of food when used as a food additive in the future, meeting the modern consumer's pursuit of a low-salt, healthy diet while also fully satisfying consumers' expectations for food flavor and taste.

[0034] Furthermore, the salt-reducing polypeptide combination of the present invention has shown significant advantages in terms of salt reduction effect, taste preservation, and food health promotion. Through scientific proportioning and careful screening, we ensure that the polypeptide combination will not sacrifice the taste and flavor of the food while reducing sodium salt intake, thereby providing consumers with a healthier and more delicious food choice. In addition, the preparation method of the natural polypeptide combination of the present invention has many advantages. The raw materials are cheap, which reduces production costs and makes this healthy food additive easier to promote and apply. At the same time, the yield of salt-reducing polypeptides is high, ensuring the stability of production efficiency and product quality. More importantly, the polypeptide combination of the present invention has a high degree of specificity and can accurately act on relevant taste receptors and metabolic pathways, thereby achieving a more accurate and efficient salt reduction effect.

[0035] In summary, the salt-reducing polypeptide combination of the present invention has demonstrated excellent performance and advantages in many aspects, not only providing consumers with healthier and more delicious food choices, but also providing strong support for the healthy transformation and upgrading of the food industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0037] Figure 1 This is a PCR identification result diagram of the recombinant transformed strain of the salt-reducing polypeptide gene sequence in Example 1 of the present invention, wherein A is the salt-reducing polypeptide EF 10 PCR identification results of recombinant transformed strains of gene sequences, M is nucleic acid marker, 1 is blank control (water), 2 is negative control, 3 is salt-reducing peptide PIC9K-YT-EF 10 4-7 are four single colonies randomly selected from the plate; B is a PCR identification result diagram of the recombinant transformation strain of the salt-reducing polypeptide PP9 gene sequence, M is a nucleic acid marker, 1 is a blank control (water), 2 is a negative control, 3 is a plasmid of the salt-reducing polypeptide PIC9K-YT-PP9, 4-7 are four single colonies randomly selected from the plate; C is a PCR identification result diagram of the recombinant transformation strain of the salt-reducing polypeptide PQ5 gene sequence, M is a nucleic acid marker, 1 is a blank control (water), 2 is a negative control, 3 is a plasmid of the salt-reducing polypeptide PIC9K-YT-PQ5, 4-7 are four single colonies randomly selected from the plate;

[0038] Figure 2 This is a purity analysis chart of the purified recombinant salt-reducing polypeptide by HPLC in Example 2 of the present invention, wherein A is the salt-reducing polypeptide EF 10 A is a graph showing the HPLC purity test results of A, B is a graph showing the HPLC purity test results of salt-reducing polypeptide PP9, and C is a graph showing the HPLC purity test results of salt-reducing polypeptide PQ5;

[0039] Figure 3A is a total quality factor graph of TMC4 in Example 3 of the present invention;

[0040] Figure 3B is a Pull diagram of TMC4 in Example 3 of the present invention;

[0041] Figure 3C is a three-dimensional image of TMC4 in Example 3 of the present invention;

[0042] Figure 4A The salt-reducing polypeptide EF in Example 4 of the present invention 10 3D image of the docking mode with the active site of TMC4 and 2D image of the interaction details between the amino acid residues and the peptide;

[0043] Figure 4B A 3D image of the docking pattern of the salt-reducing polypeptide PP9 and the active site of TMC4 in Example 4 of the present invention and a 2D image of the interaction details between the amino acid residues and the peptide;

[0044] Figure 4C A 3D image of the docking pattern of the salt-reducing peptide PQ5 in Example 4 of the present invention and the active site of TMC4 and a 2D image of the interaction details between the amino acid residues and the peptide;

[0045] Figure 5A The salt-reducing polypeptide EF in Example 5 of the present invention 10 3D image of the docking mode with the active site of ENaC and 2D image of the interaction details between amino acid residues and peptide;

[0046] Figure 5B A 3D image of the active site docking pattern of the salt-reducing polypeptide PP9 and ENaC in Example 5 of the present invention and a 2D image of the interaction details between the amino acid residues and the peptide;

