Mould capable of generating fruit wine fragrance and application thereof

Abstract

The invention provides a mould capable of generating fruit wine fragrance and application thereof. Specifically, the invention provides a strain of Xerochryum sp., and the strain of Xerochryum sp. Has a preservation number of CCTCC (China Center for Type Culture Collection) NO: M 2024349. The Xerochryum sp. Strain is named as HLY001, can be fermented to generate fruit wine fragrance, and can be applied to preparation of food and / or food additives.

Description

Technical Field

[0001] The invention relates to a mold and an application thereof, in particular to a Xerochrysium sp. strain capable of fermenting to produce a fruit wine aroma and an application thereof in preparing food and / or food additives. Background Art

[0002] In the field of food and food additive technology, there are relatively few research reports on Xerochrysium sp. strains and their applications.

[0003] CN118240924A discloses the presence of Xerochrysium sp. microbial colonies in tangerine peel. CN116426352A discloses the presence of Xerochrysium sp. microbial colonies in Hakka wine koji. However, these prior arts do not provide further classification and identification of Xerochrysium sp. microorganisms, nor disclose the contribution of the Xerochrysium sp. microorganisms to the food. Summary of the invention

[0004] The inventor of this case discovered a strain of Xerochrysium sp. isolated from strawberry in his research. The strain is numbered HLY001 in the present invention. It can produce fruit wine aroma and can be used to prepare food and / or food additives. According to ITS rDNA identification, the ITS rDNA gene sequence (SEQ ID NO.1) of the strain HLY001 has the highest similarity with the related species in NCBI, which is Xerochrysium xerophilum CBS153.67 T (NR 154476) 91.3%, followed by Xerochrysium dermatitidis CBS132.31 T (MH855157) 88.8%; indicating that the strain HLY001 of the present invention belongs to a new species of Xerochrysium sp. The strain HLY001 of the present invention has been deposited in the China Center for Type Culture Collection (CCTCC) (address of the deposit unit: Wuhan University, Wuhan, China, zip code: 430072), deposit date: February 28, 2024; deposit number: CCTCC NO: M2024349; classification name: Xerochrysium sp.

[0005] ITS rDNA sequence of Xerochrysium sp. HLY001 (SEQ ID NO. 1):

[0006] GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCTTTCAAGCTTCGTTCTTCGAAGCGCCCAACCTCCCACCCGTGACTATTGTACCGTACGTTGCTTCGGCGCGGCCGCTGCGCCCGCCGGAGACACTCTCCTG AATGCTGTTCTATTGAAAGGGAATTGCAGTCTGAGTCGACCAACGAAAAATTGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTG CCCTCAAGCACGGCTTGTGTGTTGGACCGTCGTCCCGCCGCTTCGGTGGGACGGGCCCGAAAGGCAGTGGCGGCACCGGTATCCGGTCCTCGAGCGCATGGGGCTTTGTCACCCGCTCCGTAGGCCGGACCGGAGCCCGCCGGCTCCCCCTTTATTTATCTTTTGAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

[0007] Thus, in one aspect, the present invention provides a Xerochrysium sp. strain having a deposit number of CCTCCNO:M2024349.

[0008] On the other hand, the present invention further provides a bacterial preparation, which contains the Xerochrysium sp. strain HLY001 described in the present invention (ie, the strain with a deposit number of CCTCC NO: M2024349, or referred to as Xerochrysium sp. HLY001).

[0009] According to a specific embodiment of the present invention, the bacterial preparation of the present invention may be in the form of live bacteria or inactivated bacteria, and may be a liquid preparation or a solid preparation.

[0010] On the other hand, the present invention also provides a postbiotic, which is a postbiotic containing bacteria and metabolites obtained by fermenting the strain HLY001 described in the present invention in a culture medium, or a postbiotic containing a fermentation product.

[0011] In the present invention, the postbiotics refer to the general term for metabolites obtained by fermentation culture of bacterial strains, and may contain bacterial cells or metabolically active substances obtained by further removing bacterial cells.

[0012] According to a specific embodiment of the present invention, in the present invention, the fermentation product obtained by fermenting and culturing the Xerochrysium sp. HLY001 in a culture medium is a postbiotic containing bacteria and metabolites; or, the fermentation product is further centrifuged and / or filtered to remove the product of the bacteria, for example, the fermentation liquid supernatant is further collected by centrifugation and filtered with a filter membrane to obtain the postbiotic containing metabolites without the bacteria; optionally, the postbiotic can be further dried to prepare a powder.

