Natural aroma-producing geotrichum candidum and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to a natural aroma-producing geotrichum candidum and application of the natural aroma-producing geotrichum candidum. The invention relates to Geotrichum candidum, which is preserved in the Guangdong Microbial Culture Collection Center, and the preservation number is GDMCC No.65443. The Geotrichum candidum is named as GDMCC. The hypha protein generated by the Geotrichum candidum gives off the unique fragrance of roses, honey, flowers and fruits, and the hypha protein generated by the Geotrichum candidum has the unique fragrance of the roses, the honey, the flowers and the fruits. Besides, the hypha protein is rich in protein, has high nutritional value and also contains fat, so that food prepared from the hypha protein is endowed with unique fat flavor and excellent taste.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a natural Geotrichum candidum and a use thereof. Background Art

[0002] Geotrichum candidum is a common fungus belonging to the subphylum Ascomycota, family Acanthosporaceae, tribe Ovosporidae, and genus Geotrichum. The morphological characteristics of Geotrichum candidum are between yeast and mold, and its reproduction mode is mainly fission, and a few strains have budding spores. The growth temperature range is 5-38°C, and the growth pH range is 3-11. It has a wide range of ecological adaptability. A single strain of Geotrichum candidum has a certain degree of phenotypic variability, and different strains of the same species show genetic polymorphism. The colony color ranges from white to cream, and a few strains are light brown or dark brown. The texture ranges from oily to membranous.

[0003] Geotrichum candidum is widely found in water, air, soil, grains, mature fruits and dairy products. It has various forms, rich enzyme systems and diverse metabolic pathways. It can be used in the food field, medical testing and textile wastewater treatment. After research, some strains of Geotrichum candidum have the characteristics of producing aroma. For example, in 1975, Gueguen et al. found that Geotrichum candidum can hydrolyze proteins to form aroma compounds. In 1982, Koizumi et al. proved that some strains of Geotrichum candidum can produce fatty acid esters to form special fruit aroma. Although it is still unclear which metabolic pathways Geotrichum candidum produces aroma, this does not prevent people from studying and utilizing it. Daigle et al. used the Geotrichum candidum strain ATCC 62217 to ferment yeast wastewater (containing 35% bread crumbs and 65% water) to produce aroma compounds (pineapple aroma). By analyzing the fermentation broth by HS-GC-MS, the fatty acid esters identified were mainly ethyl acetate, propionic acid, butyric acid, isobutyric acid, etc. According to existing research data, there are differences in the types of aroma compounds produced by different strains of Geotrichum candidum. Although this difference has brought certain challenges to the application of aroma compounds of white mold, the diversity of aroma also provides rich options for research and application. So far, no detailed study on white mold strains that produce rose, honey and floral aromas has been reported. Further, as previously described in the literature, the aroma substances produced by the aroma-producing white mold are mainly present in the culture solution. On the one hand, these aroma compounds present in the culture solution are mainly volatile compounds, which makes the aroma substances in the culture solution easily volatilize. Therefore, when these aroma substances are used in the food field, their persistence is relatively poor. On the other hand, in the food industry, some foods use mycelial protein as a raw material. Therefore, those white molds that produce aroma substances in the culture solution have certain limitations in the application of food. In addition, the research and development of aroma-producing white mold mainly focuses on the diversity and content of aroma compounds, and the fact that aroma substances are mainly present in the culture solution, but often ignores its nutritional value in the food field. At present, there are relatively few research reports on how to increase the protein content in the mycelium of aroma-producing white mold strains. Summary of the invention

[0004] Therefore, the technical problem to be solved by the present invention is to provide a natural fragrant Geotrichum candidum and its use, wherein the mycelial protein produced by the Geotrichum candidum exudes the unique aroma of roses, honey and flowers and fruits, bringing diversified choices to the food industry. These flavor substances are mainly concentrated in the mycelial protein, which solves the problem that the flavor substances of traditional fragrant Geotrichum candidum are mainly present in the culture solution, thereby limiting its application in the food industry. In addition, these mycelial proteins are not only rich in protein and have high nutritional value, but also contain fat, giving the food prepared therefrom a unique fat-scented flavor and excellent taste.

[0005] To this end, the present invention provides the following technical solutions:

[0006] The embodiment of the present invention relates to a Geotrichum candidum, which is any one of the following A1) to A5):

[0007] A1), a strain whose ITS sequence is at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO:6; and / or a strain whose 26S sequence is at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO:5;

[0008] A2), Geotrichum candidum MN17901, deposited in Guangdong Microbiological Culture Collection Center, with the deposit number GDMCC No.65443;

[0009] A3), a strain having at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the ITS sequence of the strain described in A2); and / or a strain having at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the 26S sequence of the strain described in A2);

[0010] A4), a strain whose genome has an average nucleotide identity of at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% with the genome of any of the strains described in A1) to A3).

[0011] As used herein, "identity" with respect to nucleic acid sequences refers to the extent to which the two nucleic acid sequences have identical nucleotide residues at the same position when the two nucleic acid sequences are aligned to achieve the maximum level of identity, expressed as a percentage. Wherein, the "identity" between the sequences of two nucleic acid molecules can be determined using a known computer algorithm, such as at least one of the GCG program package, BLASTN or FASTA, and other commercial or publicly available programs may also be, for example, DNAStar-"MegAlign" program.

[0012] In addition, with the rapid development of second-generation and third-generation sequencing technologies, strain identification based on whole genome sequencing has become possible, making strain identification results more accurate. Average nucleotide identity (ANI) of bacterial genomes refers to the similarity of homologous genes between two bacterial genomes. At present, there are various mature ANI value calculation tools, such as local calculation software Jspecies ( / jspecies) and Gegenees ( / documentation.html), online calculation tools ANI caculator (http: / enveomics.gatech.edu / ), EzGenome ( / ezgenome / ani) and ANItools, etc. Therefore, the ANI value of the isolated strain and the strain MN17901 can be calculated by any of the above-mentioned local calculation software or online calculation tools or other tools or methods known in the art.

[0013] The culture characteristics of the strain MN17901 are as follows: the colony diameter after 6 days is 3.80 cm, the colony is flat and spreads, grows fast, is flat, milky white, short-wool or nearly powdery, has concentric rings and radial characteristics, and some have central protrusions. Mycelial morphological characteristics: the hyphae are fungal hyphae with transverse septa, and some are dichotomously branched. The hyphae are 3 to 7 μm wide. After the hyphae mature, they break into single or chain, long cylindrical, and blunt-ended arthrospores. The size of the arthrospore is (4.9 to 7.6 μm) × (5.4 to 16.6 μm).

[0014] Furthermore, the Geotrichum candidum produces at least one metabolite of phenylethanol, β-p-hydroxyphenylethanol and / or phenylacetic acid.

[0015] The present invention relates to a microbial agent, including the candidum, its inactivated product, its culture, its fermentation product, its extract and / or at least one metabolite. The "metabolites", "cultures", "fermentation broths", "inactivated products" and "extracts" used herein include any components, compounds, substances or byproducts (including but not limited to small molecule secondary metabolites) produced by the candidum strains described herein and having any beneficial effects disclosed in the present invention. Any components, compounds, substances or byproducts of the beneficial effects include proteins, amino acids, trace elements, etc.