[0047] Figure 5C A 3D image of the active site docking pattern of the salt-reducing peptide PQ5 in Example 5 of the present invention and ENaC and a 2D image of the interaction details between the amino acid residues and the peptide;

[0048] Figure 6 This is a radar chart of sensory evaluation of the salt-reducing polypeptide in Example 6 of the present invention;

[0049] Figure 7 This is a graph showing the results of analyzing the saltiness of a salt-reducing polypeptide using an electronic tongue in Example 7 of the present invention;

[0050] Figure 8 This is a statistical graph showing the significance of the results of analyzing the saltiness of the salt-reducing polypeptide using an electronic tongue in Example 7 of the present invention, wherein * indicates a significant difference, and ** indicates a large significant difference. DETAILED DESCRIPTION

[0051] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention. Detailed Description of the Invention

[0053] The expression host for brasiliensis, Pichia pastoris, has been designated a GRAS (Grade A2) food safety strain by the FDA and is also a safe strain for health food production as required by Chinese law. Furthermore, Pichia pastoris possesses the unique ability to grow with methanol as the sole carbon and energy source. Furthermore, Pichia pastoris boasts the ability to perform high-density fermentations using inexpensive culture media, strict regulation and a very strong promoter, excellent post-translational modification and secretion capabilities, and ease of genetic manipulation. This has led to its widespread adoption as a highly successful heterologous protein expression system for recombinant protein production, particularly in vaccine production (over 5,000 proteins have been successfully expressed to date).

[0054] Unless otherwise specified, “EF 10 " refers to "salt-reducing polypeptide EF 10 ", whose amino acid sequence is EDEGEQPRPF, was isolated from commercial ordinary fermented tofu (FSC) by Chen et al. (J Agric Food Chem. 2021 Sep 8; 69(35): 10272-10280. doi: 10.1021 / acs.jafc.1c03431. Epub 2021 Aug 26.) using multiple chromatographic techniques. It is a flavor peptide with saltiness-enhancing function. Sensory evaluation results showed that the saltiness of 0.4 mg / mL peptide E in 50 mmol / L NaCl solution was comparable to that of 63 mmol / L NaCl solution.

[0055] Unless otherwise specified, "PP9" in this document refers to "salt-reducing polypeptide PP9," whose amino acid sequence is PKLLLLPKP. Shan et al. (J Agric Food Chem. 2022 Nov 30; 70(47): 14898-14906. doi: 10.1021 / acs.jafc.2c06237. Epub 2022 Nov 2) isolated a simple taste peptide from yeast extract using ultrafiltration. In the taste characterization and salt-enhancing effect tests, it was found that (sour taste 0.18 mM) had a strong salt-enhancing effect; and S-curve analysis further confirmed that PKLLLLPKP had an additive effect on salty taste perception.

[0056] Unless otherwise specified, "PQ5" in the text refers to "salt-reducing peptide PQ5", whose amino acid sequence is PHEMQ. It was isolated from Stropharia rugosoannulata by Chen et al. (https: / / doi.org / 10.1016 / j.jfca.2022.104530). Sensory evaluation and electronic tongue analysis showed that the peptide fragment had good umami activity, with an umami threshold between 0.167 and 0.390 mmol / L.

[0057] Unless otherwise specified, "TMC4" or "TMC4 protein" herein refers to "TMC4 receptor".

[0058] Unless otherwise specified, "ENaC" or "ENaC protein" herein refers to "ENaC receptor".

[0059] Unless otherwise specified, "GalaxyRefine" in this article refers to "a technology used for protein structure refinement, mainly to optimize the protein structure through side chain rearrangement", which can significantly improve the accuracy of protein structure and thus provide a more reliable starting model for molecular docking.

[0060] Commonly used molecular docking simulation software includes SYBYL, MOE, AutoDock, and Discovery Studio. We chose Discovery Studio. Compared to other common simulation software, Discovery Studio integrates multiple modules, including molecular docking, pharmacophore identification, virtual screening, quantitative structure-activity relationship, combinatorial chemistry, and protein homology modeling. Its comprehensive and powerful functionality makes it widely used in academia and pharmaceutical companies at all stages of drug design.