[0013] On the other hand, the present invention also provides a method for culturing the Xerochrysium sp. HLY001, the method comprising:

[0014] The Xerochrysium sp. HLY001 is inoculated into a culture medium for fermentation culture.

[0015] The Xerochrysium sp. HLY001 of the present invention can grow in a common mold culture medium, but the growth is relatively slow.

[0016] According to a specific embodiment of the present invention, when the Xerochrysium sp. HLY001 of the present invention is fermented and cultured in a culture medium, the culture medium may be a hypertonic culture medium.

[0017] According to a specific embodiment of the present invention, when the Xerochrysium sp. HLY001 of the present invention is fermented and cultured in a culture medium, the water activity (Aw) of the culture medium is above 0.70, preferably 0.70-0.94.

[0018] According to a specific embodiment of the present invention, the culture medium of Xerochrysium sp. HLY001 of the present invention contains 0-70% sugar, and the sugar can be one or more of monosaccharides, disaccharides or polysaccharides.

[0019] According to a specific embodiment of the present invention, the culture medium of Xerochrysium sp. HLY001 of the present invention may contain 0-5% protein.

[0020] According to a specific embodiment of the present invention, the culture medium of Xerochrysium sp. HLY001 of the present invention may contain an appropriate amount of fruit raw materials, for example, 0%-2% of strawberry powder.

[0021] According to a specific embodiment of the present invention, the hypertonic culture medium can be any feasible hypertonic culture medium in the prior art, such as commercially available DG18, etc. The hypertonic culture medium of the present invention can also be prepared by adding an appropriate amount of white sugar to a conventional mold liquid culture medium and adjusting the water activity as required. Specifically, glycerol can be used to regulate the water activity of the culture medium.

[0022] In some more specific embodiments of the present invention, the hypertonic culture medium of the present invention can be prepared according to the following proportions: 5 g of peptone, 10 g of glucose, 2 g of strawberry powder, 1 g of potassium dihydrogen phosphate, 0.5 g of magnesium phosphate, 0.1 g of chloramphenicol, 400 g of white sugar, and 600 g of distilled water.

[0023] The Xerochrysium sp. HLY001 of the present invention is a facultative anaerobic bacterium.

[0024] According to a specific embodiment of the present invention, when the Xerochrysium sp. HLY001 of the present invention is fermented and cultured in a culture medium, the culture condition is aerobic culture.

[0025] According to a specific embodiment of the present invention, the Xerochrysium sp. HLY001 of the present invention grows in a culture medium at 25°C-35°C, and the optimum growth temperature is 30°C.

[0026] According to a specific embodiment of the present invention, the Xerochrysium sp. HLY001 of the present invention can grow in a neutral to acidic environment, and in particular has good acid resistance and can grow in an environment of pH 3.5.

[0027] On the other hand, the present invention also provides the use of the Xerochrysium sp. HLY001, the bacterial preparation or the postbiotic in the preparation of food and / or food additives.

[0028] According to a specific embodiment of the present invention, in the present invention, the food includes one or more of alcoholic beverages (such as fruit wine, popsicles, ice cream, etc.), fermented glutinous rice, condiments (such as fruit vinegar, jam, etc.), baked goods (such as fruit-flavored bread, etc.), and candies (such as wine-filled soft candies, wine-filled chocolates, etc.).

[0029] According to a specific embodiment of the present invention, in the present invention, the food additives include additives for solid-state fermented foods (such as leavening agents and flavoring agents for bread), etc.

[0030] According to a specific embodiment of the present invention, when used in the preparation of alcoholic beverages, Xerochrysium sp. HLY001 can enhance the fruity and floral flavors of the beverages.

[0031] According to a specific embodiment of the present invention, the Xerochrysium sp. HLY001 of the present invention is applied to the preparation of fermented glutinous rice, which can improve the complex aroma, thereby enhancing the sensory quality of the fermented glutinous rice, and ultimately achieving the effect of improving the market competitiveness of the fermented glutinous rice product and achieving the effect of improving the quality and efficiency of the fermented glutinous rice industry.

