Bio-control bacterium for Lonicera corpulenta and application of bio-control bacterium

Abstract

The invention belongs to the technical field of plant insect pest biocontrol, and discloses a biocontrol bacterium for Lonicera cordata and application of the biocontrol bacterium, the biocontrol bacterium is classified and named as Paraboereria selaginellas, the strain number of the biocontrol bacterium is JSAFC 2053, the biocontrol bacterium is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation time is September 23, 2024, and the preservation number is CGMCC 41561. An impregnation method and a soil mixing method show that spores of the biocontrol bacterium JSAFC 2053 for the cyclea corpulenta are strong in pathogenicity to larvae of the cyclea corpulenta, environment-friendly, pollution-free and not easy to generate drug resistance. Therefore, the strain can be applied to prevention and treatment of larvae of the larvae of the Artemisia cordata in the unearthed period, can relieve harm of adult Artemisia cordata from the source, and has good development potential and application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a biocontrol bacterium of Aglaonema corydalis and application thereof. Background Art

[0002] Anomala corpulenta is one of the important underground pests in my country's agricultural areas. From the 1970s to the early 1980s, my country once focused on the prevention and control of underground pests on a large scale, but then people began to neglect or even give up the prevention and control of underground pests, resulting in the continuous accumulation of the insect population. With the adjustment of agricultural planting structure in recent years, the changes in farming system and variety layout, especially the substantial increase in the types and areas of economic crops such as peanuts, soybeans, potatoes, and fruit, its damage is gradually increasing, causing it to become a disaster in many areas of the country. Due to long-term dependence on highly toxic, extremely toxic, and highly residual chemical pesticides, the resistance of scarab beetles has increased, the population of natural enemies has sharply decreased, and environmental pollution has become increasingly prominent. In the context of developing pollution-free ecological agriculture and organic agriculture, people's control of pests has turned to their relationship with ecology. For special groups of underground pests such as Anomala corpulenta, it is difficult to prevent and control them. The use of biocontrol agents with relatively good environmental safety and compatibility is undoubtedly the main means.

[0003] The copper green beetle is harmful as an adult and larva. The adult bites the leaves of trees and crops, causing notches; the larvae bite the newly germinated seeds at the roots of crops, or bite off the base of the plant stems and roots, causing the plants to die, and the wounds are easily invaded by pathogens, causing other diseases. The larvae and pupae live in the soil, and the larvae overwinter. Before pupation and eclosion, the larvae need to migrate to the surface of the soil. If this characteristic can be used to control the copper green beetle in the larvae, the harm of the copper green beetle can be reduced from the source, and many disadvantages of chemical pesticide control can be avoided. Biocontrol fungi have the characteristics of many parasitic species, strong adaptability, short pathogenic cycle, strong specificity, no toxicity to humans and livestock, and environmental friendliness. Summary of the invention

[0004] The purpose of the present invention is to provide a biocontrol bacterium for A. coparis and its application in inhibiting the growth of A. coparis.

[0005] Technical solution: In order to enrich the resource library of biocontrol bacteria for Copper Green Beetle, the present invention provides a Copper Green Beetle biocontrol bacterium. The strain number of the Copper Green Beetle biocontrol bacterium is JSAFC 2053, which is preserved in the General Microbiology Center of China Microbiological Culture Collection Administration, the preservation time is September 23, 2024, the preservation number is CGMCC41561, and the microbial classification is named Paraboeremia selaginellae.

[0006] Furthermore, the nucleotide sequence of the rpb2 gene of the biocontrol bacteria of A. corydalis is shown in SEQ ID NO.1.

[0007] The present invention also provides a biocontrol fungus agent for Copper Green Beetle, the active ingredients of which are the Copper Green Beetle biocontrol fungus, hyphae or conidia thereof.

[0008] The present invention also provides the use of the above-mentioned copper green beetle biocontrol bacteria and copper green beetle biocontrol bacteria agent in inhibiting the growth of copper green beetle.

[0009] Furthermore, the application is specifically to spray the spore suspension of the above-mentioned copper green beetle biocontrol bacteria on the copper green beetle larvae, or to add the spore suspension of the copper green beetle biocontrol bacteria into the soil containing the copper green beetle larvae.

[0010] Furthermore, the preparation method of the spore suspension is as follows: (1) inoculating the copper green beetle biocontrol bacterium Paraboeremiaselaginellae JSAFC 2053 on a PDA medium to prepare a culture; (2) placing the culture prepared in step (1) in a Tween-80 solution (0.1%), filtering out the spores, and preparing a copper green beetle biocontrol agent.