[0061] Unless otherwise specified, the reagents and materials in this article can be obtained from regular channels.

[0062] Example 1. Preparation of a Pichia pastoris strain deficient in salt-reducing polypeptide protease

[0063] We used salt-reducing peptide EF 10 (SEQ ID NO: 1, EDEGEQPRPF), PP9 (SEQ ID NO: 2, PKLLLLPKP), and PQ5 (SEQ ID NO: 3, PHEMQ) were designed for multiple copies and codon-optimized. The gene sequences of the codon-optimized salt-reducing polypeptides were synthesized by Nanjing GenScript Gene Co., Ltd. The gene sequences of the different polypeptides after codon optimization are as follows:

[0064] EF 10 The gene sequence of is shown in SEQ ID NO: 4: GAGGACGAAG GCGAGCAACC TAGACCTTTT; the gene sequence of PP9 is shown in SEQ ID NO: 5: PKLLLLPKP; and the gene sequence of PQ5 is shown in SEQ ID NO: 6: PHEMQ.

[0065] Then use the seamless cloning connection method to connect the codon optimized EF 10 The gene sequences of PP9 and PQ5 were constructed into the EcoRI restriction site of the plasmid pPIC9K (Thermo Fisher Product No. V17520). 10, pPIC9K-YT-PP9, pPIC9K-YT-PQ5 were linearized by SaLI digestion, and the linearized products were transformed into protease-deficient Pichia pastoris host strain MF001-143 (the detailed information of this strain has been recorded in patent 202411877517.9, and the deposit number of this strain is CCTCC M 20241743) yeast competent cells. The transformed strain was spread on a YPDS plate containing a final concentration of 4 mg / mL geneticin at 30°C and cultured for 2-4 days, and a single colony was picked for identification. The transformant was confirmed by colony PCR amplification of the target gene, and the results were as follows: Figure 1 As shown in A, B, and C.

[0066] Finally, two transformants were identified for each salt-reducing peptide. The two transformant colonies that were positive for PCR were sequenced by the Shanghai branch of Beijing Qingke Biotechnology Co., Ltd., and the initial recombinant strain MF001-143-YT-EF expressing three salt-reducing peptides was obtained. 10 , MF001-143-YT-PP9, MF001-143-YT-PQ5.

[0067] Example 2. Expression characterization and purity detection of different recombinant salt-reducing polypeptides in protease-deficient Pichia pastoris strains

[0068] (1) Preparation of fermentation seed liquid

[0069] Pick a single yeast colony that is activated and grows well on the YPD plate, inoculate it into 50 mL of sterilized YPD, and place it in a shaker at 30°C and culture it overnight at 250 rpm to activate the strain. Transfer the YPD-activated yeast seed liquid at a ratio of 4% to a 500 mL Erlenmeyer flask containing 100 mL of YPD liquid medium, place it in a shaker at 30°C and culture it overnight at 250 rpm as the seed liquid for fermentation in a 5 L fermentor.

[0070] (2) High-density culture of recombinant yeast strains in 5L fermenters

[0071] The cultured yeast seed liquid was inoculated into a 5L fully automatic mechanical stirring and ventilated fermentation tank (sterilized) at an inoculum volume of 8%, and glycerol was added to start bacterial growth (the volume of the initial culture medium was 2L, sterilized at 121°C for 30 minutes). Bacterial growth stage: 25% concentrated ammonia water was used to control the pH at 5.5, the dissolved oxygen was maintained at (30-60)%, the temperature was controlled at 30°C, the upper limit of the stirring speed was 200r / min, the lower limit was 120r / min, and the ventilation volume was set to 2vvm. After the initial cell density OD600 reached 400, the glycerol addition was stopped. When DO (dissolved oxygen) rebounded to above 80% again, methanol feeding was started to induce fermentation. During the methanol addition phase, the temperature was controlled at 30°C, the pH was maintained at 5.5 using 25% concentrated ammonia, the rotational speed was controlled at 800 r / min, the ventilation volume was controlled at 4 L / min, the pressure was controlled at 0.05 MPa, the ventilation volume was adjusted to 2 vvm, and methanol was added using a variable-speed feed method. The dissolved oxygen level was maintained at 15-25%. The fermentation process was automatically controlled and related data was collected using Bailun BLBIO B control system software.

