Moso bamboo PedARF23 gene and application thereof in regulation and control of plant lignin synthesis

Abstract

The invention discloses application of a moso bamboo PedARF23 gene in regulation and control of plant lignin synthesis and plant root development, and belongs to the technical field of gene engineering. The coding of the PedARF23 gene is an amino acid sequence as shown in SEQ ID NO. 2. The lignin content, the main root length, the lateral root number and the lateral root length can be increased by increasing PedARF23 expression, and it is indicated that the gene can be applied to cultivation of plant varieties with high lignin and / or developed roots.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a moso bamboo PedARF23 gene sequence and an application thereof in regulating plant lignin synthesis and plant root development. Background Art

[0002] The root system is an important part of plants. It is not only responsible for absorbing water and mineral nutrients, but also plays an irreplaceable role in fixing plants, supporting the aboveground parts, and interacting with soil microorganisms. A well-developed root system can more effectively obtain water from deep soil and reduce the need for irrigation, especially in arid areas or seasonal water shortages, which helps to alleviate the problem of water shortage. A good root distribution can expand the absorption area of ​​nutrients (such as nitrogen, phosphorus, and potassium), reduce the risk of fertilizer loss, and improve fertilizer utilization, thereby reducing environmental pollution and saving costs. A strong root system makes plants more resistant to the effects of dry environments, and they maintain their life activities by searching deep underground for water sources, ensuring the survival rate of crops under adverse climatic conditions. A stable root system provides better support for plants, prevents lodging caused by wind and rain, and ensures normal growth of crops and final harvest. Active root growth increases soil porosity, improves ventilation, and is conducive to the reproduction of beneficial microorganisms, forming a healthy soil ecosystem. Root residues can be converted into organic matter after decomposition, which helps improve soil fertility in the long run and, as a carbon sink, also plays a positive role in mitigating global warming. Therefore, optimizing root structure and function is crucial to improving crop yield and quality, and enhancing stress resistance and adaptability. In modern agricultural production, facing challenges such as climate change and land degradation, cultivating crop varieties with strong root systems has become one of the key strategies for achieving sustainable development goals.

[0003] With the development of molecular biology techniques and gene editing tools, scientists have been able to understand to some extent how specific genes regulate root development. Lignin is one of the important components of plant cell walls, especially in secondary walls. It gives the root cell walls additional strength and rigidity, allowing the roots to effectively penetrate the soil and provide physical support for the plant. This is essential for the stable growth of the main root and lateral roots. Similar research results not only deepen our understanding of the growth mechanism of plant roots, but also provide a theoretical basis and technical support for the development of new crop varieties. Lignin is involved in the construction of the vascular system, especially the vessel elements in the xylem. These structures are responsible for transporting water and minerals dissolved in them from the roots to the aboveground parts. Healthy lignin synthesis is very important for ensuring efficient water absorption and transport. However, the genetic background of different plants varies greatly. Further discovering new genes that can be used to regulate the development of plant root auxin content and then proposing a new method to optimize crop root structure by regulating the expression of key genes is still very important for promoting the development of green agriculture and meeting the society's growing demand for efficient and environmentally friendly agricultural products. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a bamboo (Phyllostachys edulis) PedARF23 gene and its application in regulating plant root development and cultivating varieties with high nitrogen utilization rate.

[0005] The present invention clones the PedARF23 gene of bamboo, constructs and compares the root length, lateral root number, lateral root length, auxin and lignin accumulation of the PedARF23 overexpression strain and the wild-type strain. The results show that the overexpression strain has advantages in all the above indicators. The PedARF23 gene encodes a nucleotide sequence of the amino acid sequence shown in SEQ ID NO.2. The gene is expected to be applied to genetic engineering breeding of plants, providing a theoretical basis for increasing the lignin content of plant roots and creating new germplasm with strong root systems. Taking into account the degeneracy of codons, the bases of the above nucleotide sequence are modified without changing the amino acid sequence, which also falls within the scope of protection of the present invention.

[0006] In one aspect, the present invention provides a protein for regulating plant root development, characterized in that the sequence of the protein is shown in SEQ ID NO.2.

[0007] Furthermore, a gene for regulating plant root development is provided, characterized in that the gene encodes an amino acid sequence as shown in SEQ ID NO.2.

[0008] Preferably, the gene sequence comprises a nucleotide sequence as shown in SEQ ID NO.1, or comprises a nucleotide sequence that is completely reverse complementary to the sequence shown in SEQ ID NO.1.

