Murine mesenchymal stem cell targeting peptide G15 and application thereof

Abstract

The invention provides a mouse bone marrow mesenchymal stem cell targeting peptide G15. The amino acid sequence of the targeting peptide G15 is as follows: Gly Val Ala Leu Gly Asp Asn Leu Ile Leu Leu Leu Asp Ser Gly. The drug carrier can be applied to recruitment and mobilization of in-vivo mesenchymal stem cells in injury-related diseases, and can be combined with the drug carrier to target the mesenchymal stem cells to deliver a specific drug to promote directional differentiation of the in-vivo mesenchymal stem cells so as to achieve a repair level. The invention solves the problems of low survival rate, biocompatibility and the like of in-vitro transplanted bone marrow mesenchymal stem cells, and provides a new thought for targeted therapy of small molecular drug targeted mesenchymal stem cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a mouse bone marrow mesenchymal stem cell targeting peptide G15 and an application thereof. Background Art

[0002] Mesenchymal stem cells are a unique stem cell population that exists in the bone marrow and has multidirectional differentiation potential and self-renewal ability. Due to its multidirectional differentiation potential, low immunity and inducibility, it has broad application prospects in the fields of tissue engineering and regenerative medicine. Mesenchymal stem cells have the ability of multidirectional induction, and even adult mesenchymal stem cells are still inducible. These cells can differentiate into bone cells, chondrocytes, adipocytes, etc. in vitro under a specific induction environment. Therefore, mesenchymal stem cells are widely studied and used in diseases such as bone defects and osteochondral defects.

[0003] However, in actual application, the survival rate of bone marrow mesenchymal stem cells is low when transplanted in vitro, which limits their effectiveness and makes it difficult to achieve therapeutic and preventive effects. Therefore, the development of a targeted peptide that efficiently recruits mesenchymal stem cells in vivo to the site of injury and induces them in a targeted manner is a technical problem that needs to be solved in injury diseases such as bone defects and osteochondral defects. Summary of the invention

[0004] The purpose of the present invention is to provide a mouse bone marrow mesenchymal stem cell targeting peptide G15 and its application, so as to solve the problem that the survival rate of bone marrow mesenchymal stem cells transplanted in vitro in the prior art is low and it is difficult to achieve treatment and prevention effects.

[0005] To achieve the above object, the present invention provides a mouse bone marrow mesenchymal stem cell targeting peptide G15, wherein the amino acid sequence of the targeting peptide G15 is: Gly Val Ala Leu Gly Asp Asn Leu Ile Leu Leu Leu Asp SerGly.

[0006] The present invention also provides a method for preparing the targeting peptide G15 as described above, and the specific preparation process is as follows:

[0007] A. Isolate and culture mouse bone marrow mesenchymal stem cells and synovial fibroblasts to obtain bone marrow mesenchymal stem cells and synovial fibroblasts;

[0008] B. Observe the morphology of mouse bone marrow mesenchymal stem cells;

[0009] C. Flow cytometry was used to detect the purity of mouse bone marrow mesenchymal stem cells;

[0010] D. Amplify VCSM13 helper phage and determine phage titer;

[0011] E. Amplification of Phage-15-mer display library;

[0012] F. Bio-panning, using bone marrow mesenchymal stem cells as target cells and synovial fibroblasts as negative selection cells, after multiple rounds of panning, peptide sequences targeting bone marrow mesenchymal stem cells were screened;

[0013] G. Peptide synthesis: After selecting peptide G15 that appeared repeatedly in the final panning round, it was synthesized using the Fmoc method and subjected to HPLC purification and mass spectrometry analysis;

[0014] H. Flow cytometry was used to verify the targeting of synthetic peptides to bone marrow mesenchymal stem cells.

[0015] Step A specifically includes:

[0016] a1. Extraction and identification of bone marrow mesenchymal stem cells (BMSC): isolate the femur of rats within 1 week old and flush out the bone marrow cells with serum-free medium. After centrifugation, resuspend with red blood cell lysis buffer and lyse for 5 minutes. After centrifugation again, resuspend with αMEM medium containing 10% FBS and culture. Passage for multiple times until there are no impurities and use flow cytometry to identify BMSC.

[0017] a2. Extraction and identification of synovial fibroblasts (FLS): The synovial tissue of rats was isolated and the surrounding soft tissue was removed. The synovial tissue was then cultured in an environment containing synovial fibroblast factors until the synovial fibroblasts grew out along the culture dish. The expression of vimentin in the synovial fibroblasts was then detected using flow cytometry and immunofluorescence for identification.