[0072] (3) Purification process of recombinant salt-reducing polypeptide yeast strain

[0073] The fermentation supernatant after centrifugation and filtration was purified and filtered using the ultrafiltration-nanofiltration membrane filtration system of Hangzhou Zhongqi Environmental Protection Technology Co., Ltd. The membrane core used a ceramic membrane / 1000kDa for pre-filtration to remove bacteria, and then a Xingda ceramic membrane / 30kDa was used for ultrafiltration to remove impurities. Finally, oligofructose gel was used for nanofiltration under pressure (0.2-0.3MPa) to recover soluble salt-reducing polypeptides. The filtration temperature was 20°C. After adding 2 times the volume of pure water to wash the nanofiltration system, the recombinant salt-reducing polypeptide concentrate was obtained. The product was dried and concentrated by freeze-drying, and the obtained powder was weighed and sealed and stored at -20°C for subsequent saltiness detection of salt-reducing polypeptides.

[0074] The purity of the purified recombinant salt-reducing peptide was determined by HPLC, which was performed as described using a ThermoScientific Vanquish HPLC system equipped with 5μm C4(2) A 150 × 4.6 mm column was used. Buffer A (water + 0.1% TFA) was used as the stationary phase, and Buffer B (ACN + 0.1% TFA) was used as the mobile phase. The absorbance at 220 nm was monitored with a UV detector. The column temperature was set to 50°C, and the injection volume was 5 μL. The 10-minute gradient program settings are shown in Table 1 below:

[0075] Table 1

[0076]

[0077] The purity of the purified recombinant salt-reducing polypeptide was analyzed by HPLC. Figure 2 As shown in AC.

[0078] from Figure 2 It can be seen from AC that the EDEGEQPRPF (EF 10 ) The purity of the salt-reducing peptide is 99.0%, the purity of the PKLLLLPKP (PP9) salt-reducing peptide is 99.7%, and the purity of the PHEMQ (PQ5) salt-reducing peptide is 98.2%. The purity of the above salt-reducing peptides can be used for downstream salinity testing experiments.

[0079] Example 3. Analysis of the flavor characteristics of salt-reducing polypeptides

[0080] Salty taste receptors interact with their ligands (salty substances) to generate cellular signaling, thereby exerting their biological functions. This study utilized conventional molecular docking models to dock the molecular interaction mechanism between salt-reducing peptides and TMC4. By docking potential salt-reducing peptides into the active site of the salty taste receptor protein, further screening for salt-reducing peptides was performed. Transmembrane channel-like 4 (TMC4) was selected as the receptor for molecular docking. The amino acid sequence of TMC4 (NP_001138775.2) was obtained from the NCBI database using the NCBI BLAST search tool. The structure of TMC4 was obtained from the PDB database and refined using GalaxyRefine (see Nucleic Acids Res. 2013 Jul;41 (Web Server issue):W384-8.doi:10.1093 / nar / gkt458.Epub 2013 Jun 3). The optimized receptor model was evaluated for model quality using Ramachandran Plot and ERRAT. Ramachandran Plot is mainly used to illustrate the allowed and unallowed conformations of amino acids in proteins or peptides. The most favorable region in the Ramachandran Plot is the region with the most amino acids, which indicates the more reasonable the structure. The unallowed region (blank area with red residues) is the region with the most amino acids. (psi-phi) contains unreasonable amino acids in the structure; ERRAT distinguishes correct and incorrect protein structures through characteristic atoms. The larger the overall quality factor (98.935) of the result value, the closer it is to the high-resolution crystal structure, and the closer it is to the high-resolution crystal structure, the more refined the optimized model.