[0016] The embodiment of the present invention relates to a mycelial protein or mycelium, which is prepared by culturing the Geotrichum candidum or the microbial agent. In the present invention, mycelium, mycelial protein, mycelial protein, and fungal protein all represent the same substance.

[0017] In some embodiments, the arthrospore size of the hyphal protein or mycelium is 4.9-7.6 μm×5.4-16.6 μm.

[0018] In some embodiments, the mycelial protein contains at least one of protein, volatile aroma substances, fat, amino acids and trace elements. On the one hand, since the mycelial protein or mycelium is rich in volatile aroma substances, these aroma compounds can be effectively extracted and concentrated, and when applied to the food field, the aroma substances are persistent, which can make it widely used in the food industry, such as as a natural flavor enhancer. On the other hand, the mycelial protein or mycelium is rich in nutrients such as protein, amino acids, trace elements, etc., so that it has high nutritional value when applied to the food field. In addition, the mycelial protein or mycelium also contains fat, so that it can have a fat fragrance when applied to the food field, improve the taste, and improve the spreadability when applied to spreadable products.

[0019] In some embodiments, the volatile aroma substances include at least one of esters, alcohols, acids, and aldehydes and ketones. Further, ester substances include ethyl ethoxylate, mevalonate lactone, amyl isobutyrate, and 2-methylbutyl isovalerate; alcohol substances include 1-pentanol, phenylethanol, and β-hydroxyphenylethanol; acid substances include phenylacetic acid and 2-methylbutyric acid; aldehydes and ketones include acetoin and 4-hydroxy-benzaldehyde. In a preferred embodiment, the volatile aroma substances include at least one of phenylethanol, β-parahydroxyphenylethanol, and phenylacetic acid. Phenylethanol corresponds to rose fragrance, β-parahydroxyphenylethanol corresponds to flower and fruit fragrance, and phenylacetic acid corresponds to honey fragrance. The mycelial protein can be rich in the unique fragrance of rose fragrance, flower and fruit fragrance, and honey fragrance at the same time. Preferably, the mycelial protein or mycelium has a phenylethanol content of ≥38%, β-parahydroxyphenylethanol ≥5%, and phenylacetic acid ≥4%.

[0020] In a preferred embodiment, the protein content is greater than 35% based on the dry weight of mycelial protein or mycelium, and further, the protein content is 39%-50%.

[0021] In a preferred embodiment, the fat content is greater than 0.5% based on the wet weight of mycelial protein or mycelium, and further, the fat content is 0.6%-0.8%.

[0022] The embodiment of the present invention relates to a method for producing mycelial protein or mycelium, comprising fermenting and culturing the Geotrichum candidum or the microbial agent, separating mycelium from the fermented product, and obtaining mycelial protein.

[0023] In some embodiments, the fermentation culture includes at least one of liquid fermentation and solid fermentation; preferably, it is liquid fermentation.

[0024] In some embodiments, the volume of the liquid fermentation is ≥1L, which can be any one of 1L, 5L, 10L, 20L, 30L, 40L, 50L, 100L, 200L, 300L, etc., or a range between any two of the above values. In some embodiments, the inoculation amount of the white mold is a conventional inoculation amount, such as an inoculation amount of 1 to 10v / v% of the total volume of the culture medium. The white mold can be scaled up to meet the needs of large-scale industrial applications. During the scale-up production process, the fermentation conditions need to be strictly controlled to ensure the yield and quality of mycelial protein. For example, parameters such as fermentation temperature, pH value, stirring speed and ventilation volume all need to be precisely controlled to ensure that the growth environment of white mold is optimized. In a preferred embodiment, the pH of the liquid culture medium used in the fermentation culture is 4-8, preferably, the pH is 6-7; and / or the temperature of the fermentation culture is 25-35°C, preferably 28-30°C. Furthermore, after the amplified production process, the mycelial protein obtained was examined under a microscope, and the bacterial morphology mainly contained mycelium similar to yeast morphology and mold morphology, the filter cake was light flesh color, slightly tough, and had obvious fruity and rose aroma; therefore, the tasting result was good, the protein detection result was 39.66%, and the yield was 20g / L by wet weight. It shows that it is very suitable for the food field. The amplified production of Geotrichum candidum can not only provide a large amount of mycelial protein raw materials, but also the types and contents of aroma components are in the best state, so that the yield and aroma quality of mycelial protein have been significantly improved, which can further improve the quality and application value of mycelial protein.

[0025] In some embodiments, the liquid culture medium used in the fermentation culture includes, but is not limited to, a nitrogen source, a carbon source, trace elements, organic acids, and vitamins.

[0026] In a preferred embodiment, the nitrogen source in the liquid culture medium used in the fermentation culture includes but is not limited to cheap nitrogen sources such as corn starch saccharification liquid.

[0027] In a preferred embodiment, the carbon source includes but is not limited to corn starch saccharification liquid.

[0028] In a preferred embodiment, the trace elements include but are not limited to at least one of potassium, magnesium, calcium, manganese, iron and zinc; in a preferred embodiment, the potassium source is selected from potassium salts, preferably potassium nitrate and potassium dihydrogen phosphate. The magnesium source is selected from magnesium salts, preferably magnesium sulfate heptahydrate. The calcium source is selected from calcium salts, preferably calcium chloride. The manganese source is selected from manganese salts, preferably manganese sulfate monohydrate. The iron source is selected from iron salts, preferably iron sulfate heptahydrate. The zinc source is selected from zinc salts, preferably zinc chloride.

[0029] In some embodiments, the organic acid is selected from citric acid.

[0030] In some embodiments, the vitamins include, but are not limited to, B family vitamins;

[0031] In some embodiments, in the liquid culture medium, the concentration of the carbon source is 25-35 g / L, the nitrogen source is 0.01-30 g / L, the potassium salt concentration is 0.1-2 g / L, the magnesium salt concentration is 0.1-2 g / L, the calcium salt concentration is 0.005-1 g / L; and, optionally, 0.001-0.1 g / L of trace elements.

[0032] Preferably, the liquid culture medium further comprises a vitamin complex, more preferably 0.001 to 0.2 v / v % of the vitamin complex.

[0033] In some embodiments, the liquid culture medium contains 20-35 g / L corn starch saccharification liquid, 0.1-2 g / L citric acid, 0.1-2 g / L potassium dihydrogen phosphate, 0.01-10 g / L ammonium sulfate, 0.1-2 g / L magnesium sulfate heptahydrate, 0.001-1 g / L calcium chloride; and, optionally, 0.001-0.1 g / L trace elements.

[0034] Preferably, the liquid culture medium further comprises a vitamin complex, more preferably 0.001 to 0.2 v / v % of the vitamin complex.

[0035] In a preferred embodiment, before fermentation, the process further comprises the step of activating and / or amplifying the Neurospora intermedia.

[0036] In a preferred embodiment, the activation culture is carried out on a solid culture medium. The culture medium used for the activation culture can be any conventional culture medium. In a preferred embodiment, the activation culture medium includes but is not limited to MEA plate culture medium, Sabouraud medium (SDA), potato dextrose agar medium (PDA), and other conventional fungal culture media. The temperature and time of the activation culture are conventional culture conditions. In some embodiments, the culture temperature is 25 to 30°C and the culture time is 24 to 96h.