[0032] According to a specific embodiment of the present invention, the Xerochrysium sp. HLY001 of the present invention is applied to solid-state fermentation, a solid bacterial preparation can be prepared and used in a solid-state fermentation process, the utilization rate of protein in solid-state fermentation can be increased, and the content of aroma components in wine can be improved.

[0033] According to a specific embodiment of the present invention, the Xerochrysium sp. HLY001 of the present invention is used to prepare condiments, and the special fragrance produced during the breeding process can be used in condiments.

[0034] According to a specific embodiment of the present invention, the Xerochrysium sp. HLY001 of the present invention is used to prepare baked products, and its fermented dough can be used to produce a fermented aroma with fruity and floral aromas.

[0035] According to a specific embodiment of the present invention, when making wine-flavored candies in the present invention, Xerochrysium sp. HLY001 can enhance the fruity and floral flavors of the candies.

[0036] On the other hand, the present invention also provides a food, which contains the Xerochrysium sp. HLY001, the bacterial preparation or the postbiotics described in the present invention.

[0037] According to a specific embodiment of the present invention, the food of the present invention may be an alcoholic beverage, fermented glutinous rice, baked or confectionery food.

[0038] In summary, the present invention provides a new species of Xerochrysium sp., strain HLY001, which can ferment to produce fruit wine aroma and can be used in the preparation of food and / or food additives. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is a bacterial morphology diagram of the Xerochrysium sp. strain HLY001 of the present invention.

[0040] Figure 2 This is the morphology of Xerochrysium sp. strain HLY001 cultured on PDA for 7 days.

[0041] Figure 3This is the morphological picture of Xerochrysium sp. strain HLY001 cultured in PDA+S40 for 7 days.

[0042] Figure 4 This is the morphological diagram of Xerochrysium sp. strain HLY001 cultured in PDA+S60 for 7 days.

[0043] Figure 5 This is the morphological picture of Xerochrysium sp. strain HLY001 cultured in EMA + 10% Nacl for 7 days.

[0044] Figure 6 This is the morphology of Xerochrysium sp. strain HLY001 cultured in M60Y for 7 days.

[0045] Figure 7 This is the morphology of Xerochrysium sp. strain HLY001 cultured in CY20S for 7 days.

[0046] Figure 8 This is the morphology of Xerochrysium sp. strain HLY001 cultured in DG18 for 7 days.

[0047] Fig. 9 This is the morphology of Xerochrysium sp. strain HLY001 cultured in CYA for 7 days.

[0048] Fig.10 This is the morphology of Xerochrysium sp. strain HLY001 cultured in MEA for 7 days.

[0049] Fig.11 This is the phylogenetic tree of strain HLY001 constructed based on the ITS rDNA gene sequence.

[0050] Fig.12 The results of GCMS detection of odorous substances produced during the reproduction of strain HLY001 in a specific embodiment of the present invention are shown.

[0051] Deposit of biological material for patent procedure:

[0052] Xerochrysium sp. strain HLY001:

[0053] Deposit date: February 28, 2024;

[0054] Depository: China Center for Type Culture Collection (CCTCC);

[0055] Address of the depository: Wuhan University, Wuhan 430072, China;

[0056] Deposit number: CCTCC NO:M2024349;

[0057] Taxonomic nomenclature: Xerochrysium sp. DETAILED DESCRIPTION

[0058] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention.

[0059] When the embodiment gives a numerical range, it should be understood that, unless otherwise specified in the present invention, the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art.

[0060] In addition to the specific methods, equipment, reagents and materials used in the embodiments, according to the technical personnel in this technical field's understanding of the prior art and the description of the present invention, any methods, equipment and materials of the prior art that are similar or equivalent to the methods, equipment and reagents and materials described in the embodiments of the present invention can also be used to implement the present invention.

[0061] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the technical field.

[0062] For easier understanding of the present invention, some technical and scientific terms are specifically defined below. Unless otherwise specifically defined herein, all other technical and scientific terms used herein have the meanings commonly understood by those skilled in the art.

[0063] In this specification, the references to "some specific / preferred embodiments", "other specific / preferred embodiments", "embodiments", "implementations", etc. refer to specific elements (e.g., features, structures, properties and / or characteristics) related to the embodiments / implementations described herein, which are included in at least one embodiment described herein, and may or may not exist in other embodiments. In addition, it should be understood that the elements may be combined in various embodiments in any suitable manner.