[0081] The overall quality factor of TMC4 is shown in the figure Figure 3AAs shown, it analyzes the statistics of non-bonded interactions between different atom types and plots the relationship between the error function value and the position of a 9-residue sliding window, which is calculated by comparison with the statistics of highly refined structures; where * indicates that on the error axis, two lines are drawn to indicate the confidence with which regions exceeding this error value can be rejected; ** indicates the percentage of proteins with calculated error values ​​below the 95% rejection limit. Good high-resolution structures usually produce values ​​of 95% or higher. For lower resolutions (2.5 to 3A), the average overall quality factor is about 91%. From Figure 3A The evaluation results show that the overall quality factor obtained is 98.9%

[0082] Ramachandran Turu Figure 3B As shown, according to Figure 3B The specific results are as follows:

[0083]

[0084] Based on the analysis of 118 structures, the resolution is at least 2.0 Angstroms, the R factor is no greater than 20%, and the proportion of a good quality model is expected to be above 90% in the maximum allowed area.

[0085] from Figure 3B The evaluation results show that 98.2% of the residues are located in the most favorable region, 1.6% are in the allowed region, 0.2% are in the loosely allowed region, and 0.0% are in the disallowed region. Taken together, these data confirm that the model is viable.

[0086] Example 4. Molecular dynamics analysis of the interaction mechanism between salt-reducing peptide and TMC4

[0087] The peptide structure was constructed using Chem3D 20.0, and pre-processed using Discovery Studio 2019 (DS). Specifically, the Small Molecules module was selected, hydrogenation was performed, the CHARMm force field was added, the charge mode was set to Momany-Rone mode, and finally the model was saved in mol2 format for future use. At the same time, the optimized receptor was also pre-processed by first removing water molecules and the original ligand. Then, Clean Protein was selected in Prepare Protein in the Macromolecules module to improve the receptor amino acid residues. The CHARMm force field was also added for energy minimization, the Momany-Rone mode was set, and the model was saved in PDB format for future use.

[0088] Molecular docking was performed using the CDOCKER tool of DS for semi-flexible molecular docking. The coordinates of the active site sphere were x = 17.7065, y = 11.7845, z = -14.9743, and the docking radius was 19.7. The docking force field selected was the CHARMm force field, and the PoseClusterRadius was set to 0.5 to ensure that the docking conformation was as diverse as possible. Other parameters were set to default. After the calculation, multiple conformations of a ligand were obtained. The results were analyzed based on the binding energy. The most stable conformation was selected for subsequent molecular dynamics analysis. The changing trends in the types and quantities of protein binding interactions of the three salt-reducing peptides during the simulation were analyzed. The molecular docking results are shown in the figure. Figure 4A -C shown.

[0089] Therefore, from Figure 4A -C It can be seen that the closest binding prediction of theoretical calculation is EF 10 -7.0kcal / mol, PQ5-6.1kcal / mol, PP9-6.7kcal / mol. These data show that EF 10 It binds most tightly to TMC4 and is the most likely polypeptide among the three polypeptides to first occupy the TMC4 binding site and cause a conformational change in the receptor.

[0090] And from Figure 4A -C As can be seen, the data show that the strongest EF 10 The salt-reducing peptide ligand and protein mainly interact through hydrogen bonds, π (Pi) bonds and salt bridges. When it interacts with the TMC4 receptor protein, the ligand and protein form 6 hydrogen bonds, 2 π (Pi) bonds and 4 salt bridges. The main binding sites are: Arg91, Arg104, Asn107, Asp111, Glu133, Glu137 are 6 hydrogen bond sites; two π (Pi) bonds are formed at His103 and Arg130; and Arg126 forms a bond with EF 10 Glu5, Arg129 and EF 10 Glu1 and EF 10 Gln6, and Lys134 with EF 10 Glu3 forms four salt bridges.