[0037] In a preferred embodiment, the amplified culture is carried out in a liquid culture medium, and the culture medium used can be any conventional culture medium. Further, the culture medium used is a common seed culture medium, and the seed culture medium includes but is not limited to a carbon source, a nitrogen source, and metal ions. Metal ions include but are not limited to potassium ions, magnesium ions, and calcium ions. In a specific embodiment, the culture medium includes but is not limited to glucose, yeast extract, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, and calcium chloride. In a more specific embodiment, the seed culture medium contains 25-35 g / L of glucose, 10-30 g / L of yeast extract, 1-10 g / L of potassium dihydrogen phosphate, 0.5-5 g / L of magnesium sulfate heptahydrate, and 0.2-1 g / L of calcium chloride.

[0038] The embodiments of the present invention relate to mycelial protein or mycelium obtained by the above-mentioned method for producing mycelial protein or mycelium.

[0039] The embodiments of the present invention relate to the use of the hyphae protein or mycelium in any of the following:

[0040] 1) Use in the food field or in food preparation;

[0041] 2) Use in the field of edible flavors or in the preparation of edible flavor products;

[0042] 3) Use in protein replacement or in the preparation of protein replacement products.

[0043] In some embodiments, the food field includes any one of food, health products, functional food or food additives. In certain embodiments, the food may include at least one of meat analogs, plant-based protein meat products, dairy products, beverages, baked products, spreadable products, etc. In some embodiments, mycelial protein can also be used as a food additive to improve the texture, taste and nutritional value of food. For example, it can be added to food as an emulsifier, stabilizer or thickener to improve the stability and taste of food.

[0044] In certain embodiments, edible flavors include but are not limited to cooking spices, condiments or food additives. In other embodiments, edible flavor products can be ingredients for enhancing or improving food flavors, for example, they can be added to various foods, such as meat, fish, vegetables, sauces, soups or ready-to-eat foods, to provide or enhance specific flavor characteristics. Food additives include but are not limited to any one of meat analog additives, plant-based protein meat product additives, dairy product additives, beverage spices, baking product additives, and spreadable product additives. In a preferred embodiment, the edible flavor is an edible flavor containing rose fragrance, floral and fruity fragrance and / or honey fragrance.

[0045] In some embodiments, the alternative protein products may include any one of the categories of food, health products, functional foods or food additives. These alternative protein products can be used to make nutritionally fortified foods, aiming to provide consumers with an additional source of protein, especially suitable for individuals who are allergic to animal protein or follow a vegetarian diet. These products may include but are not limited to protein bars, protein powders, protein drinks and protein supplements. In some embodiments, the food may include at least one of meat analogs, plant-based protein meat products, dairy products, beverages, baked products, spreadable products, etc.

[0046] In some embodiments, the meat analogs include but are not limited to meat analogs of livestock, seafood, and poultry; the plant-based protein meat products include but are not limited to plant-based protein meat products of livestock, seafood, and poultry; the livestock include but are not limited to at least one of pigs, cattle, and sheep; the seafood include but are not limited to at least one of fish, shrimps, crabs, and shellfish; the plant-based protein meat products include but are not limited to plant-based protein meat products derived from soy protein, pea protein, peanut protein, and wheat protein; the meat analogs and plant-based protein meat products include but are not limited to meat balls, meat patties, meat-like cuts, and meat-like sliced ​​products such as ham and bacon; the dairy products include but are not limited to yogurt, cheese, cream, ice cream, condensed milk or milk powder; the beverages include but are not limited to plant milk, sports drinks, energy drinks, juices, tea, coffee, or alcohol; the baked products include but are not limited to bread, cakes, biscuits, pies, or cookies; the spread products include but are not limited to spreads, butter, cheese, peanut butter, and chocolate sauce. The food additives include any one of meat analogue additives, plant-based protein meat product additives, dairy product additives, beverage flavors, bakery product additives, and spreadable product additives; the edible flavors are edible flavors containing rose aroma, floral and fruity aroma, and / or honey aroma.

[0047] As described above, the mycelial protein or mycelium has a wide range of uses, not only limited to the field of food and edible flavors, but also extended to the development of alternative protein products, providing new possibilities for the food industry and meeting consumers' needs for healthy, nutritious and sustainable food choices.

[0048] The embodiment of the present invention relates to a liquid food, comprising the hyphae protein or mycelium, wherein the added amount of the hyphae protein or mycelium is ≥0.01wt% of the total amount.

[0049] In some embodiments, the liquid food includes drinks, such as dairy drinks, which can be products such as milk, yogurt, condensed milk, etc. In these products, the addition of mycelial protein can not only provide unique rose, floral and fruity, honey aroma flavors, but also enhance the nutritional value of the product. For example, adding mycelial protein or mycelium to yogurt can improve its taste and texture, while increasing the protein content to meet consumers' demand for healthy food. In addition, the mycelial protein contains fat, which makes it have a fat aroma, a delicate and smooth taste, and rich layers.

[0050] When implementing the present invention, the amount of hyphal protein or mycelium added can be adjusted according to the type of product and the expected effect. Usually, the amount of hyphal protein or mycelium added is ≥0.01wt% of the total amount, but this ratio can be appropriately increased or decreased according to actual needs. During the production process, the uniform dispersion of hyphal protein or mycelium should be ensured to ensure the quality of the final product. Optionally, the amount of hyphal protein or mycelium added is 1wt% to 99.99wt% of the total amount; optionally, the amount of hyphal protein or mycelium added is 1wt%, 2wt%, 4wt%, 6wt%, 8wt%, 10wt%, 20wt%, 30wt%, 40wt%, 50wt%, 60wt%, 70wt%, 80wt%, 90wt%, 99.99wt% of the total amount, any one of the values ​​or the range between any two values.

[0051] In some embodiments, the liquid food can be a spread, comprising the hyphae protein or mycelium, wherein the amount of the hyphae protein or mycelium added is ≥0.01wt% of the total amount. The spread is suitable for a variety of occasions, such as being spread on bread or biscuits for breakfast, or as an ingredient for desserts, such as decoration of ice cream and cakes. Since the hyphae protein or mycelium has a unique rose, floral, fruity, honey aroma and flavor, is rich in protein, and has high nutritional value, the hyphae protein contains fat, so that it has a fat aroma, a good taste, and is easy to spread.

[0052] When implementing the present invention, the amount of hyphal protein or mycelium added can be adjusted according to the type of product and the expected effect. Usually, the amount of hyphal protein or mycelium added is ≥0.01wt% of the total amount, but this ratio can be appropriately increased or decreased according to actual needs. In the production process, the uniform dispersion of hyphal protein should be ensured to ensure the quality of the final product. Optionally, the amount of hyphal protein or mycelium added is 1wt% to 99.99wt% of the total amount; Optionally, the amount of hyphal protein added is 1wt%, 2wt%, 4wt%, 6wt%, 8wt%, 10wt%, 20wt%, 30wt%, 40wt%, 50wt%, 60wt%, 70wt%, 80wt%, 90wt%, 99.99wt% of the total amount, any one of the values ​​or the range between any two values.