[0018] Step B specifically includes:

[0019] During the cell culture period, an inverted microscope was used to observe the growth status of bone marrow mesenchymal stem cells. 50,000 cells were cultured in a confocal dish overnight, the culture medium was aspirated, and the cells were washed twice with PBS. They were fixed with 4% paraformaldehyde, and the cytoskeleton of mouse bone marrow mesenchymal stem cells was labeled with phalloidin. Finally, an inverted fluorescence microscope was used to observe and photograph.

[0020] Step C specifically includes:

[0021] Take a dish of bone marrow mesenchymal stem cells that have grown, wash it twice with 0.1M PBS, digest it with trypsin at 37°C for 1 minute, and then terminate the digestion with serum-containing culture medium, collect the cells and centrifuge at 3000rpm for 5 minutes; resuspend it with PBS, count it and divide it into five parts, and mark it as Control, CD29, CD34, CD44, and CD90 respectively; add flow cytometry antibodies at a ratio of 1:1000, incubate it on ice in the dark for half an hour, then wash it three times with PBS to wash away non-specifically bound antibodies, each wash for 5 minutes, and finally detect it by flow cytometry.

[0022] Step D specifically includes:

[0023] d1. Prepare 100 mL of L-M9 solid culture medium and pour into a plate;

[0024] d2. Take out a frozen TG1 strain from the -80℃ refrigerator, sterilize it with ultraviolet light for more than 15 minutes in a clean bench, gently dip the strain with a sterile 200μL pipette tip, streak it on an M9 plate, and culture it at 37℃ for 36 hours;

[0025] d3. After 36 hours of culture, pick a single clone of bacteria and place it in 100 mL of non-resistant 2YT liquid culture medium. Culture it at 37°C and 220 rpm for 5 hours until the culture medium becomes slightly turbid.

[0026] d4. Add 5ul VCSM13 helper phage to the bacterial solution, mix well, and place in a 37°C incubator for 30 minutes to allow the helper phage to fully invade TG1 for amplification. After culturing at 37°C and 220rpm for 1 hour, add karanomycin to a final concentration of 25ug / mL and mix well. Incubate at 37°C and 220rpm overnight.

[0027] d5, centrifuge the bacteria-phage mixture at 5000g for 15 min at 4°C, pour the supernatant into a new 50-mL tube, centrifuge again at 3200g for 15 min at 4°C, pour 40 mL of the supernatant from each tube into a new 50-mL tube, add 0.25 volumes of PEG / NaCl to precipitate the phage, mix by inverting five times, and incubate on ice for at least 5 h;

[0028] d6, centrifuge at 5000 g for 20 min at 4°C, discard the supernatant completely, and drain on filter paper. Add 300 μl of pre-cooled sterile PBS to each tube to resuspend the phages, and transfer to a 1.5 mL centrifuge tube;

[0029] d7. Centrifuge at 20,000 g for 1 min at 4°C and transfer the supernatant to a new sterile 1.5 mL centrifuge tube. Repeat several times until there is no sediment at the bottom of the tube.

[0030] d8. Use lacrofenac resistance plates to titrate the phage concentration.

[0031] Step E specifically includes:

[0032] e1. Take out the phage library from the -80℃ refrigerator, thaw on ice, take 1mL and add it to 10mL AMP+(20ug / mL)2YT medium, shake at 37℃, 200rpm for 1 hour;

[0033] e2. Add 100 mL of AMP+ (100 ug / mL), Tetr+ (20 ug / mL) 2YT medium and shake at 200 rpm for 1 hour;

[0034] e3, join 10 12 pfu of VCSM13 helper phage, incubate at 37°C for 20 min, and shake at 200 rpm for 2 h;

[0035] e4. Add kana+ at a final concentration of 70ug / mL and shake at 37℃, 200rpm overnight;

[0036] e5. The next day, centrifuge at 6000 rpm for 20 min, pour out the supernatant, add 4% PEG8000 and 3% NaCl, mix well, and place on ice for more than 5 hours;

[0037] e6. Dispense into 50 mL centrifuge tubes and centrifuge at 9000 rpm for 25 min. Discard the supernatant, drain and resuspend the precipitate in 1 mL PBS to obtain the packaging library.

[0038] Step F specifically includes:

[0039] f1. Select BMSCs and FLS in the logarithmic growth phase, and replace the culture medium the night before when the cell confluence reaches 70%;

[0040] f2, the synovial fibroblasts FLS growing in the logarithmic growth phase were digested with trypsin and centrifuged at 1000 rpm for 5 minutes before collection;