[0091] Example 5. Molecular dynamics analysis of the interaction mechanism between salt-reducing peptide and ENaC

[0092] ENaC plays an important role in the salty taste perception of rodents. The present invention uses a molecular docking model to further verify the molecular interaction mechanism between salt-reducing peptides and ENaC. By docking potential salt-reducing peptides to the active site of the salty taste receptor protein, salt-reducing peptides can be further screened. ENaC (amiloride-sensitive sodium channel subunit alpha isoform 3 [Homo sapiens]) was selected as the receptor for molecular docking. The amino acid sequence of ENaC protein (NP_001153047.1) was obtained from the NCBI database using the NCBI BLAST tool to search the sequence. The structure of ENaC was obtained from the PDB database. Molecular docking was performed according to the same steps and methods as in Example 4. The results are as follows. Figure 5A -C shown.

[0093] from Figure 5A -C shows that the binding strengths of the three salt-reducing peptides to ENaC are also different, namely EF 10 The PP9 peptides showed a -6.1 kcal / mol, PQ5 -6.9 kcal / mol, and PP9 -8.7 kcal / mol. Analysis of the types and quantities of protein binding interactions observed during the simulations revealed that the strongest binding, PP9, primarily interacted with the protein through hydrogen bonds and salt bridges. When interacting with the ENaC receptor, the ligand formed six hydrogen bonds and one σ-π (sigma-π) bond. The primary binding sites were Tyr140, Ser269, His296, His298, Arg438, and Tyr444, with a σ-π bond also forming at Pro300.

[0094] Therefore, combined with the results of Example 4, from the energy analysis and binding strength analysis, PP9 has the strongest binding to ENaC, EF 10 The strongest binding was to TMC4. To verify that the combination of the three salt-reducing peptides could achieve a better salt-reduction effect and to explore whether there was a synergistic effect, we conducted sensory evaluation tests on different combinations. This initiative aimed to confirm our hypothesis through practical evaluation and determine the combination ratio that could achieve the optimal salt-reduction effect.

[0095] Example 6. Sensory evaluation of salt-reducing polypeptides

[0096] 1. Sample preparation: Prepare 100 mL of each mixed solution of salt-reducing peptide and NaCl at different concentrations. First, prepare a 3 mg / mL solution without any NaCl addition as the "NaCl solution" as a negative control. Then, prepare the standard and test sample according to the following ratio:

[0097] ① According to 3mg / mL NaCl + 0.1mg / mL salt-reducing peptide EDEGEQPRPF (EF 10 ) was prepared into 100 mL of a mixed solution as standard 1 (J Agric Food Chem. 2021 Sep 8; 69(35): 10272-10280. doi: 10.1021 / acs.jafc.1c03431. Epub 2021 Aug 26.).

[0098] ② Prepare 100 mL of a mixed solution of 3 mg / mL NaCl + 0.1 mg / mL salt-reducing polypeptide PKLLLLPKP (PP9) as standard 2.

[0099] ③ Prepare 100 mL of a mixed solution of 3 mg / mL NaCl + 0.1 mg / mL salt-reducing peptide PHEMQ (PQ5) as standard 3.

[0100] ④ According to 2mg / mL NaCl+0.1mg / mL salt-reducing peptide EDEGEQPRPF (EF 10 ) + 0.1 mg / mL salt-reducing peptide PHEMQ (PQ5) was prepared into a mixed solution as sample 1.

[0101] ⑤2mg / mL NaCl+0.1mg / mL salt-reducing peptide EDEGEQPRPF(EF 10 )+0.1 mg / mL salt-reducing polypeptide PKLLLLPKP (PP9) was prepared into a mixed solution as sample 2.

[0102] ⑥ A mixed solution of 2 mg / mL NaCl + 0.1 mg / mL salt-reducing peptide PHEMQ (PQ5) + 0.1 mg / mL salt-reducing peptide PKLLLLPKP (PP9) was prepared as sample 3.

[0103] ⑦2mg / mL NaCl+0.1mg / mL salt-reducing peptide EDEGEQPRPF(EF 10 )+0.1 mg / mL salt-reducing polypeptide PHEMQ (PQ5)+0.1 mg / mL salt-reducing polypeptide PKLLLLPKP (PP9) was prepared into a mixed solution as sample 4.