[0053] Embodiments of the present invention relate to a protein food ingredient comprising a. cultured Geotrichum candidum biomass in an amount of at least 2% w / w; and b. water in an amount of up to 98% w / w;

[0054] In some embodiments, the Geotrichum candidum is the Geotrichum candidum described;

[0055] In some embodiments, the Geotrichum candidum biomass is the Geotrichum candidum hyphal protein or mycelium;

[0056] In some embodiments, the protein food ingredient comprises 5% w / w-55% w / w of the cultured Geotrichum candidum biomass and 95%-45% water;

[0057] In some embodiments, the protein food ingredient comprises 10% w / w-20% w / w of the cultured Geotrichum candidum biomass and 90%-80% water;

[0058] In some embodiments, the protein food ingredient comprises 80% w / w-99% w / w of the cultured Geotrichum candidum biomass and 1% w / w-20% w / w water;

[0059] In some embodiments, the protein food ingredient further comprises carbohydrates, fat, protein, fiber, or any combination thereof;

[0060] In some embodiments, the carbohydrate comprises glucose, fructose, galactose, maltose, sucrose, lactose, starch, or any combination thereof;

[0061] In some embodiments, the carbohydrate comprises white sugar, brown sugar, black sugar, agar, pectin, gum arabic, molasses, honey, cane sugar, wheat starch, corn starch, potato starch, food starch, dextrose, or any combination thereof;

[0062] In some embodiments, the fat comprises vegetable oil, animal oil, or any combination thereof;

[0063] In some embodiments, the fat comprises safflower oil, sunflower oil, olive oil, coconut oil, sunflower oil, safflower oil, rapeseed oil, canola oil, vegetable glycerin, soy lecithin, or any combination thereof;

[0064] In some embodiments, the protein comprises plant protein, animal protein, microbial protein, or any combination thereof;

[0065] In some embodiments, the protein comprises texturized pea protein, texturized wheat protein, texturized soy protein, soy protein, wheat protein, pea protein, rice protein, potato protein, albumin, or any combination thereof;

[0066] In some embodiments, the fiber includes pea fiber, oat bran, other plant fiber, bamboo fiber, cellulose, citrus fiber, soy fiber, or any combination thereof;

[0067] In some embodiments, the protein food ingredient further includes soybeans, lentils, lentil flour, soy flour, pea flour, yeast extract, nutritional yeast (fixed dry yeast), mushroom powder, white button mushroom powder, shiitake mushroom powder, chickpeas, isolated oat products, isolated pea products, fermented rice extract, kelp extract, algae, silicon dioxide, vitamins, dry yeast, citrus extract, beet pulp, beet juice, beet juice extract, turmeric, mushroom extract, shiitake mushroom stems, shiitake mushrooms, white button mushrooms, tofu, soy hydrolyzate, maltodextrin, sodium ascorbate, calcium carbonate, yeast extract, seaweed, spices, sweeteners, natural flavoring agents, or any combination thereof.

[0068] The embodiment of the present invention relates to an edible composition, comprising the mycelial protein or mycelium, or the protein food component, and food additives; the amount of the mycelial protein or protein food component added is ≥0.01wt% of the total amount. Further, the amount of the mycelial protein or mycelium or protein food component added is 0.05wt%, 1wt%, 2wt%, 3wt%, 4wt%, 5wt%, 8wt%, 10wt%, 15wt%, 20wt%, 30wt%, 40wt%, 50wt%, 60wt%, 70wt%, 80wt%, 90wt%, 100wt% of the total amount, any one of the values ​​or the range between any two values. In some embodiments, the food additives, such as plant or animal protein, fat, emulsifier, thickener, stabilizer, flavoring agent, pH adjuster, oil, spices, salt, etc.

[0069] The technical solution of the present invention has the following advantages:

[0070] 1. A Geotrichum candidum, any one of the following A1) to A5): A1), a strain having an ITS sequence that is at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO: 6; and / or a strain having a 26S sequence that is at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO: 5; A2), a strain having an ITS sequence that is at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO: candidum) MN17901, deposited in Guangdong Microbial Culture Collection Center, with the deposit number of GDMCC No.65443; A3), a strain having at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the ITS sequence of the strain described in A2); and / or, a strain having at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5% A4) is a strain with an average nucleotide identity of at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% of the same strain; A1) to A3) is a strain with an average nucleotide identity of at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% of the same strain. The hyphae protein produced by the Geotrichum candidum exudes the unique aroma of roses, honey and fruits, bringing diversified choices to the food industry. These aroma substances are mainly concentrated in the hyphae protein, which solves the problem that the aroma substances of the traditional aroma-producing Geotrichum candidum are mainly present in the culture solution, thereby limiting its application in the food industry. In addition, these mycelial proteins are not only rich in protein and have high nutritional value, but also contain fat, which gives the food prepared from them a unique fatty flavor and excellent taste.

[0071] Further, the mycelial protein produced by Geotrichum candidum has a special application value. Due to its unique flavor characteristics, mycelial protein can be added as a natural flavor to various cheeses, yogurts and other dairy products, such as in dairy beverages, to enhance the flavor and aroma of the product. In addition, the protein and fat components in mycelial protein can improve the nutritional value and taste of the product.

[0072] In addition, the use of the candidum mycelial protein can also be extended to other food fields, such as spreads, protein meat, baked goods, etc. In these applications, mycelial protein can not only provide flavor, but also serve as a nutritional enhancer to increase the protein and fat content of the product, thereby improving the overall nutritional value of the product.

[0073] In summary, the mycelial protein produced by Geotrichum candidum has broad application prospects in the food industry. Its unique flavor characteristics, nutritional value and easy processing characteristics make it an ideal choice for food formulators and manufacturers when developing new products.

[0074] Biological Deposit Certificate

[0075] Geotrichum candidum MN17901 is deposited in Guangdong Microbial Culture Collection Center (GDMCC), the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Postal Code 510070, deposit date: November 8, 2024, and the deposit number is GDMCC No.65443. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0077] Figure 1 Colony picture of strain MN17901 cultured in MEA medium in Example 1;

[0078] Figure 2 Microscopic observation of mycelium of strain MN17901 in Example 1;

[0079] Figure 3 Phylogenetic tree of strain MN17901 in Example 1;

[0080] Figure 4The fermentation broth obtained by the scaled-up production of strain MN17901 in Example 4;

[0081] Figure 5 The hyphal protein obtained by the amplified production of strain MN17901 in Example 4;

[0082] Figure 6 Microscopic examination of strain MN17901 in Example 4;

[0083] Figure 7 A dairy beverage prepared from the mycelial protein of strain MN17901 in Example 6;

[0084] Figure 8 Spread prepared from mycelial protein of strain MN17901 in Example 7. DETAILED DESCRIPTION

[0085] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0086] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0087] In the following embodiments.

[0088] Example 1 Isolation and identification of strain MN17901

[0089] 1. Strain source

[0090] 1.1 Sample collection: The samples were collected from the soil of beans planting areas in Sichuan Province in April 2017.

[0091] 1.2 Separation process:

[0092] Weigh 2 g of sample, add 20 mL of 0.7% sodium carboxymethyl cellulose suspension (CMC) or other buffer, and shake on a shaker for 30 min (150 rpm) to obtain 10 -1 g / mL sample diluent, pipette 1mL of sample into 9mL of saline and mix until 10 -2 g / mL dilution, and then serially diluted to 10 -3 ~10 -4 g / mL, take 10 -2 g / mL, 10 -3g / mL two gradients of bacterial liquid were spread on red Bengal agar plates (RBM plates for short, formula: 5.0 g peptone, 20.0 g glucose, 1.0 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 0.0333 g red Bengal, 0.1 g chloramphenicol, 20.0 g agar, 1 L water), and inverted culture was carried out in a constant temperature incubator at 25°C for 3-7 days.