[0064] In each embodiment, the general ethanol quantitative detection and flavor analysis method is as follows:

[0065] 1. Ethanol quantitative analysis method:

[0066] Instrument model: GC-FID 7890A

[0067] Instrument conditions:

[0068] Chromatographic column: HP-INNOWax, 30m, Agilent

[0069] Inlet temperature: 230°C

[0070] Temperature gradient: 60℃ for 1min, increase to 160℃ at 20℃ / min and hold for 2min, increase to 220℃ at 15℃ / min and hold for 10min

[0071] Detector conditions: heater 240℃ H2 flow 40ml / min air flow 350ml / min

[0072] Pre-treatment conditions:

[0073] Directly pass through 0.45 water system membrane into the instrument, or dilute it a certain multiple into the instrument

[0074] Test principle:

[0075] The ethanol in the sample is extracted with water, and the extract is filtered and then determined by gas chromatography and quantified by external standard method.

[0076] 2. Flavor analysis method:

[0077] SPME-GCMS

[0078] Experimental process:

[0079] Weigh 10.00g of sample into a 40mL glass bottle, balance at 60℃ for 15min, extract with SPME head at 60℃ for 45min, remove the SPME head and put it into GCMS, analyze at 230℃ for 5min

[0080] GC-MS conditions:

[0081] (1) GC conditions:

[0082] Flow rate: 1ml / min

[0083] Chromatographic column: HP-5MS 30m, 0.25mm, 0.25um

[0084] Heating program:

[0085] Start temperature 40℃ hold 3min

[0086] 2.5℃ / min---140℃hold 0min

[0087] 10℃ / min---150℃hold 0min

[0088] 25℃ / min---230℃hold 6min

[0089] 35℃ / min---40℃

[0090] (2) MS conditions: mass spectrometer interface temperature was 230°C, ion source temperature was 230°C, ionization mode was EI, ion energy was 70 eV, scanning mass range was 45-500u, and solvent delay time was 0.5 min.

[0091] Instruments and equipment:

[0092] Gas chromatography-mass spectrometry model: Agilent 8890-7000D

[0093] Solid phase microextraction head model: DVB / CAR / PDMS.

[0094] Example 1: Screening and identification of Xerochrysium sp. strain HLY001

[0095] The invention freeze-dries strawberries, dilutes them 10 times, and simultaneously pours a culture medium PDA+40% white sugar for culturing for 5 days. It is found that white colonies grow in the PDA+40% white sugar culture medium and have obvious wine aroma. The strain producing the wine aroma is numbered as strain HLY001 in the invention.

[0096] The strain HLY001 of the present invention has been deposited in the China Center for Type Culture Collection (CCTCC) (address of the deposit unit: Wuhan University, Wuhan, China, zip code: 430072), deposit date: February 28, 2024; deposit number: CCTCC NO: M2024349; classification name: Xerochrysium sp.

[0097] Identification of the HLY001 strain of the present invention:

[0098] 1. Morphology: The microbial morphology of the new strain Xerochrysium sp. HLY001 under a microscope can be found in Figure 1 , which is white mycelium.

[0099] 2. Culture conditions: 30°C, hypertonic culture medium, 72h to 7 days.

[0100] 3. Physiological and biochemical characteristics:

[0101] The Xerochrysium sp. strain HLY001 of the present invention was cultured in different culture media, and the bacterial morphology was shown in Figure 2-Figure 10 .

[0102] Figure 2This is a morphological picture of Xerochrysium sp. strain HLY001 cultured on PDA for 7 days. The colony diameter is 3-5 mm. The colony is white, dense, and round. The hyphae have no septa and are 2-5 μm in diameter. Spores are formed at the top and the spores are oval.

[0103] Figure 3 This is a morphological picture of Xerochrysium sp. strain HLY001 cultured in PDA+S40 for 7 days. The colony diameter is 18-20mm, the colony is white and slightly yellow, flocculent, and the colony is round. The hyphae have no septa, with a diameter of 2-5μm, and spores are formed at the top, and the spores are oval.

[0104] Figure 4 This is a morphological picture of Xerochrysium sp. strain HLY001 cultured in PDA+S60 for 7 days. The colony diameter is 8-10mm, the colony is white with a yellowish tint, dense and flocculent, and the colony is round. The hyphae have no septa, and spores are formed at the top, and the spores are oval.