[0041] f3, negative selection and phage rescue: count the cells and take 2×10 6The synovial fibroblasts were cultured in α-MEM containing 5% FBS until they adhered to the wall, and then the Phage-15-mer display library was taken out of the refrigerator, shaken and mixed, and 10 μL of phage stock solution was taken out with a pipette and added to the culture medium. The phage was gently shaken and incubated at room temperature for 2 hours to allow the phage to fully adsorb the FLS cells. The supernatant was centrifuged and incubated in 10 mL of TG1 in the growth period at 37°C for 1 hour. The bacterial solution was transferred to 100 mL 2YT liquid culture medium and cultured at 37°C 220 rpm for 2 hours. Ampicillin was added to make the final concentration of 50 ug / mL. After continuing to culture at 37°C 220 rpm for 1 hour, 5 ul VCSM13 helper phage was added. After continuing to culture at 37°C 220 rpm for 1 hour, karanomycin was added to make the final concentration of 25 ug / mL. After culturing at 37°C 220 rpm for 18 hours, the rescued phage library was extracted;

[0042] f4, positive screening: by cell counting, take 2×10 6 Bone marrow mesenchymal stem cells were cultured in α-MEM containing 5% FBS until they adhered to the wall. The rescued phage library was added and gently shaken at room temperature for 2 hours to allow the phage to fully adsorb to BMSC. The supernatant was removed by centrifugation. 1 mL of 0.2 mol / L Lycine-HCl (pH 2.2) and 1% BSA were added and gently shaken at room temperature for 10 minutes to elute the phage bound to BMSC. After three times, the supernatant was taken and incubated in TG1 during the growth period at 37°C for 1 hour. The bacterial solution was transferred to 100 mL of 2YT liquid culture medium at 37°C for 220 After 2 hours of rpm culture, ampicillin was added to a final concentration of 50ug / mL. After 1 hour of continuous culture at 37℃ and 220rpm, 5ulVCSM13 helper phage was added and cultured at 37℃ and 220rpm for 1 hour. Then, kalamycin was added to a final concentration of 25ug / mL. After 5 hours of culture at 37℃ and 220rpm, gradient plating was performed on an ampicillin-positive plate. After each round of screening and rinsing away non-specifically bound phages, the phages bound to the surface were eluted and amplified. Four rounds of selection were performed continuously, and the recovery rate gradually stabilized.

[0043] f5. Pick a single clone and culture it in 5 mL AMP+2YT medium for 10 hours for sequencing;

[0044] f6. Based on the sequencing results and amino acid comparison table, the peptide sequence targeting mesenchymal stem cells was inferred.

[0045] The present invention also provides the use of the above-mentioned targeting peptide G15 in recruiting and mobilizing mesenchymal stem cells in vivo to the injury site in injury-related diseases.

[0046] The present invention also provides the use of the above-mentioned targeting peptide G15 in combination with a drug carrier to deliver specific drugs to targeted mesenchymal stem cells.

[0047] Compared with the existing technology, the above technical solution has the following beneficial effects:

[0048] Due to the multidirectional differentiation potential and inducibility of bone marrow mesenchymal stem cells, they are a hot topic in biological tissue engineering and regenerative medicine. Screening with intact cells can fully simulate the interaction of protein molecules under natural conditions, and is more conducive to screening out marker protein polypeptides that specifically bind to target cells. The bone marrow mesenchymal stem cell targeting peptide G15 obtained by phage display technology screening in the present invention has the potential to mobilize and recruit mesenchymal stem cells in vivo. Combining it with related fields of biological tissue engineering can effectively treat injury-related diseases, alleviate the progression of diseases, and solve the problems of low survival rate and biocompatibility of bone marrow mesenchymal stem cells transplanted in vitro;

[0049] The targeting peptide G15 provided by the present invention is a polypeptide having the advantages of low immunogenicity, small relative molecular weight, high clearance efficiency, strong permeability, etc., and the polypeptide has a relatively rich amino acid sequence, has a larger modifiable space, and is easier to be combined with biomedical tissue engineering and regenerative medicine; at the same time, the selected targeting peptide G15 can be used in combination with a drug carrier to improve the targeting of the treatment, and is easier to overcome the cell barrier to enter the cell to exert its effect, providing a new idea for the targeted treatment of mesenchymal stem cells with small molecule drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 This is a diagram of the growth status of bone marrow mesenchymal stem cells observed using an inverted microscope during cell culture;

[0051] Figure 2 This is an observation of bone marrow mesenchymal stem cells under an inverted fluorescence microscope after a series of treatments;

[0052] Figure 3-1 to Figure 3-5 The results of cell flow cytometry analysis of bone marrow mesenchymal stem cell phenotypes; 3-1, 3-2, 3-3, 3-4, and 3-5 are the flow cytometry analysis results of Control, CD29, CD34, CD44, and CD90, respectively;

[0053] Figure 4-1 to Figure 4-3 This is the result of validation of the targeting of targeting peptide G15 and BMSC. DETAILED DESCRIPTION

[0054] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0055] The invention provides a mouse bone marrow mesenchymal stem cell targeting peptide G15, the amino acid sequence of which is Gly Val Ala Leu Gly Asp Asn Leu Ile Leu Leu Leu Asp Ser Gly.