[0009] In another aspect, the present invention provides a use of the aforementioned protein or the aforementioned gene in regulating plant root development.

[0010] Furthermore, the regulation of plant root development is to increase the plant root length and / or the number of lateral roots and / or the length of lateral roots by overexpressing the protein described in claim 1 or the gene described in claim 2, or to reduce the plant root length and / or the number of lateral roots and / or the length of lateral roots by reducing the expression of the protein described in claim 1 or the gene described in claim 2.

[0011] Furthermore, the plant is a plant of the family Cruciferae or Poaceae.

[0012] Furthermore, the plant is a plant of the genus Arabidopsis or the genus Phyllostachys.

[0013] Furthermore, the plant is Arabidopsis thaliana or bamboo.

[0014] In another aspect, the present invention provides a use of the aforementioned protein or the aforementioned gene in regulating the lignin content in plant roots.

[0015] Furthermore, the regulation of plant lignin content is to increase the plant lignin content by overexpressing the protein according to claim 1 or the gene according to claim 2, or to reduce the plant lignin content by reducing the expression of the protein according to claim 1 or the gene according to claim 2.

[0016] Furthermore, the plant is a plant of the family Cruciferae or Poaceae.

[0017] Furthermore, the plant is a plant of the genus Arabidopsis or the genus Phyllostachys.

[0018] Furthermore, the plant is Arabidopsis thaliana or bamboo.

[0019] In another aspect, the present invention provides a use of the aforementioned protein or the aforementioned gene in regulating the auxin content in plant roots.

[0020] Furthermore, the regulation of the plant root auxin content is to increase the plant root auxin content by overexpressing the protein described in claim 1 or the gene described in claim 2, or to reduce the plant root auxin content by reducing the expression of the protein described in claim 1 or the gene described in claim 2.

[0021] Furthermore, the plant is a plant of the family Cruciferae or Poaceae.

[0022] Furthermore, the plant is a plant of the genus Arabidopsis or the genus Phyllostachys.

[0023] Furthermore, the plant is Arabidopsis thaliana or bamboo.

[0024] In another aspect, the present invention provides a use of the aforementioned protein or the aforementioned gene in cultivating plant varieties with high lignin content.

[0025] Furthermore, the cultivation of plant varieties with high lignin content is to obtain plant varieties with high lignin content by overexpressing the aforementioned protein or the aforementioned gene.

[0026] Furthermore, the plant is a plant of the family Cruciferae or Poaceae.

[0027] Furthermore, the plant is a plant of the genus Arabidopsis or the genus Phyllostachys.

[0028] Furthermore, the plant is Arabidopsis thaliana or bamboo.

[0029] In another aspect, the present invention provides a use of the aforementioned protein or the aforementioned gene in cultivating plant varieties with well-developed root systems.

[0030] Furthermore, the cultivation of plant varieties with well-developed root systems is to obtain plant varieties with well-developed root systems by overexpressing the aforementioned protein or the aforementioned gene.

[0031] Furthermore, the indicator of a developed root system is an increase in plant root length and / or the number and / or length of lateral roots.

[0032] Compared with the prior art, the present invention has the following advantages: 1) The present invention provides a new protein and its encoding gene, which has the function of regulating plant root length, lateral root number, lateral root length, lignin content and auxin content.

[0033] 2) The present invention provides a new method for regulating plant root length, lateral root number, lateral root length, lignin content and auxin content, namely, increasing plant root length, lateral root number, lateral root length, lignin content and auxin content by increasing the expression of the PedARF23 gene or the protein encoded by it.

[0034] 3) The present invention provides a method for cultivating a new plant variety with a well-developed root system, namely, cultivating a plant variety with a well-developed root system by increasing the expression of the PedARF23 gene or the protein encoded by it.

[0035] 4) The above method can effectively improve the efficiency of crop resource utilization and enhance the crop's resistance to stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The beneficial effects of the present invention are described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0037] Figure 1 Shown is the comparison of primary root length between PedARF23 overexpressing Arabidopsis and wild-type Arabidopsis.

[0038] Figure 2 Shown is the growth and development comparison of lateral roots of PedARF23 overexpressing Arabidopsis and wild-type Arabidopsis; A is the number of lateral roots, B is the length of lateral roots, and C is the density of lateral roots.

[0039] Figure 3 Shown are GUS staining of roots of PedARF23-overexpressing Arabidopsis and wild-type Arabidopsis.