[0105] Figure 5 This is a morphological picture of Xerochrysium sp. strain HLY001 cultured in EMA + 10% NaCl for 7 days. The colony diameter is 6-10mm. The colony is white, dense, and round. The hyphae are without septa, with a diameter of 2-5μm, and spores are formed at the top. The spores are oval.

[0106] Figure 6 This is a morphological picture of Xerochrysium sp. strain HLY001 cultured in M60Y for 7 days. The colony diameter is 3-5mm. The colony is white, dense, and round. The hyphae are non-septate, with a diameter of 2-5μm, and spores are formed at the top. The spores are oval.

[0107] Figure 7 This is a morphological picture of Xerochrysium sp. strain HLY001 cultured in CY20S for 7 days. The colony diameter is 2-4mm. The colony is white, dense, nearly round, and the edge of the colony is not smooth. The hyphae are without septa, with a diameter of 2-5μm, and spores are formed at the top. The spores are oval.

[0108] Figure 8 This is a morphological picture of Xerochrysium sp. strain HLY001 cultured in DG18 for 7 days. The colony diameter is 12-15mm. The colony is white, velvety, round, and diffuse at the edge. The hyphae are septate, 2-5μm in diameter, and spores are formed at the top. The spores are oval.

[0109] Fig. 9This is a morphological picture of Xerochrysium sp. strain HLY001 cultured in CYA for 7 days. The colony diameter is 1-2mm. The colony is white, dense, and irregular in shape. The hyphae are non-septate, 2-5μm in diameter, and spores are formed at the top. The spores are oval.

[0110] Fig.10 This is a morphological picture of Xerochrysium sp. strain HLY001 cultured in MEA for 7 days. The colony diameter is 3-6mm. The colony is white, dense, and irregular in shape. The hyphae are without septa, with a diameter of 2-5μm, and spores are formed at the top. The spores are oval.

[0111] It can be seen that the Xerochrysium sp. strain HLY001 of the present invention grows very slowly in common fungal culture media (potato dextrose agar PDA, Czapek medium CYA, malt extract agar MEA), and the morphological diagrams show that Figure 2 , Fig. 9 , Fig.10 It can grow rapidly in a hypertonic environment (potato dextrose agar + 40% white sugar PDA + S40, potato dextrose agar + 40% white sugar PDA + S60, malt extract agar + 10% sodium chloride EMA + 10% Nacl, chloranil 18% glycerol medium DG18), and the morphology can be seen Figure 3 , Figure 4 , Figure 5 , Figure 8 , it can produce alcohol and have a wine aroma when growing.

[0112] a) Hyperosmotic tolerance: Aw 0.7 can grow

[0113] Add the basic culture medium (5g peptone, 10g glucose, 1g potassium dihydrogen phosphate, 0.5g magnesium phosphate, 0.1g chloramphenicol, 400g white sugar, 600g distilled water) to the mold liquid culture medium, and then add different amounts of glycerol to the basic culture medium to adjust the culture medium to different water activities. After high-pressure sterilization, the Xerochrysium sp. HLY001 bacterial suspension was inoculated in various culture media and placed in a 30°C incubator for 2 months before observation. The results are shown in Table 1.

[0114] Table 1

[0115] A 0.9203 0.8637 0.7731 0.7694 0.7585 0.7455 Growth status Growth Growth Growth Growth Growth Growth A 0.7465 0.7401 0.7351 0.7283 0.7077 0.6814 Growth status Growth Growth Growth Growth Growth No growth

[0116] b) Temperature tolerance: can grow at 35℃

[0117] 40% white sugar was added to potato glucose agar as a culture medium (5 g potato extract, 20 g glucose, 15 g agar, 0.1 g chloramphenicol, 400 g white sugar, 600 g distilled water), sterilized by high pressure, poured into a sterile plate, cooled and solidified, Xerochrysium sp. HLY001 was inoculated on the culture medium, and cultured at 25°C, 30°C, and 35°C for 5 days, and the diameter of the colony was measured. The results are shown in Table 2.

[0118] Table 2

[0119] Cultivation temperature 25℃ 30℃ 35℃ Colony size 8mm*8mm 15mm*15mm 8mm*8mm

[0120] c) pH tolerance: can grow at pH 3.5

[0121] 40% white sugar was added to the mold liquid culture medium as the basic culture medium (5g peptone, 10g glucose, 1g potassium dihydrogen phosphate, 0.5g magnesium phosphate, 0.1g chloramphenicol, 400g white sugar, 600g distilled water), and after high pressure sterilization, different amounts of 1 mol / L sterile hydrochloric acid solution were added to the basic culture medium; Xerochrysium sp. HLY001 bacterial suspension was inoculated on each culture medium, placed in a 30°C incubator and cultured for 2 months before observation. The results are shown in Table 3.