[0056] The targeting peptide G15 provided by the present invention has a good bone marrow mesenchymal stem cell recruitment function, and can recruit and mobilize mesenchymal stem cells in the body to the injury site in injury-related diseases, for example, it can recruit bone marrow mesenchymal stem cells to the defect site in a disease model of osteochondral defect to promote cartilage repair. The injury-related diseases also include bone defect diseases.

[0057] At the same time, the targeting peptide G15 provided by the present invention has a larger modification space, and can be combined with a tissue engineering drug delivery system to deliver specific drugs to targeted mesenchymal stem cells, thereby promoting the directional differentiation of mesenchymal stem cells in vivo and achieving a repair effect.

[0058] The present invention also provides a method for preparing mouse bone marrow mesenchymal stem cell targeting peptide G15, and the specific preparation method is as follows:

[0059] 1. Isolation and culture of mouse bone marrow mesenchymal stem cells and synovial fibroblasts

[0060] (1) Extraction and identification of bone marrow mesenchymal stem cells (BMSC): The femurs of rats less than 1 week old were separated and the bone marrow cells were flushed out with serum-free medium. After centrifugation, the cells were resuspended with red blood cell lysis buffer and lysed for 5 minutes. After centrifugation again, the cells were resuspended with αMEM medium containing 10% FBS and cultured. The cells were passaged multiple times until there were no impurities. BMSC were identified using flow cytometry.

[0061] (2) Extraction and identification of synovial fibroblasts (FLS): The synovial tissue of rats was isolated and the surrounding soft tissue was removed. The synovial tissue was then cultured in an environment containing synovial fibroblast factors until the synovial fibroblasts grew along the culture dish. The expression of vimentin in the synovial fibroblasts was then detected using flow cytometry and immunofluorescence for identification.

[0062] 2. Observation of the morphology of mouse bone marrow mesenchymal stem cells

[0063] During the cell culture period, an inverted microscope was used to observe the growth status of bone marrow mesenchymal stem cells. Figure 1 As shown, 50,000 cells were cultured overnight in a confocal dish, the culture medium was removed, the cells were washed twice with PBS, fixed with 4% paraformaldehyde, and the cytoskeleton of mouse bone marrow mesenchymal stem cells was labeled with phalloidin. Finally, an inverted fluorescence microscope was used to observe and photograph the cells. Figure 2 shown.

[0064] 3. Detection of the purity of mouse bone marrow mesenchymal stem cells using flow cytometry

[0065] Take a dish of bone marrow mesenchymal stem cells that have grown, wash them twice with 0.1M PBS, digest them with trypsin at 37°C for 1 minute, and terminate the digestion with serum-containing culture medium. Collect the cells and centrifuge at 3000rpm for 5 minutes. Resuspend them with PBS, count them and divide them into five parts, labeled as Control, CD29, CD34, CD44, and CD90 respectively. Add flow cytometry antibodies at a ratio of 1:1000, incubate them on ice in the dark for half an hour, and wash them three times with PBS to wash away non-specifically bound antibodies, each wash lasting 5 minutes. Use flow cytometry to detect, and the identification results are as follows Figure 3-1 to Figure 3-5 shown.

[0066] 4. VCSM13-assisted phage amplification and phage titer determination

[0067] (1) Prepare 100 mL of L-M9 solid culture medium and pour into a plate;

[0068] (2) Take out a frozen TG1 strain from a -80°C freezer, sterilize with ultraviolet light for more than 15 minutes in a clean bench, gently dip the strain with a sterile 200 μL pipette tip, streak it on an M9 plate, and culture it at 37°C for 36 hours (VCSM13 phage can only infect E. coli with sex pili encoded by F factor, while E. coli without sex pili cannot grow on M9 plates);

[0069] (3) After culturing for 36 hours, a single clone was selected and placed in 100 mL of non-resistant 2YT liquid medium and cultured at 37°C, 220 rpm for 5 hours until the medium became slightly turbid;

[0070] (4) Add 5 μl of VCSM13 helper phage to the bacterial solution, mix well, and place in a 37°C incubator for 30 minutes to allow the helper phage to fully invade TG1 for amplification. After culturing at 37°C and 220 rpm for 1 hour, add karatomycin to a final concentration of 25 μg / mL and mix well. Incubate at 37°C and 220 rpm overnight.