[0093] 1.3 Purification process:

[0094] Purification was performed by the step-by-step transplantation method of hyphae ends. After the colonies were formed on the plate, the hyphae at the edge of the single colony were picked and placed on a potato dextrose agar plate (PDA plate for short, with the formula: 200 g potato extract, 20 g glucose, 15 g agar, 1 L water), and continued to be cultured at 25°C until pure colonies were obtained, and the obtained colonies were stored at 4°C.

[0095] 2. Strain Identification

[0096] 2.1 Morphological characteristics of strain MN17901

[0097] The strain MN17901 was inoculated into MEA medium (Huankai Microorganisms) and cultured at 28°C for 6 days. The strain was identified based on growth rate, hyphae shape, colony color, number and shape of microconidia and macroconidia, spore-forming cells, shape and presence of thick-walled spores, fruiting body type, etc.

[0098] Culture characteristics:

[0099] like Figure 1 As shown, the diameter of the 6d colony is 3.80cm. The colony spreads in a plane, grows fast, is flat, milky white, short-wool or nearly powdery, has concentric circles and radial line characteristics, and some have central protrusions.

[0100] Morphological characteristics:

[0101] like Figure 2 As shown, the hyphae are septate fungal hyphae, some of which are dichotomously branched. The hyphae are 3 to 7 μm wide. When mature, the hyphae break into single or chain-shaped arthrospores with obtuse ends. The size of the arthrospores is (4.9 to 7.6 μm) × (5.4 to 16.6 μm).

[0102] 2.2 Molecular biological identification of strain MN17901

[0103] 2.2.1 ITS and 26S sequence analysis

[0104] 2.2.2.1. DNA template preparation

[0105] Pick an appropriate amount of bacteria from the surface of the colony cultured on the PDA plate into a PCR tube containing 50 μL of lysis solution, put it into a PCR instrument (Dongshenglong ETC811), heat it at 95℃ for 30 minutes, and transfer it to -20℃ for freezing for 15 minutes. After taking it out, put it into a centrifuge (SIGMA3K15) and centrifuge it at 3000rpm for 2 minutes to allow the cell fragments and lysis solution to settle to the bottom of the PCR tube, and the supernatant is basically clear. At this time, the fungal genetic material is dissolved in the supernatant.

[0106] 2.2.2.2. PCR system preparation

[0107] Prepare 25 μL of PCR system in a PCR tube: ultrapure sterile water, 10.8 μL; 2×PCR Mix, 12 μL; dimethyl sulfoxide (DMSO), 1 μL; 10 μmol / L forward primer, 0.6 μL; 10 μmol / L reverse primer, 0.6 μL; primer sequences are as follows:

[0108] Table 1. Primer sequences

[0109]

[0110]

[0111] PCR amplification

[0112] In a PCR tube, add 2 μL of supernatant to the prepared PCR system and place it in a PCR instrument (Dongshenglong ETC811) for PCR amplification. The PCR reaction conditions are as follows. After amplification, the PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing using a sequencer (abi3730XL).

[0113] PCR reaction conditions:

[0114] 26S gene: pre-denaturation at 95°C for 4 min; denaturation at 94°C for 60 s, annealing at 52°C for 60 s, amplification at 72°C for 1 min 20 s, 37 cycles; maintain at 72°C for another 8 min.

[0115] ITS gene: pre-denaturation at 95°C for 4 min; denaturation at 94°C for 40 s, annealing at 54°C for 30 s, amplification at 72°C for 1 min, 37 cycles; maintain at 72°C for another 10 min.

[0116] 2.2.2.4. Sequences obtained by PCR

[0117] 26S sequence:

[0118] GCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAAATTCCTTCTAAAGCTAAATATTGACGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTCGGCATAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGCCCGT (see SEQ ID NO.5);

[0119] ITS sequence:

[0120] AGCGACTGCGGAGGACATTAAGAATTATAAATATTTGTGAAATTTACACAGCAAACAATAATTTTATAGTCAAAACAAAAATAATCAAAACTTTTAACAATGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCAAAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCATTGCTTTTCTAAAATTTCAAATCA AATTCGTTTGAAAAACAACACTATTCAACCTCAAATCAAGTAGGATTACCCGCTGAACTTAACCATATCATAAGGCGAAGAAA (see SEQ ID NO.6);

[0121] The NCBI online alignment system (blast) was used to align the two gene sequences. The alignment database was the Nucleotide collection (nr / nt). The most similar alignment results of the two genes are shown in the following table:

[0122] Table 2. Comparison results

[0123] Gene Accession Species name Identity / % Coverage / % E-value 26S PP033883.1 Geotrichum candidum 100 100 0.0 ITS OP349631.1 Geotrichum candidum 98.29 96 3e-171

[0124] The steps of multi-gene evolutionary tree analysis are as follows: first, MAFFT (version v7.310) is used to perform multiple sequence alignment for each gene, then GBLOCKS (version 0.91b) is used to trim the multiple sequence alignment result file, and then AliView is used for manual trimming. After trimming, the sequences of the two genes are spliced ​​in series, and the spliced ​​sequences are used to construct a multi-gene joint phylogenetic tree using IQ-TREE (version 2.2.5). Figure 3 shown.

[0125] Based on morphological characteristics, ITS and 26S sequence analysis, strain MN17901 is Geotrichum candidum. The strain was deposited in Guangdong Microbiological Culture Collection Center (GDMCC) on November 8, 2024, with the deposit address being the fifth floor of Building 59, No. 100 Xianlie Middle Road, Guangzhou, zip code 510070, and the deposit number is GDMCC 65443.

[0126] Example 2 Determination of hyphae protein of strain MN17901

[0127] The activated strain MN17901 was inoculated into a 250 mL tri-conical flask containing 50 mL of the primary screening medium and cultured at 28°C with constant temperature shaking at 200 rpm for 48 h. The primary screening medium formula was: 30 g / L glucose, 30 g / L yeast extract powder, and KH 2 PO 4 1g / L, MgSO 4 7H 2 O 0.5g / L, CaCl 2 0.2g / L, sterilized by high pressure steam at 115℃ for 30min before use.

[0128] After 48 hours of cultivation, the filter cake was filtered with a vacuum filtration device, and the filter cake was fully washed and dried in an electric blast drying oven at 60°C. The mass of the dried filter cake was accurately weighed and the biomass concentration was calculated. Then, the crude protein of mycelium was determined by the Kjeldahl method in accordance with GB 5009.5-2016 National Food Safety Standard Determination of Protein in Food. The results are as follows:

[0129] Table 3. Mycelial protein determination results

[0130] Mycelium morphology Filter cake color Filter cake texture Dry weight g / 50mL Biomass% Mycelial protein content% Granular Off-white Sticky 0.82 1.64 41.9

[0131] Biomass = mycelium dry weight / medium volume × 100%;

[0132] Mycelial protein content = crude protein mass / total mass of mycelium × 100%.

[0133] Therefore, the use of strain MN17901 to ferment and prepare mycelial protein can obtain a granular mycelial morphology, an off-white filter cake color, a sticky texture of the filter cake, a dry weight (mycelium dry weight / culture medium volume) of 0.82 g / 50 mL, a biomass of 1.64%, and a mycelial protein content of 41.9%.