[0122] Table 3

[0123] Culture pH pH 2.52 pH 3.02 pH 3.51 pH 4.03 pH 4.49 pH 5.33 Growth status No growth No growth Growth Growth Growth Growth

[0124] 4. ITS rDNA identification:

[0125] ITS rDNA sequence of Xerochrysium sp. HLY001 (SEQ ID NO. 1):

[0126] GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCTTTCAAGCTTCGTTCTTCGAAGCGCCCAACCTCCCACCCGTGACTATTGTACCGTACGTTGCTTCGGCGCGGCCGCTGCGCCCGCCGGAGAC ACTCTCCTGAATGCTGTTCTATTGAAAGGGAATTGCAGTCTGAGTCGACCAACGAAAAATTGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATT CAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCTCAAGCACGGCTTGTGTGTTGGACCGTCGTCCCGCCGCTTCGGTGGGACGGGCCCGAAAGGCAGTG GCGGCACCGGTATCCGGTCCTCGAGCGCATGGGGCTTTGTCACCCGCTCCGTAGGCCGGACCGGAGCCCGCCGGCTCCCCCTTTATTTATCTTTTGAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

[0127] The phylogenetic tree of strain HLY001 was constructed based on the ITS rDNA gene sequence (SEQ ID NO.1). Fig.11 ), MEGA5.0 software was used to display the phylogenetic tree of ITS rDNA sequences of strain "HYL001" and related species by the neighbor-joining method. The similarity was calculated 1000 times. In the figure, only the nodes of the phylogenetic tree with Bootstrap values ​​greater than 70% are displayed. The superscript "T" represents the model strain.

[0128] The NCBI homology search results are as follows:

[0129] NCBI Alignment: HLY001

[0130] 91.3% Xerochrysium xerophilum CBS153.67 T (NR 154476)

[0131] 88.8% Xerochrysium dermatitidis CBS132.31 T (MH855157)

[0132] 88.5% Leiothecium ellipsoideum CBS 607.74 T (NR 144922)

[0133] 86.5% Xeromyces bisporus CBS236.71 T (NR 154540)

[0134] 86.0% Monascus purpureus CBS109.07 T (KY635851)

[0135] 85.9% Monascus ruber FRR 2447 T (GU733332)

[0136] Homology search showed that the most similar strain to HLY001 was Xerochrysium xerophilum CBS153.67 T (NR 154476) 91.3%, followed by Xerochrysium dermatitidis CBS132.31 T (MH855157)

[0137] 88.8%, indicating that the strain HLY001 of the present invention belongs to a new species of Xerochrysium sp.

[0138] Example 2: Fermentation of Xerochrysium sp. HLY001 to produce fruit wine aroma substances

[0139] GC and GCMS were used to detect the ethanol and odor substances produced during the reproduction of this strain of Xerochrysium sp. HLY001.

[0140] Culture medium: 5 g peptone, 10 g glucose, 2 g strawberry powder, 1 g potassium dihydrogen phosphate, 0.5 g magnesium phosphate, 0.1 g chloramphenicol, 400 g white sugar, 600 g distilled water. The control group did not contain Xerochrysium sp. HLY001; the test group was supplemented with 10 CFU of Xerochrysium sp. HLY001.

[0141] Cultivation conditions: 30°C, 7 days to 4 months. Detect ethanol and flavor after 7 days of cultivation, and test ethanol content again after 4 months of continuous storage.

[0142] The ethanol content of the control group was 0 ppm after 7 days and 4 months. The ethanol content of the test group was 4000 ppm after 7 days and 18978 ppm after 4 months.

[0143] Fig.12 The results of GCMS detection of odor substances produced during the reproduction of strain HLY001 in this example are shown. Compared with the control sample (unfermented culture matrix as the control sample), the main flavor substances and odor descriptions produced by the fermentation of HLY001 of the present invention are shown in Table 4.