[0071] (5) Centrifuge the bacteria-phage mixture at 5000 g for 15 min at 4°C, pour the supernatant into a new 50-mL tube, centrifuge again at 3200 g for 15 min at 4°C, pour 40 mL of the supernatant from each tube into a new 50-mL tube, add 0.25 volumes (10 mL) of PEG / NaCl to precipitate the phage, mix by inverting five times, and incubate on ice for at least 5 h;

[0072] (6) Centrifuge the supernatant at 5000 g for 20 min at 4°C, discard the supernatant completely, drain on filter paper, add 300 μl of pre-cooled sterile PBS to each tube to resuspend the phage, and transfer to a 1.5 mL centrifuge tube (1 mL / tube);

[0073] (7) Centrifuge at 20,000 g for 1 min at 4°C and transfer the supernatant to a new sterile 1.5 mL centrifuge tube. Repeat this process several times until there is no precipitate at the bottom of the tube.

[0074] (8) Use lacrofenac resistance plates to titrate the phage concentration.

[0075] 5. Amplification of Phage-15-mer Display Library

[0076] (1) Take out the phage library from the -80°C refrigerator, thaw on ice, take 1 mL and add 10 mL AMP + (20 ug / mL) 2YT medium, shake at 37°C, 200 rpm for 1 hour;

[0077] (2) Add 100 mL of AMP+ (100 ug / mL), Tetr+ (20 ug / mL) 2YT medium and shake at 200 rpm for 1 hour;

[0078] (3) Add 10 12 pfu of VCSM13 helper phage, incubate at 37°C for 20 min, and shake at 200 rpm for 2 h;

[0079] (4) Add kana+ to a final concentration of 70 ug / mL and shake at 200 rpm at 37°C overnight;

[0080] (5) The next day, centrifuge at 6000 rpm for 20 min, pour out the supernatant, add 4% PEG8000 (4 g) and 3% NaCl (3 g), mix well, and place on ice for more than 5 hours;

[0081] (6) Aliquot the solution into 50 mL centrifuge tubes and centrifuge at 9000 rpm for 25 min. Discard the supernatant, drain and resuspend the precipitate in 1 mL PBS to obtain the packaging library.

[0082] 6. Bio-panning

[0083] (1) BMSCs and FLS in the logarithmic growth phase were selected, and the culture medium was replaced the night before when the cell confluence reached 70%;

[0084] (2) Synovial fibroblasts FLS growing in the logarithmic growth phase were digested with trypsin and centrifuged at 1000 rpm for 5 minutes before collection;

[0085] (3) Negative selection and phage rescue: Count the cells and take 2×10 6Synovial fibroblasts were cultured in α-MEM containing 5% FBS until they adhered to the wall, and then the Phage-15-mer display library was taken out of the refrigerator, shaken and mixed, and 10 μL of phage stock solution was taken out with a pipette and added to the culture medium. The phage was gently shaken and incubated at room temperature for 2 hours to allow the phage to fully adsorb FLS cells. The supernatant was centrifuged and incubated in 10 mL of TG1 in the growth phase at 37°C for 1 hour. The bacterial solution was transferred to 100 mL 2YT liquid culture medium and cultured at 37°C 220 rpm for 2 hours. Ampicillin was added to make the final concentration of 50 ug / mL. After continuing to culture at 37°C 220 rpm for 1 hour, 5 ul VCSM13 helper phage was added. After continuing to culture at 37°C 220 rpm for 1 hour, kalamycin was added to make the final concentration of 25 ug / mL. After culturing at 37°C 220 rpm for 18 hours, the rescued phage library was extracted as in step "3";

[0086] (4) Positive screening: Count the cells and take 2×10 6 Bone marrow mesenchymal stem cells were cultured in α-MEM containing 5% FBS until they adhered to the wall, and the rescued phage library was added and gently shaken at room temperature for 2 hours to allow the phage to fully adsorb BMSC. The supernatant was removed by centrifugation, and 1mL 0.2mol / L Lycine-HCl (pH2.2) and 1% BSA were added and gently shaken at room temperature for 10min to elute the phage bound to BMSC. After repeating three times, the supernatant was taken and incubated in TG1 in the growth period at 37°C for 1 hour, and the bacterial solution was transferred to 100mL 2YT liquid culture medium and cultured at 37°C 220rpm for 2 hours, and ampicillin was added to make its final concentration of 50ug / mL. After continuing to culture at 37°C 220rpm for 1 hour, 5ul M13 helper phage was added, and kalamycin was added to make its final concentration of 25ug / mL. After culturing at 37°C 220rpm for 5 hours, gradient plating was performed on ampicillin-positive plates; the number of screening rounds, input amount, and recovery amount are shown in Table 1. After each round of screening, non-specifically bound phages were rinsed away, and the phages bound to the surface were eluted and amplified. Four rounds of selection were performed continuously, and the recovery rate gradually stabilized.

[0087] (5) Single clones were picked and cultured in 5 mL AMP+2YT medium for 10 hours for sequencing;

[0088] (6) Based on the sequencing results and the amino acid comparison table, the peptide sequence targeting mesenchymal stem cells was inferred and synthesized.