[0134] Example 3 Analysis of aroma compounds in mycelial protein of strain MN17901

[0135] The activated strain MN17901 was inoculated into a 250 mL tri-conical flask containing 50 mL of the primary screening medium and cultured at 28°C with constant temperature shaking at 200 rpm for 48 h. The primary screening medium formula was: 30 g / L glucose, 30 g / L yeast extract powder, and KH 2 PO 4 1g / L, MgSO 4 7H 2 O 0.5g / L, CaCl 2 0.2g / L, sterilized by high pressure steam at 115℃ for 30min before use.

[0136] After 48 hours of cultivation, the fermentation liquid was centrifuged at 10,000 rpm for 5 minutes, and the supernatant was removed. The mycelium was resuspended in sterile water and ultrasonically broken and extracted in an ultrasonic cleaner for 10-20 minutes. The blank culture medium and mycelium lysate were tested for volatile substances by headspace solid-phase microextraction (HS-SPME) and gas chromatography-mass spectrometry (GC-MS). The specific experimental method is as follows:

[0137] Metabolite extraction

[0138] 1. Take the sample and add it to a 20ml headspace bottle, then seal it with a cap;

[0139] 2. SPME conditions: Equipment: TriplushRSH autosampler; Extraction head: DVB / Carbon WR / PDMS-80μm (50 / 30μm); Extraction temperature: 90℃; Time: oscillation 5min, extraction 20min, incubation 10min; Oscillation speed: 250rpm; Analysis time: 3min; GC cycle time: 41min.

[0140] Chromatographic mass spectrometry conditions: Thermo Fisher's Trace1610-TSQ9610 gas chromatograph-mass spectrometer (GC-MS) was used. The specific analysis conditions are as follows: injection volume 1 μL, split mode 5:1, carrier gas He, chromatographic column DB-wax (30m×0.25mm×0.25μm), column flow rate 1.2mL / min, injection port temperature 240℃, mass spectrometer transmission line temperature 240℃, ion source temperature 280℃, ionization voltage 70ev, scanning mode Full scan.

[0141] Metabolite identification: Deconvolution Plugin software was used to perform peak extraction, peak detection, deconvolution, and peak alignment analysis on mass spectrometry data. For the qualitative work of substances, Wiley (including NIST2020) spectral library was used, including mass spectrum matching and retention time index matching.

[0142] 381 substances were measured, among which 11 aroma substances were mainly found in the mycelial protein of MN17901. The GC-MS results are shown in the following table:

[0143] Table 4. Analysis of aroma compounds

[0144]

[0145]

[0146] The change factor in the table is the absolute concentration of aroma compounds in the mycelial lysate of MN17901 compared with the absolute concentration of aroma compounds in the blank medium. %, refers to the percentage of the substance in the total aroma substances.

[0147] Therefore, MN17901 was used to ferment and prepare mycelial protein or mycelium, and a variety of aroma substances could be obtained from the mycelial protein or mycelium, among which the higher contents were 38.08% phenylethanol, 5.26% β-parahydroxyphenylethanol and 4.03% phenylacetic acid, and the main aroma types were rose aroma, floral and fruity aroma and honey aroma.

[0148] This shows that the mycelial protein or mycelium of the strain MN17901 of the present invention is rich in phenylethanol, β-parahydroxyphenylethanol and phenylacetic acid, which is of great advantage for applying the mycelial protein of the strain MN17901 to the food industry, especially in foods that need to add fragrance, such as beverages, spreads, dairy products, candies and cakes, etc. MN17901 mycelial protein or mycelium can be used to effectively extract and concentrate these aroma compounds, thereby giving the food a unique flavor.

[0149] In addition, since these aroma compounds are present in higher levels in mycelial protein or mycelium, other flavors can be added less during food processing, thereby reducing production costs and increasing the naturalness of the product. At the same time, this natural source of aroma is more in line with modern consumers' demand for healthy and natural food.

[0150] In summary, the discovery of strain MN17901 provides a new natural aroma source for the food industry, which has broad application prospects and commercial value.

[0151] Example 4 Strain MN17901 scaled up to produce mycelial protein

[0152] 1. Seed cultivation

[0153] First-level seed cultivation:

[0154] The activated strain MN17901 was inoculated into a 250 mL tri-conical flask containing 50 mL of the primary screening medium and cultured at 28°C with constant temperature shaking at 200 rpm for 24 h. The primary screening medium formula was: 30 g / L glucose, 30 g / L yeast extract powder, and KH 2 PO 4 1g / L, MgSO 4 7H 2 O 0.5g / L, CaCl 2 0.2g / L, sterilized by high pressure steam at 115℃ for 30min before use.

[0155] Secondary seed cultivation:

[0156] The seed solution obtained from the primary seed culture was transferred to a 3L three-concave conical flask containing 1L of the secondary seed culture medium at a 5v / v% inoculation rate, and cultured for 24 hours at 28°C and a shaking speed of 200rpm. The difference between the secondary seed culture medium and the primary seed culture medium is that the yeast extract powder content is reduced to 10g / L.

[0157] 2. Scale up and cultivate

[0158] The seed liquid obtained from the secondary seed culture was transferred to a 50L fermentation tank containing 30L fermentation medium at a 5v / v% inoculation rate, 28°C, stirring speed 50-200rpm, ventilation 15-300L / min, dissolved oxygen coupling control dissolved oxygen 20-50%, and cultured for 18h. The formula of the fermentation medium (solvent is deionized water) is as shown in the following table.

[0159] Table 5. Fermentation medium formula

[0160] Element Fermentation medium Corn starch saccharification liquid 30g / L Citric Acid 1g / L Potassium dihydrogen phosphate 2g / L Ammonium sulfate 5g / L Magnesium sulfate heptahydrate 0.3g / L Calcium chloride 0.01g / L Manganese sulfate monohydrate 1.7mg / L Ferrous Sulfate Heptahydrate 5mg / L Zinc chloride 1.7mg / L Vitamin B solution (commercially available) 1mL / L

[0161] After the fermentation is completed, the fermentation liquid is Figure 4 As shown, the wet basis of mycelial protein is as Figure 5 Mycelium microscopy: The mycelium morphology mainly contains mycelium similar to yeast morphology and mold morphology, such as Figure 6 As shown, the filter cake is light flesh color, slightly tough, and has obvious fruity, rose, and honey aromas; therefore, the tasting result is good. The protein test result is 39.66%, and the yield is 20g / L by wet weight (mycelium wet weight / culture medium volume).

[0162] From the above, it can be seen that after scaled-up production, the mycelial protein or mycelium of strain MN17901 has obvious fruity, rose and honey aromas, which indicates that the fermentation process successfully retains and strengthens the aroma characteristics of the mycelial protein of strain MN17901.

[0163] In addition, in the amplified culture process of the present invention, the mycelium not only grows vigorously, but also the types and contents of aroma components reach the optimal state, so that the yield and aroma quality of mycelium protein are significantly improved.

[0164] In summary, through the amplified culture process of the present invention, the mycelial protein or mycelium of the strain MN17901 not only has excellent aroma, but also reaches the expected target in terms of protein content. This achievement provides a solid foundation for the application of the strain in the food industry and lays the foundation for further industrial production in the future.