[0144] Table 4

[0145] Flavor substances Odor description Isovaleraldehyde Aromatic aldehydes Alanine Protein hydrolysate Isoamyl alcohol Apple brandy aroma 2-Methylbutanol Alcohol smell Ethyl isobutyrate Fruity Benzaldehyde Bitter almond smell Phenylacetaldehyde Floral, rose, citrus Methyl benzoate Has a strong floral and fruity aroma Phenylethyl alcohol Rose scent 4-Methoxystyrene Sweet smell Ethyl benzoate Floral scent Limonene Lemon aroma 3-Phenylpropanol Herbal aroma Ethyl phenylacetate Aromatic smell Diphenyl ether Geranium scent a-cedrene Woody scent

[0146] In addition, a culture medium without strawberry powder was used: 5g peptone, 10g glucose, 1g potassium dihydrogen phosphate, 0.5g magnesium phosphate, 0.1g chloramphenicol, 400g white sugar, 600g distilled water. 10CFU of Xerochrysium sp.HLY001 was added. Fermentation was carried out at 30℃ for 7 days, and the ethanol content and flavor substances were detected. The results showed that the ethanol content and flavor substances produced by Xerochrysium sp.HLY001 in the culture medium without strawberry powder were close to those in the aforementioned fermentation containing strawberry powder.

[0147] Example 3: Fermentation of fruit wine by Xerochrysium sp. HLY001

[0148] After strawberry fruits are selected and washed, they are steamed in a steamer with boiling water for 5 minutes. 200g of berries are added with distilled water to 2L and then juiced. After pectinase is added for 4 hours and the enzymolysis is sufficient, white sugar is added to adjust the sugar content to 40%, and the mixture is sterilized at 115℃ for 15 minutes. The 5% bacterial solution of Xerochrysium sp.HLY001 after expansion is inoculated and fermented. The fermentation temperature is 30℃. When the pH after fermentation reaches 3.0, the fermentation is terminated and clarified by gauze filtration. Finally, a 0.22μm filter is used for sterilization filtration to obtain a fruit wine with a complex flavor.

[0149] The above embodiments are only used to illustrate the present invention, but not to limit the present invention. Those skilled in the art may make various changes and modifications without departing from the essence and scope of the present invention. For example, other culture media may be used to prepare anti-Candida active fermentation broth based on Xerochrysium sp. HLY001, and the anti-Candida preparation may also be used to inhibit the application of other pathogenic fungi (such as application) to achieve the same purpose. Therefore, all equivalent technical solutions also belong to the protection scope of the present invention.

Claims

1. A Xerochrysium sp. strain having a deposit number of CCTCC NO: M2024349.

2. A bacterial preparation comprising the Xerochrysium sp. strain according to claim 1.

3. The bacterial preparation according to claim 2, which is a liquid or solid preparation in the form of live bacteria or inactivated bacteria.

4. A postbiotic, which is a postbiotic containing bacterial cells and metabolites obtained by fermenting the Xerochrysium sp. strain according to claim 1 or the bacterial preparation according to claim 2 in a culture medium, or a postbiotic containing a fermentation product; Preferably, the culture medium is a hypertonic culture medium; More preferably, the fermentation product obtained by fermenting and culturing the Xerochrysium sp. strain according to claim 1 in a culture medium is a postbiotic containing bacterial cells and metabolites; or, the fermentation product is further centrifuged to collect the fermentation supernatant, and filtered with a filter membrane to obtain a postbiotic containing metabolites from which the bacterial cells have been removed; optionally, the postbiotic can be further dried to prepare a powder.

5. A method for culturing the Xerochrysium sp. strain according to claim 1, the method comprising: The Xerochrysium sp. strain according to claim 1 is inoculated into a culture medium for fermentation culture; Preferably, the culture medium is a hypertonic culture medium.

6. Use of the Xerochrysium sp. strain according to claim 1, the bacterial preparation according to claim 2 or 3, or the postbiotic according to claim 4 in the preparation of food and / or food additives.

7. The use according to claim 6, wherein: The food includes one or more of alcoholic beverages, fermented glutinous rice, condiments, candies, and baked goods.

8. The use according to claim 6, wherein: The food additives include additives for solid-state fermented foods.

9. A food comprising the Xerochrysium sp. strain according to claim 1, the bacterial preparation according to claim 2 or 3, or the postbiotic according to claim 4.

10. The food according to claim 9, which is an alcoholic beverage, fermented glutinous rice, condiment, candy or baked food.

Images