[0104] 2. Sample Testing: Ten experienced panelists (5 males and 5 females, aged 22-35 years) trained in appearance, flavor, and texture evaluation conducted a comparative tasting. The sensory evaluations were conducted in a sensory analysis room maintained at a temperature of 22.5±2.5°C and normal lighting. Each panelist was required to abstain from alcohol and smoking. Each panelist worked in separate rooms to ensure that no one interfered with the other's evaluation results. To ensure fairness in the tastings, each sample was assigned three random numbers, and all samples were presented to the panelists in a random order. During the evaluation process, the panelists rinsed their mouths with purified water and then held the samples in their mouths for 2 minutes before spitting them out. The panelists then scored the samples on a 10-point scale based on a pre-set reference standard, with 0-2 indicating very weak saltiness / umami, 4-6 indicating moderate saltiness / umami, 6-8 indicating strong saltiness / umami, and 8-10 indicating very strong saltiness / umami.

[0105] The test results are shown in Tables 2-3 and Figure 6 shown.

[0106] Table 2 Sensory tasting results of salt-reducing peptide combinations

[0107]

[0108] Table 3 Sensory tasting results of salt-reducing peptide combination

[0109]

[0110]

[0111] From the above Table 2-3, and Figure 6 It can be seen that the four salt-reducing polypeptide combinations of the present invention exhibit significant umami-enhancing properties while increasing saltiness compared to Standard Samples 1, 2, and 3. The saltiness and umami taste ranking is Sample 2 > Sample 4 > Sample 3 > Sample 1 > Standard Sample 2 > Standard Sample 3 > Standard Sample 1 > NaCl solution.

[0112] Among them, when comparing Sample 2 with the standard, 80% of the evaluators believed that the saltiness was greatly improved when the salt content was reduced by 33.3%. This shows that the salt-reducing polypeptide combination of the present invention can be used as a food additive in the future to significantly reduce the amount of salt in food and condiments, and has good application prospects.

[0113] Example 7. Electronic tongue analysis of salt-reducing polypeptides

[0114] Electronic tongue is a fast, accurate and unbiased way to evaluate flavor. The salt-reducing effect of the combined salt-reducing peptides was tested using ThinkSenso & Senso electronic tongue. 10 ) was used as the salinity standard to measure the salinity score. The salinity scores of standards 2 and 3 and samples 1, 2, 3, and 4 were measured. Each sample was measured 10 times in parallel and the average value was taken. The results are shown in the figure. Figure 7-8 shown.

[0115] from Figure 7-8 It can be seen that the salty and umami taste ranking of the four groups of samples is: sample 2 > sample 4 > sample 3 > sample 1 > standard product 2 > standard product 3 > standard product 1. The results of the electronic tongue are consistent with the results of the sensory evaluation.

[0116] We found that the four combinations of salt-reducing peptides have better salt-increasing effects and freshness-enhancing properties than standard samples 1, 2, and 3; and the effects of sample 1 are better than those of salt-reducing peptide EF. 10 and PQ5 in terms of salt reduction and freshness enhancement; the effects of sample 2 were better than those of the salt-reducing peptide EF. 10 The salt-reducing effect and freshness-enhancing properties of PP9 are significantly different, indicating that the salt-reducing peptide EF 10 The combination of sample 3 and PP9 not only has the effect of reducing salt and enhancing freshness, but also has obvious synergistic effect; the effect of sample 3 is better than the salt-reducing effect and freshness-enhancing characteristics of salt-reducing peptides PQ5 and PP9, with significant differences, indicating that the combination of salt-reducing peptides PQ5 and PP9 not only has the effect of reducing salt and enhancing freshness, but also has a synergistic effect; the effect of sample 4 is not only better than standard products 1, 2 and 3 respectively, but also has a significant effect, and the effect of sample 4 is also better than sample 1 and sample 3.

[0117] In addition, and most importantly, we also found that when using a combination of salt-reducing peptides, as long as there are both strong TMC4 receptor binding peptides and ENaC receptor binding peptides, its salt-reducing effect is the best. For example, the effect of sample 2 and sample 4 is better than that of sample 1 and sample 3. However, we found that in sample 2, when only the strongest TMC4 receptor peptide (EF 10 ), and the strongest ENaC receptor peptide (PP9), its effect is significantly better than other combinations. It is possible that when these two salt-reducing peptides are present, there is a strong binding tendency, resulting in a good synergistic effect.