[0165] Example 5 Fat content in mycelial protein of strain MN17901

[0166] The activated strain MN17901 was inoculated into a 250 mL tri-conical flask containing 50 mL of the primary screening medium and cultured at 28°C with constant temperature shaking at 200 rpm for 48 h. The primary screening medium formula was: 30 g / L glucose, 30 g / L yeast extract powder, and KH 2 PO 4 1g / L, MgSO 4 7H 2 O 0.5g / L, CaCl 20.2g / L, sterilized by high pressure steam at 115℃ for 30min before use.

[0167] After culturing for 48 hours, the fermentation liquid was filtered through a filter membrane, and the fat content of the mycelium fermented by MN17901 was tested according to the GB 5009.6-2016 test method. The test result showed that the fat content in the mycelium protein was 0.8 g / 100 g mycelium wet basis.

[0168] From the above results, it can be seen that since mycelial protein or mycelium contains a certain fat content, the prepared food can have sensory characteristics such as fat aroma. For example, for dairy drinks, it can increase the lubricity of the drink, improve the delicate taste, and at the same time have a fat aroma, enrich the taste layer of the drink, and optimize the sensory flavor. For spread products, it can increase the viscosity of the spread product and facilitate spreading. In addition, the fat molecules form a stable structure in the spread to prevent the spread from stratification or precipitation, thereby keeping the texture of the spread uniform and the taste delicate and soft.

[0169] Example 6 Application of mycelial protein or mycelium of strain MN17901 in dairy products

[0170] This embodiment provides a mycelial protein or mycelium dairy beverage, comprising: the mycelial protein wet base obtained in Example 4 is configured into an aqueous solution, and the content of mycelial protein or mycelium can be 0.01wt% to 99wt%. In this embodiment, 10wt% and 20wt% mycelial protein aqueous solutions are exemplarily selected, and the mycelial protein or mycelium aqueous solutions are obtained after shearing at 12000rpm for 15min and homogenizing at 200bar using a shearing instrument, and the solution state and smell are observed, and the observation results are:

[0171] Solution appearance: Figure 7 As shown (the corresponding concentration in the figure is 20wt% mycelium protein aqueous solution after homogenization), after homogenization of the mycelium protein or mycelium aqueous solution, the mycelium protein or mycelium is evenly and stably dispersed, and the solution turns slightly yellow.

[0172] Smell: After homogenization, the two mycelial protein or mycelial aqueous solutions maintain a light fruity, rose and honey aroma. Compared with the 10wt% mycelial protein or mycelial aqueous solution after homogenization, the 20wt% mycelial protein or mycelial aqueous solution after homogenization has a relatively strong fruity, rose and honey aroma. In addition, the two mycelial protein or mycelial aqueous solutions also have a fat aroma after homogenization, and the mouthfeel is smooth without astringency and foreign body sensation. Compared with the 10wt% mycelial protein aqueous solution after homogenization, the 20wt% mycelial protein or mycelial aqueous solution after homogenization has a relatively strong fat aroma.

[0173] According to the above solution state and odor observation results, in actual application, the amount of mycelial protein or mycelium used can be adjusted according to product positioning and consumer preferences. For consumers who pursue a healthy and light taste, it is recommended to use a lower concentration of mycelial protein or mycelium; while for consumers who prefer a rich taste, the amount of mycelial protein or mycelium can be appropriately increased. By flexibly adjusting the addition ratio of mycelial protein, the needs of different markets and consumer groups can be met.

[0174] Furthermore, as described in the previous Examples 2 and 4, the mycelial protein of strain MN17901 contains a relatively high protein content, which can increase the protein content of the dairy beverage while maintaining the original nutrients, thereby improving the nutritional value of the product.

[0175] Therefore, as mentioned above, adding an appropriate amount of mycelial protein or mycelium of strain MN17901 to dairy drinks can not only increase the protein content of dairy products and enhance the functional characteristics of the products, but also improve the taste and flavor of the products, increase the fruity, rose and honey aromas, fat aroma, and delicate and rich taste. For example, in the production process of yogurt, by adding a certain proportion of mycelial protein or mycelium, the yogurt protein can have high nutritional value, natural aromas such as fruity, rose and honey aromas, and fat aroma, with a more delicate texture and a richer taste. In addition, the various amino acids and trace elements contained in mycelial protein or mycelium can further enhance the nutritional value of yogurt and meet consumers' demand for healthy food.

[0176] In summary, the application of mycelial protein of strain MN17901 in dairy beverages can not only increase the nutritional value of the product, but also improve the sensory properties of the product, and has broad application prospects and market potential.

[0177] Example 7 Application of mycelial protein or mycelium of strain MN17901 in spreads

[0178] This embodiment provides a mycelial protein or mycelium spread, comprising: preparing the mycelial protein or mycelium wet base obtained in Example 4 into an aqueous solution, wherein the mycelial protein or mycelium content may be 0.01wt% to 99wt%. In this embodiment, an 84wt% mycelial protein or mycelium aqueous solution is selected as an example, and the solution is sheared at 12000rpm for 15min and homogenized at 200bar using a shearing instrument, and the solution state and odor are observed, and the observation results are as follows:

[0179] Solution appearance: Figure 8 As shown, after the mycelial protein or mycelium aqueous solution is homogenized, the mycelial protein or mycelium is evenly and stably dispersed, the solution is thick and presents a light pink color.

[0180] Smell: After homogenization, the mycelium protein water or mycelium solution maintains a strong aroma of fruit, rose and honey, and also has a fat aroma. It has a smooth taste and is easy to spread. It can be used for spreading or adding to various sliced ​​breads and cakes.

[0181] Furthermore, as described in the previous Examples 2 and 4, the mycelial protein or mycelium of strain MN17901 contains a relatively high protein content, which can increase the protein content of the spread while maintaining the original nutritional components, thereby improving the nutritional value of the product.

[0182] In summary, the application of mycelial protein or mycelium of strain MN17901 in spreads can not only increase the nutritional value of the product and the protein content, but also improve the sensory characteristics of the product, making it have natural fruity, rose and honey aromas, a delicate and rich taste, and is easy to spread. It has broad application prospects and market potential.

[0183] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A Geotrichum candidum, characterized in that: Any one of the following A1) to A5): A1), a strain whose ITS sequence is at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO:6; and / or a strain whose 26S sequence is at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO:5; A2), Geotrichum candidum MN17901, deposited in Guangdong Microbiological Culture Collection Center, with the deposit number GDMCC No.65443; A3), a strain having at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the ITS sequence of the strain described in A2); and / or a strain having at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the 26S sequence of the strain described in A2); A4), a strain whose genome has an average nucleotide identity of at least 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% with the genome of any of the strains described in A1) to A3).

2. The Geotrichum candidum according to claim 1, characterized in that The Geotrichum candidum produces at least one metabolite of phenylethanol, β-p-hydroxyphenylethanol and / or phenylacetic acid.

3. A microbial agent, characterized in that: The method comprises the Geotrichum candidum as claimed in claim 1, its inactivated product, its culture, its fermentation product, its extract and / or at least one metabolite.