[0040] Figure 4 Shown are GUS activities in roots of PedARF23-overexpressing and wild-type Arabidopsis.

[0041] Figure 5 Shown are the auxin contents of PedARF23-overexpressing Arabidopsis and wild-type Arabidopsis.

[0042] Figure 6 Shown are the lignin contents of PedARF23-overexpressing Arabidopsis and wild-type Arabidopsis.

[0043] Figure 7 Shown are the expression levels of PedARF23 in wild-type and transgenic Arabidopsis. DETAILED DESCRIPTION

[0044] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0045] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by ordinary technicians in the technical field to which this application belongs.

[0046] The nucleotide sequence of the bamboo PedARF23 gene in the embodiment is shown in SEQ ID NO.1: The amino acid sequence of the Phyllostachys edulis PedARF23 protein is shown in SEQ ID NO.2: MTGIDLNTVEEDEEEAEEVATNCSHHSQASSAATGTPPRPSAVCLELWHACAGPVAPLPRKGSVVVYLPQGHLEHLGSAAAGGVSGAPSAAAASAVPPHVFCRVVDVTLHADAATDEVYAQLSLVAENEEVARRLREGTDDGSAGDAEDGDTVKQRFARMPHMFCKTLTASDTSTHGGFSVPRRAAEDCFPPLDYSQQRPSQELVAKDLHGTEWRFRHIYRGQPRRHLLTTGWSAFVNKKKLVSGDAVLFLRGDDGELRLGVRRAAQLKNGSAFPALYKQCANLGTLANVAHAVATKSMFHIYYNPRLSQSEFIVPYWKFMKSLSQPFSVGLRFKMRYESEDAAERRYTGIITGSGDADPMWRGSKWKCLLVRWDDDGEFRRPNRVSPWEIELTSSVSASHLSTPNSKRLKPCLPHVNPEYMVPHGGGRSDFAESALFHKVLQGQELLGFKTHDGAAVATSQPCEARNLQYIDERSCSNDASNSILGVPRLGVRSPLGNPGLSYHCSGFGESQRFQKVLQGQEVFRPYRRTLVDACMRNSGFHQQDGPRAPGMANKWNTQLHGCAFRGLPSPVLPCQSSSPPSVLMFQQANSKISQFEFGHGHLDKNKDDRRARFGPAEGIGRTEQTLPLRPHLVSGEEIDGHAAVEKLHQPVRLGKDGPDNKNVSTNSCKIFGISLTEKVPAREEIDCGDANYPSPFQSLKQQVPKSLGNSCATVHEQRPVVGRVIDVSTMDMMI Example Example 1 Construction of an overexpression vector for the Phyllostachys edulis PedARF23 gene Based on the unigene sequence obtained by previous sequencing in our laboratory, a pair of specific primers PedARF23-F (ATGACGGGGATCGACCTCAACACC) and PedARF23-R (TCAGATCATCATATCCATTGTTGAA) were designed. RNA was extracted from bamboo and reverse transcribed into cDNA. The bamboo was grown in the greenhouse of Nanjing Forestry University. The PCR amplification system was 20 μL: 10 μL PrimeSTAR Max Premix enzyme (TaKaRa, Dalian, China), 7 μL ddH2O, 1 μL template cDNA, and 1 μL each of upstream and downstream primers. The RT-PCR reaction program was: 98 °C pre-denaturation for 3 min; 35 cycles: 98 °C denaturation for 10 s, 54 °C annealing for 30 s, 72 °C extension for 60 s; 72 °C extension for 5 min. The PCR product was recovered using a DNA recovery kit, ligated to the pMD19-T vector, and transformed into Escherichia coli DH5α competent cells. Single colonies were picked for PCR detection, and finally the plasmids were screened and extracted for sequencing (GenScript, Nanjing, China). According to the vector sequence and the PedARF23 gene sequence, specific recombination primers PedARF23-F (GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGACGGGGATCGACCTCAACACC) and PedARF23-R (GGGGACCACTTTGTACAAGAAAGCTGGGTCGATCATCATATCCATTGTTGAA) were designed to amplify the PedARF23 gene. Subsequently, the overexpression vector pB2GW7-PeARF23 was generated by BP and LR recombination reactions using the Gateway cloning system (Invitrogen).