[0118] After comparing samples with different combinations of salt-reducing peptides, we found that when all three peptides were present (i.e., sample 4), the effect was slightly inferior to sample 2 containing only two of the peptides, but still better than samples containing only other combinations (samples 1 and 3) or a single peptide (such as EF 10We speculate that this may be because PQ5 does not bind tightly enough to the two relevant receptors, thereby interfering with the expected effects of the other two peptides (possibly the peptides used in combination with PQ5) to a certain extent. Therefore, the overall performance of sample 4 failed to surpass that of sample 2. On the other hand, for the sample containing only EF 10 The single polypeptide sample of , due to its binding to the ENaC receptor, initiates a single signal and may not be able to effectively affect the two related metabolic pathways, resulting in its salt reduction effect being inferior to the carefully proportioned combination formula in Sample 2.

[0119] In summary, our analysis shows that the interaction between peptides and their ability to bind to specific receptors are crucial for achieving the best salt reduction effect. The peptide combination in sample 2 may have just achieved the best synergistic effect, thus showing the best salt reduction effect. Although sample 4 was affected by PQ5's receptor binding, it still achieved the best salt reduction effect by virtue of EF. 10 The synergistic effect of PP9 and PP-1 has achieved good results in salt reduction. We need to deeply understand the interaction mechanism between each peptide and find the optimal combination. This provides ideas for the future development of efficient and precise salt reduction peptide combinations.

[0120] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the invention can be embodied in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as illustrative and non-restrictive, and the scope of the invention is defined by the appended claims, not the foregoing description, and all variations within the meaning and range of equivalents of the claims are intended to be included therein. Any reference sign in a claim should not be construed as limiting the claim to which it relates.

[0121] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. A natural salt-reducing polypeptide composition, the salt-reducing polypeptide composition is composed of salt-reducing polypeptide EF 10 and PP9, the salt-reducing polypeptide EF 10 The binding force of PP9 to TMC4 receptor and ENaC receptor has a binding preference; the EF 10 The amino acid sequence of PP9 is shown in SEQ ID NO: 1: EDEGEQPRPF, and the amino acid sequence of PP9 is shown in SEQ ID NO: 2: PKLLLLPKP.

2. The natural salt-reducing polypeptide composition according to claim 1, characterized in that The EF 10 Both PP1 and PP9 were expressed in protease-deficient Pichia pastoris.

3. The natural salt-reducing polypeptide composition according to claim 1, wherein The EF 10 The gene sequence is shown in SEQ ID NO: 4: GAGGACGAAG GCGAGCAACC TAGACCTTTT; the gene sequence of PP9 is shown in SEQ ID NO: 5: CCTAAATTAT TGTTGTTGCC TAAACCA.

4. The natural salt-reducing polypeptide composition according to any one of claims 1 to 3, characterized in that The EF 10 The PP9 binds strongly to the ENaC receptor and the TMC4 receptor.

5. The natural salt-reducing polypeptide composition according to claim 4, characterized in that The EF 10 The weight ratio of PP9 is (1~3): (1~2).

6. The natural salt-reducing polypeptide composition according to claim 5, characterized in that The EF 10 The weight ratio of PP9 is 1:

1.

7. A salt-reducing composition comprising the natural salt-reducing polypeptide composition according to any one of claims 1 to 6, and further comprising edible salt, wherein the weight ratio of the edible salt to the salt-reducing polypeptide combination is (3-10):

1.

8. Use of the natural salt-reducing polypeptide composition according to any one of claims 1 to 6 or the salt-reducing composition according to claim 7 in the preparation of low-salt food or food additives.

9. The use according to claim 8, characterized in that The food additive is a salt reducing agent or a salty taste enhancer.

10. A method for enhancing saltiness or reducing salt, comprising adding the natural salt-reducing polypeptide composition according to any one of claims 1 to 6 or the salt-reducing composition according to claim 7 to salt-containing food.

Images