4. A mycelial protein or mycelium, characterized in that: The method comprises culturing the Geotrichum candidum according to claim 1 or 2 or the microbial agent according to claim 3; preferably, the arthrospore size of the hyphae protein or mycelium is 4.9-7.6 μm×5.4-16.6 μm; Preferably, the mycelial protein or mycelium contains at least one of protein, volatile aroma substances, fat, amino acids and trace elements; Preferably, the protein content is 35% or more based on the dry weight of mycelial protein or mycelium; Preferably, the protein content is 39%-50% based on the dry weight of mycelial protein or mycelium; Preferably, the fat content is 0.5% or more based on the wet weight of mycelial protein or mycelium; Preferably, the fat content is 0.6%-0.8% based on the wet weight of mycelial protein or mycelium; Preferably, the volatile aroma substances include at least one of esters, alcohols, acids, aldehydes and ketones; Preferably, the ester substances include ethyl ethoxylate, mevalonate, amyl isobutyrate, and 2-methylbutyl isovalerate; Preferably, the alcohol substances include 1-pentanol, phenylethanol, and β-p-hydroxyphenylethanol; Preferably, the acidic substances include phenylacetic acid and 2-methylbutyric acid; Preferably, the aldehyde and ketone substances include acetoin and 4-hydroxy-benzaldehyde.

5. A method for producing mycelial protein or mycelium, characterized in that: The method comprises the following steps: using Geotrichum candidum for fermentation culture, separating mycelium from the fermentation product, and obtaining mycelium protein. Preferably, the Geotrichum candidum is the Geotrichum candidum described in claim 1 or 2 or the microbial agent described in claim 3; Preferably, the fermentation culture includes at least one of liquid fermentation and solid fermentation; preferably, it is liquid fermentation; Preferably, the pH of the liquid culture medium used in the fermentation culture is 4-8, preferably, the pH is 6-7; And / or, the fermentation culture temperature is 25-35°C, preferably 28-30°C; Preferably, before fermentation culture, the method further comprises the steps of activating the Geotrichum candidum, seed culture and / or amplifying culture.

6. A mycelial protein or mycelium obtained by the method according to claim 5.

7. Use of the mycelial protein or mycelium according to claim 4 or 6 in any of the following: 1) Use in the food field or in food preparation; 2) Use in the field of edible flavors or in the preparation of edible flavor products; 3) Use in protein replacement or in the preparation of protein replacement products; Preferably, the food field includes any one of food, health products, functional food or food additives; Preferably, the edible flavors include but are not limited to cooking spices, condiments or food additives; Preferably, the protein replacement product includes any one of food, health care product, functional food or food additive; Preferably, the food includes but is not limited to at least one of meat analogs, plant-based protein meat products, dairy products, beverages, bakery products, and spreadable products; Optionally, the meat analogs include, but are not limited to, meat analogs of livestock, seafood, and poultry; Optionally, the plant-based protein meat products include, but are not limited to, plant-based protein meat products from livestock, seafood, and poultry; Optionally, the livestock includes but is not limited to at least one of pigs, cattle, and sheep; Optionally, the seafood includes but is not limited to at least one of fish, shrimps, crabs, and shellfish; Optionally, the plant-based protein meat products include, but are not limited to, plant-based protein meat products derived from soy protein, pea protein, peanut protein, and wheat protein; Optionally, the meat analogs and plant-based protein meat products include but are not limited to meat balls, meat patties, meat-like cuts, and meat-like sliced ​​products such as ham and bacon; Optionally, the dairy product includes but is not limited to yogurt, cheese, cream, ice cream, condensed milk or milk powder; Optionally, the beverage includes but is not limited to plant milk, sports drinks, energy drinks, juice, tea, coffee or alcohol; Optionally, the bakery products include but are not limited to bread, cake, biscuits, pies or cookies; Optionally, the spread product includes but is not limited to spreads, butter, cheese, peanut butter, chocolate spread; Preferably, the food additives include any one of meat analogue additives, plant-based protein meat product additives, dairy product additives, beverage flavorings, bakery product additives, and spreadable product additives; Optionally, the edible flavor is an edible flavor containing rose aroma, floral and fruity aroma and / or honey aroma.

8. A liquid food, comprising a drink or a spreadable sauce, characterized in that: Comprising the mycelial protein or mycelium according to claim 4 or 6, wherein the amount of the mycelial protein or mycelium added is ≥ 0.01 wt% of the total amount; Optionally, the amount of mycelial protein added is 1wt% to 99.99wt% of the total amount; Optionally, the added amount of the mycelial protein is any one of 1wt%, 2wt%, 4wt%, 6wt%, 8wt%, 10wt%, 20wt%, 30wt%, 40wt%, 50wt%, 60wt%, 70wt%, 80wt%, 90wt%, 99.99wt% of the total amount, or a range between any two values.

9. A protein food ingredient, characterized in that comprising a. cultured Geotrichum candidum biomass in an amount of at least 2% w / w; and b. water in an amount of up to 98% w / w; Preferably, the Geotrichum candidum is the Geotrichum candidum described in claim 1 or 2; Preferably, the Geotrichum candidum biomass is the Geotrichum candidum mycelial protein or mycelium as claimed in claim 4 or 6; Preferably, the protein food ingredient comprises 5% w / w-55% w / w of the cultured Geotrichum candidum biomass and 95%-45% water; Preferably, the protein food ingredient comprises 10% w / w-20% w / w of the cultured Geotrichum candidum biomass and 90%-80% water; Preferably, the protein food ingredient comprises 80% w / w-99% w / w of the cultured Geotrichum candidum biomass and 1%-20% water; Preferably, the protein food ingredient further comprises carbohydrates, fat, protein, fiber or any combination thereof; Preferably, the carbohydrate comprises glucose, fructose, galactose, maltose, sucrose, lactose, starch or any combination thereof; Preferably, the carbohydrate comprises white sugar, brown sugar, black sugar, agar, pectin, gum arabic, molasses, honey, cane sugar, wheat starch, corn starch, potato starch, food starch, dextrose or any combination thereof; Preferably, the fat comprises vegetable oil, animal oil or any combination thereof; Preferably, the fat comprises safflower oil, sunflower oil, olive oil, coconut oil, sunflower oil, safflower oil, rapeseed oil, canola oil, vegetable glycerin, soy lecithin or any combination thereof; Preferably, the protein comprises plant protein, animal protein, microbial protein or any combination thereof; Preferably, the protein comprises texturized pea protein, texturized wheat protein, texturized soy protein, soy protein, wheat protein, pea protein, rice protein, potato protein, albumin or any combination thereof; Preferably, the fiber comprises pea fiber, oat bran, other plant fiber, bamboo fiber, cellulose, citrus fiber, soy fiber or any combination thereof; Preferably, the protein food ingredient further comprises soybeans, lentils, lentil flour, soybean flour, pea flour, yeast extract, nutritional yeast (fixed dry yeast), mushroom powder, white Agaricus bisporus powder, shiitake mushroom powder, chickpeas, isolated oat products, isolated pea products, fermented rice extract, kelp extract, algae, silicon dioxide, vitamins, dry yeast, citrus extract, beet pulp, beet juice, beet juice extract, turmeric, mushroom extract, shiitake mushroom stems, shiitake mushrooms, white Agaricus bisporus, tofu, soybean hydrolyzate, maltodextrin, sodium ascorbate, calcium carbonate, yeast extract, seaweed, spices, sweeteners, natural flavoring agents or any combination thereof.

10. An edible composition, characterized in that It comprises the mycelial protein or mycelium described in 4 or 6, or the protein food ingredient according to claim 9, and a food additive; the added amount of the mycelial protein or protein food ingredient is ≥0.01wt% of the total amount.

Images