[0089] Table 1

[0090]

[0091] 7. Peptide Synthesis Fifteen peptides including peptide G15 that appeared repeatedly in the fourth round of screening were synthesized by Fmoc method, purified by HPLC (purity>95%) and analyzed by mass spectrometry (performed by Sangon Biotech). The specific base sequences and amino acid sequences are shown in Tables 2 and 3.

[0092] Table 2

[0093] Serial number Base sequence frequency 1 TTTTCTCGGAATGTTGTTTTGAATTTTAGGTTTCGTCGTCGTATT 1 2 GGTGTTGCTCTTGGTGATAATCTTATTTTGCTTCTTGATTCTGGT 8 3 ATTCCTTCGGATCTTAATCATTATACGAGTATTAAGATGAATCCT 1 4 GAGTTTGGGATTCCTAGGAAGTCTAGGCGTCTGCCGTCTTCTACT 1 5 GAGGTTCTTCATTTTCTTTGTTATTGTGATGTTTCTACTCATCTT 3 6 TATGGGTGTGGGGGTGTTACGCGTCATGGTAGTGTTTATATTTCG 1 7 TTTCCTGAGCATCCGACTCATGGTAGGCTTCTTCTTCGGCTTACT 2 8 GATCAGTGGGGTGTTCATAAGGTTGATGATTTTTTGCGTAATGTG 1 9 GATTATTTTTCTAGTTCGTATTGGCGTTGTCTTCTGGTGGGGGGG 6 10 CCGTTTCTATGCAGGTGAATATTTTGCCTCTTCCTGGTGGTACT 1

[0094] Table 3

[0095] Serial number Amino acid sequence frequency 1 Phe Ser Arg Asn Val Val Leu Asn Phe Arg Phe Arg Arg Arg Ile 1 2 Gly Val Ala Leu Gly Asp Asn Leu Ile Leu Leu Leu Asp Ser Gly 8 3 Ile Pro Ser Asp Leu Asn His Tyr Thr Ser Ile Lys Met Asn Pro 1 4 Glu Phe Gly Ile Pro Arg Lys Ser Arg Arg Leu Pro Ser Ser Thr 1 5 Glu Val Leu His Phe Leu Cys Tyr Cys Asp Val Ser Thr His Leu 3 6 Tyr Gly Cys Gly Gly Val Thr Arg His Gly Ser Val Tyr Ile Ser 1 7 Phe Pro Glu His Pro Thr His Gly Arg Leu Leu Leu Arg Leu Thr 2 8 Asp Gln Trp Gly Val His Lys Val Asp Asp Phe Leu Arg Asn Val 1 9 Asp Tyr Phe Ser Ser Ser Tyr Trp Arg Cys Leu Leu Val Gly Gly 6 10 Pro Val Ser Met Gln Val Asn Ile Leu Pro Leu Pro Gly Gly Thr 1

[0096] 8. Cell Targeting Verification

[0097] (1) BMSCs and FLS in the logarithmic growth phase were selected, and the culture medium was replaced the night before when the cell confluence reached 70%;

[0098] (2) Synovial fibroblasts FLS and bone marrow mesenchymal stem cells BMSC growing in the logarithmic growth phase were digested with trypsin and centrifuged at 1000 rpm for 5 minutes before collection;

[0099] (3) Take 10 respectively 6 After adding the synthetic peptide at a final concentration of 1uM to the BMSC and FLS, the synthetic peptide was incubated for half an hour and then the targeting of the synthetic peptide to BMSC was verified by flow cytometry. The results of cell targeting verification are shown in Figure 4-1 to Figure 4-3 shown.

[0100] In summary, the present invention uses phage random peptide library and whole cell differential screening technology to screen out bone marrow mesenchymal stem cell targeting peptide G15. Screening using intact cells can fully simulate the interaction of protein molecules under natural conditions, and is more conducive to screening out marker protein polypeptides that specifically bind to target cells. The obtained bone marrow mesenchymal stem cell targeting peptide G15 can, on the one hand, recruit and mobilize mesenchymal stem cells in the body to the site of injury. On the other hand, G15 has a large modification space. When combined with a tissue engineering drug delivery system, it can target mesenchymal stem cells to deliver specific drugs to promote the directional differentiation of mesenchymal stem cells in the body to achieve the repair level.

[0101] The above description is only used to illustrate the technical solution of the present invention rather than to limit it. Other modifications or equivalent substitutions made to the technical solution of the present invention by ordinary technicians in this field should be included in the scope of the claims of the present invention as long as they do not depart from the spirit and scope of the technical solution of the present invention.