[0047] Example 2 Obtaining and Identifying TdNRX1.1 Transgenic Arabidopsis The recombinant plasmid was sent to Nanjing GenScript Biotechnology Co., Ltd. for sequencing (Nanjing, China). The recombinant plasmid pB2GW7-PeARF23, which was verified by sequencing, was introduced into Agrobacterium tumefaciens strain (GV3101) by electroporation and genetic transformation of Arabidopsis thaliana was performed by floral dipping method (Zhang et al., 2006). Transgenic seedlings were screened using 1 / 2 MS medium containing hygromycin (35 mg / L), and then PCR amplification was performed using specific primers (PedGADPH-qF: CAAGGCTGTTGGCAAGGTTC; PedGADPH-qR: CATATGAGGCAGACTTCTCGATTC; PedARF23-qF:AGGAAAGGATGGACCAGATAACAAA; PedARF23-qR: TCAATCACCCTGCCAACAACA) for further verification. The expression level of PedARF23 in positive transgenic lines was detected by RT-qPCR. RT-qPCR was performed on the Bio-Rad IQ5 fluorescence quantitative PCR platform using the SYBR PreMixEx Taq kit (TaKaRa, Dalian, China). Amplification system: SYBR PreMix Ex Taq 10 μL, dd H2O 7.2 μL, cDNA 2 μL, forward and reverse primers 0.4 μL each. RT-qPCR reaction conditions were: 95 °C 30 s, 95 °C 10 s, 60 °C 20 s, 40 cycles; melting curve analysis range was 65 °C-95 °C, with an increase of 0.5 °C every 5 s to verify amplification specificity. CsTBP was used as an internal reference gene (Wu et al., 2016). Each sample was subjected to 9 biological replicates, according to 2 -ΔΔCT Methods Calculate the relative expression level of genes (Pfaffl, 2001). Three different transgenic lines (OE-1~OE-3) were selected for subsequent experiments ( Figure 7 ).

[0048] Subsequently, the obtained Pro35S:PeARF23 lines were crossed with the DR5::GUS reporter line, and the resulting Pro35S:PeARF23::DR5::GUS lines were selected for further analysis.

[0049] Example 3: Phenotypic analysis of Arabidopsis thaliana overexpressing TdNRX1.1 GUS staining: DR5::GUS and Pro35S:PeARF23::DR5::GUS seeds were germinated on medium containing 10 μM NPA for 6 days and then grown on normal medium for 7 days. Seedlings were immersed in GUS staining solution, which contained 50 mM sodium phosphate (pH 7.0), 10 mM EDTA (pH 8.0), 2 mM potassium ferric chloride, 2 mM potassium ferrous chloride, 0.1% (v / v) Triton X-100, and 2 mM X-Gluc. Samples were vacuum infiltrated for 5 minutes and incubated at 37°C for 12 hours. After staining, the solution was discarded and the seedlings were washed with 70%, 80%, and 90% ethanol in sequence until all chlorophyll was removed. Samples were stored in 90% ethanol at 4°C. The staining results were observed and photographed using a Nikon E100 microscope.

[0050] GUS activity assay: For GUS activity assay, 100 mg of root tissue was collected from each sample and ground in GUS extraction buffer (50 mM potassium phosphate buffer, pH 7.0, 2 mM EDTA, 0.1% Triton X-100). The extracts were centrifuged at 18,000 g for 20 min at 4°C and the supernatant was retained for further analysis. Fluorescence measurements were performed in a 96-well plate using 455 μM 4-methylumbelliferyl-β-D-glucuronide hydrate (Sigma-Aldrich) and performed in a Fluoroskan Ascent FL fluorometer (excitation wavelength 365 nm, emission wavelength 455 nm) at 22°C. Fluorescence was measured after 30 min of reaction and fitted to a standard curve. Enzyme activity was calibrated using a 4-methylumbelliferyl concentration gradient.

[0051] Auxin content determination: Approximately 0.2 g of frozen root sample was dissolved in 2 mL of extraction solvent (propanol, water, and concentrated hydrochloric acid; 2:1:0.002, v / v / v). The mixture was shaken at 150 rpm for 20 min at 4°C and then allowed to stand in the dark at 4°C for 10 h. After incubation, 4 mL of dichloromethane was added to each sample and shaken again at 150 rpm for 20 min. The samples were then centrifuged at 12,000 g for 15 min to obtain two phases. The lower phase (1.8 mL) was transferred to a vacuum concentrator (Eppendorf, Concentrator plus, Germany) and concentrated at 1,800 g, 10 Pa, and 4°C for 2 h. After almost drying, the residue was dissolved in 0.8 mL of 50% methanol and centrifuged again. The supernatant was filtered through a 0.22 μm organic membrane and prepared for analysis. Auxin content was analyzed by ultra-high performance liquid chromatography-tandem mass spectrometry (ACQUITY UPLC Xevo TQD, Waters) with a C18 column (2.1 mm × 100 mm, 1.7 μm; Waters) in positive electrospray ionization (ESI+) mode. The column temperature was set at 45°C and the collision energy was set at 15 V.