Claims

1. A mouse bone marrow mesenchymal stem cell targeting peptide G15, characterized in that: The amino acid sequence of the targeting peptide G15 is: Gly Val Ala Leu Gly Asp Asn Leu Ile Leu Leu Leu Asp Ser Gly.

2. A method for preparing the targeting peptide G15 as claimed in claim 1, characterized in that: The specific preparation process is as follows: A. Isolate and culture mouse bone marrow mesenchymal stem cells and synovial fibroblasts to obtain bone marrow mesenchymal stem cells and synovial fibroblasts; B. Observe the morphology of mouse bone marrow mesenchymal stem cells; C. Flow cytometry was used to detect the purity of mouse bone marrow mesenchymal stem cells; D. Amplify VCSM13 helper phage and determine phage titer; E. Amplification of Phage-15-mer display library; F. Bio-panning, using bone marrow mesenchymal stem cells as target cells and synovial fibroblasts as negative selection cells, after multiple rounds of panning, peptide sequences targeting bone marrow mesenchymal stem cells were screened; G. Peptide synthesis: After selecting peptide G15 that appeared repeatedly in the final panning round, it was synthesized using the Fmoc method and subjected to HPLC purification and mass spectrometry analysis; H. Flow cytometry was used to verify the targeting of synthetic peptides to bone marrow mesenchymal stem cells.

3. The method according to claim 2, characterized in that Step A specifically includes: a1. Extraction and identification of bone marrow mesenchymal stem cells (BMSC): isolate the femur of rats within 1 week old and flush out the bone marrow cells with serum-free medium. After centrifugation, resuspend with red blood cell lysis buffer and lyse for 5 minutes. After centrifugation again, resuspend with αMEM medium containing 10% FBS and culture. Passage for multiple times until there are no impurities and use flow cytometry to identify BMSC. a2. Extraction and identification of synovial fibroblasts (FLS): The synovial tissue of rats was isolated and the surrounding soft tissue was removed. The synovial tissue was then cultured in an environment containing synovial fibroblast factors until the synovial fibroblasts grew out along the culture dish. The expression of vimentin in the synovial fibroblasts was then detected using flow cytometry and immunofluorescence for identification.

4. The method according to claim 2, characterized in that: Step B specifically includes: During the cell culture period, an inverted microscope was used to observe the growth status of bone marrow mesenchymal stem cells. 50,000 cells were cultured in a confocal dish overnight, the culture medium was aspirated, and the cells were washed twice with PBS. They were fixed with 4% paraformaldehyde, and the cytoskeleton of mouse bone marrow mesenchymal stem cells was labeled with phalloidin. Finally, an inverted fluorescence microscope was used to observe and photograph.

5. The method according to claim 2, characterized in that: Step C specifically includes: Take a dish of bone marrow mesenchymal stem cells that have grown, wash it twice with 0.1M PBS, digest it with trypsin at 37°C for 1 minute, and then terminate the digestion with serum-containing culture medium, collect the cells and centrifuge at 3000rpm for 5 minutes; resuspend it with PBS, count it and divide it into five parts, and mark it as Control, CD29, CD34, CD44, and CD90 respectively; add flow cytometry antibodies at a ratio of 1:1000, incubate it on ice in the dark for half an hour, then wash it three times with PBS to wash away non-specifically bound antibodies, each wash for 5 minutes, and finally detect it by flow cytometry.

6. The method according to claim 2, characterized in that Step D specifically includes: d1. Prepare 100 mL of L-M9 solid culture medium and pour into a plate; d2. Take out a frozen TG1 strain from the -80℃ refrigerator, sterilize it with ultraviolet light for more than 15 minutes in a clean bench, gently dip the strain with a sterile 200μL pipette tip, streak it on an M9 plate, and culture it at 37℃ for 36 hours; d3. After 36 hours of culture, pick a single clone of bacteria and place it in 100 mL of non-resistant 2YT liquid culture medium. Culture it at 37°C and 220 rpm for 5 hours until the culture medium becomes slightly turbid. d4. Add 5ul VCSM13 helper phage to the bacterial solution, mix well, and place in a 37°C incubator for 30 minutes to allow the helper phage to fully invade TG1 for amplification. After culturing at 37°C and 220rpm for 1 hour, add karanomycin to a final concentration of 25ug / mL and mix well. Incubate at 37°C and 220rpm overnight. d5, centrifuge the bacteria-phage mixture at 5000g for 15 min at 4°C, pour the supernatant into a new 50-mL tube, centrifuge again at 3200g for 15 min at 4°C, pour 40 mL of the supernatant from each tube into a new 50-mL tube, add 0.25 volumes of PEG / NaCl to precipitate the phage, mix by inverting five times, and incubate on ice for at least 5 h; d6, centrifuge at 5000 g for 20 min at 4°C, discard the supernatant completely, and drain on filter paper. Add 300 μl of pre-cooled sterile PBS to each tube to resuspend the phages, and transfer to a 1.5 mL centrifuge tube; d7. Centrifuge at 20,000 g for 1 min at 4°C and transfer the supernatant to a new sterile 1.5 mL centrifuge tube. Repeat several times until there is no sediment at the bottom of the tube. d8. Use lacrofenac resistance plates to titrate the phage concentration.