[0052] Quantification of lignin content: About 0.2 g of sample was placed in a mortar, and each sample was repeated three times. The sample was homogenized with 1 ml of 95% ethanol, transferred to a 1.5 ml centrifuge tube, and centrifuged at 4500 rpm for 5 minutes. The supernatant was discarded, and the pellet was washed with 95% ethanol, vortexed and centrifuged again. This washing step was repeated three times. It was then washed twice with an ethanol-hexane mixture, and the supernatant was discarded each time. The collected pellet was dried in a 50°C oven overnight. 2 ml of 25% acetic acid-hydrogen bromide solution was added to the dried pellet and mixed thoroughly until completely dissolved. The mixture was incubated in a 70°C water bath for 30 minutes. Immediately after incubation, quenching solution (containing 900 μl of NaOH solution, 2 ml of glacial acetic acid, and 100 μl of 7.5 mM hydroxylamine hydrochloride) was added to the centrifuge tube, and the volume was adjusted to 5 ml with glacial acetic acid. The mixture was centrifuged at 4500 rpm for 5 minutes at room temperature, and the supernatant was transferred to a new centrifuge tube. The absorbance was measured at 280 nm using a preheated spectrophotometer. The relative lignin content was calculated using the wild type (WT) and the control as reference standards (set to 1).

[0053] Phenotypic analysis showed that pro35S:PedARF23 transgenic lines promoted taproot elongation ( Figure 1 ) and lateral root growth ( Figure 2 ), the length and number of lateral roots increased significantly. GUS staining showed that PedARF23 was distributed throughout the root, with the highest content in the root tip ( Figure 3). GUS activity assay showed that the GUS activity in pro35S:PedARF23 DR5::GUS was higher than that in DR5::GUS ( Figure 4 ) Figure 5 ) and lignin ( Figure 6 ) content determination results showed that the levels of auxin and lignin in the root tip of the pro35S:PedARF23 transgenic line were significantly higher than those in the wild-type (WT) line.

[0054] According to the disclosure and teaching of the above description, those skilled in the art to which the present invention belongs may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although some specific terms are used in this specification, these terms are only for the convenience of description and do not constitute any limitation to the present invention.

Claims

1. A protein for regulating plant root development, characterized in that: The sequence of the protein is shown in SEQ ID NO.

2.

2. A gene that regulates plant root development, characterized in that: The gene encodes the amino acid sequence shown in SEQ ID NO.

2.

3. Use of the protein according to claim 1 or the gene according to claim 2 in regulating plant root development.

4. The use according to claim 3, characterized in that: The regulation of plant root growth is to increase plant root length, and / or the number of lateral roots, and / or the length of lateral roots by overexpressing the protein described in claim 1 or the gene described in claim 2, or to reduce plant root length, and / or the number of lateral roots, and / or the length of lateral roots by reducing the expression of the protein described in claim 1 or the gene described in claim 2.

5. Use of the protein according to claim 1 or the gene according to claim 2 in regulating the lignin content of plants.

6. The use according to claim 5, characterized in that: The regulating of plant lignin content is to increase the plant lignin content by overexpressing the protein according to claim 1 or the gene according to claim 2, or to reduce the plant lignin content by reducing the expression of the protein according to claim 1 or the gene according to claim 2.

7. Use of the protein according to claim 1 or the gene according to claim 2 in regulating the content of plant auxin.

8. The use according to claim 7, characterized in that: The regulating of auxin content is to increase the auxin content by overexpressing the protein of claim 1 or the gene of claim 2, or to reduce the auxin content by reducing the expression of the protein of claim 1 or the gene of claim 2.

9. Use of the protein according to claim 1 or the gene according to claim 2 in breeding plant varieties with high lignin content.

10. Use of the protein according to claim 1 or the gene according to claim 2 in cultivating plant varieties with well-developed root systems.

Images