7. The method according to claim 2, characterized in that Step E specifically includes: e1. Take out the phage library from the -80℃ refrigerator, thaw on ice, take 1mL and add it to 10mL AMP+(20ug / mL)2YT medium, shake at 37℃, 200rpm for 1 hour; e2. Add 100 mL of AMP+ (100 ug / mL), Tetr+ (20 ug / mL) 2YT medium and shake at 200 rpm for 1 hour; e3, join 10 12 pfu of VCSM13 helper phage, incubate at 37°C for 20 min, and shake at 200 rpm for 2 h; e4. Add kana+ at a final concentration of 70ug / mL and shake at 37℃, 200rpm overnight; e5. The next day, centrifuge at 6000 rpm for 20 min, pour out the supernatant, add 4% PEG8000 and 3% NaCl, mix well, and place on ice for more than 5 hours; e6. Dispense into 50 mL centrifuge tubes and centrifuge at 9000 rpm for 25 min. Discard the supernatant, drain and resuspend the precipitate in 1 mL PBS to obtain the packaging library.

8. The method according to claim 2, characterized in that: Step F specifically includes: f1. Select BMSCs and FLS in the logarithmic growth phase, and replace the culture medium the night before when the cell confluence reaches 70%; f2, the synovial fibroblasts FLS growing in the logarithmic growth phase were digested with trypsin and centrifuged at 1000 rpm for 5 minutes before collection; f3, negative selection and phage rescue: count the cells and take 2×10 6 The synovial fibroblasts were cultured in α-MEM containing 5% FBS until they adhered to the wall, and then the Phage-15-mer display library was taken out of the refrigerator, shaken and mixed, and 10 μL of phage stock solution was taken out with a pipette and added to the culture medium. The phage was gently shaken and incubated at room temperature for 2 hours to allow the phage to fully adsorb the FLS cells. The supernatant was centrifuged and incubated in 10 mL of TG1 in the growth period at 37°C for 1 hour. The bacterial solution was transferred to 100 mL 2YT liquid culture medium and cultured at 37°C 220 rpm for 2 hours. Ampicillin was added to make the final concentration of 50 ug / mL. After continuing to culture at 37°C 220 rpm for 1 hour, 5 ul VCSM13 helper phage was added. After continuing to culture at 37°C 220 rpm for 1 hour, karanomycin was added to make the final concentration of 25 ug / mL. After culturing at 37°C 220 rpm for 18 hours, the rescued phage library was extracted; f4, positive screening: by cell counting, take 2×10 6 Bone marrow mesenchymal stem cells were cultured in α-MEM containing 5% FBS until they adhered to the wall. The rescued phage library was added and gently shaken at room temperature for 2 hours to allow the phage to fully adsorb to BMSC. The supernatant was removed by centrifugation. 1 mL of 0.2 mol / L Lycine-HCl (pH 2.2) and 1% BSA were added and gently shaken at room temperature for 10 minutes to elute the phage bound to BMSC. After three times, the supernatant was taken and incubated in TG1 during the growth period at 37°C for 1 hour. The bacterial solution was transferred to 100 mL of 2YT liquid culture medium at 37°C for 220 After 2 hours of rpm culture, ampicillin was added to a final concentration of 50ug / mL. After 1 hour of continuous culture at 37℃ and 220rpm, 5ulVCSM13 helper phage was added and cultured at 37℃ and 220rpm for 1 hour. Then, kalamycin was added to a final concentration of 25ug / mL. After 5 hours of culture at 37℃ and 220rpm, gradient plating was performed on an ampicillin-positive plate. After each round of screening and rinsing away non-specifically bound phages, the phages bound to the surface were eluted and amplified. Four rounds of selection were performed continuously, and the recovery rate gradually stabilized. f5. Pick a single clone and culture it in 5 mL AMP+2YT medium for 10 hours for sequencing; f6. Based on the sequencing results and amino acid comparison table, the peptide sequence targeting mesenchymal stem cells was inferred.

9. Use of the targeting peptide G15 according to any one of claims 1 to 2 for recruiting and mobilizing mesenchymal stem cells in vivo to the site of injury in injury-related diseases.

10. Use of the targeting peptide G15 according to any one of claims 1 to 2 in combination with a drug carrier for targeted delivery of specific drugs to mesenchymal stem cells.

Images