[0011] Furthermore, the culture condition in step (1) is culture at 25° C. in the dark for 5-7 days.

[0012] Furthermore, the spore concentration of the biocontrol agent for Copper Green Scarab Beetle is 10 6 Pieces / mL.

[0013] Furthermore, the amount of the spore suspension of the A. copper green beetle biocontrol bacteria added to the soil in step (2) is 1 mL / 10 g soil.

[0014] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and significant advantages: The present application obtains a kind of Paraboeremiaselaginellae JSAFC 2053, a biocontrol bacterium of Copper Green Scarab Beetle, by separation and purification from the soil of Huang Gongwang Forest Park in Hangzhou, Zhejiang Province. The strain can be used as a biocontrol strain, has a high mortality rate against Copper Green Scarab Beetle, is environmentally friendly and non-toxic, can significantly inhibit the survival activity of Copper Green Scarab Beetle larvae, and has great significance for the development of biocontrol agents for the prevention and control of Copper Green Scarab Beetle in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : The colony morphology of the biocontrol bacterium Paraboeremia selaginellae JSAFC 2053 of the present invention;

[0016] Figure 2 :The phylogenetic tree of Paraboeremia selaginellae JSAFC 2053, a biocontrol bacterium against Copper Green Beetle;

[0017] Figure 3 : It is the influence of the biocontrol bacteria Paraboeremia selaginellae JSAFC 2053 of the present invention on the growth of the larvae of the copper green beetle. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0019] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can control plant pests, mainly bacteria, fungi, and actinomycetes.

[0020] Example 1: Isolation and identification of the biocontrol bacterium Paraboeremia selaginellae JSAFC 2053

[0021] 1. Isolation of Paraboeremia selaginellae JSAFC 2053, a biocontrol bacterium against Copper Green Beetle

[0022] JSAFC 2053 was isolated from the soil of Huang Gongwang Forest Park in Hangzhou, Zhejiang. The characteristics of the colony are as follows: when cultured on PDA plate medium, the colony grows rapidly and grows close to the substrate. The surface color is white and the bottom color is orange-yellow ( Figure 1 ).

[0023] 2. Molecular biological identification of Paraboeremia selaginellae JSAFC 2053, a biocontrol bacterium against Copper Green Beetle

[0024] (1) The genomic DNA of strain JSAFC 2053 was extracted using a kit produced by TIANGEN.

[0025] (2) Amplification of rpb2 gene from genomic DNA. DNA amplification was performed in a 30 μL reaction volume, including 15 μL 2×EasyTaq PCR SuperMix (+dye), 1 μL (10 μM) of each primer pair rpb2-5F (SEQ ID NO.2: 5'-GAYGAYMGWGATCAYTTYGG-3') & rpb2-7cR (SEQ ID NO.3: 5'-CCCATRGCTTGYTTRCCCAT-3'), 2 μL template DNA and 11 μL ddH2O. The PCR amplification program conditions were as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 59°C annealing for 45 s, 72°C extension for 60 s, for a total of 35 cycles; and finally 72°C extension for 10 min.

[0026] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: the rpb2 gene sequence of strain JSAFC 2053 was SEQ ID NO. 1 (TCGTTTGCCCTGCCGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAAC TTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGTCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCTAACGCACAGCAGCTCGTTTCGACTGTGCAGGAACTTCGTCGAAACGGAACTCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCG TGAGTTCAAGATCTTCACAGACGCTGGTCGTGTCATGAGGCCGCTGTTCGTCGTGGAGAGCGACGTTCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGC AGAGCAGCAGGCGATGGCTGCCGCAGGTGTTGGCGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGGCTGATCCAAGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACT).

[0027] (4) Compare the sequence of SEQ ID NO.1 on the NCBI database website and establish a phylogenetic tree, see Figure 2 The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 2053 of the present invention is Paraboeremia selaginellae, and the strain was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on September 23, 2024, with a deposit number of CGMCC41561, and a classification name of Paraboeremia selaginellae JSAFC2053. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1st Courtyard, Chaoyang District, Beijing.

[0028] Table 1 Sequence alignment results of SEQ ID NO.1

[0029]

[0030] Example 2: Inhibitory effect of the biocontrol bacterium Paraboeremia selaginellae JSAFC 2053 on the growth of A. selaginella

[0031] 1. Preparation of spore suspension

[0032] (1) JSAFC 2053 was inoculated on PDA medium to prepare a culture, and the culture conditions were: 25°C in the dark for 5-7 days;

[0033] (2) Use an inoculation needle to pick up the bacterial mass in the culture and place it in a Tween-80 solution (0.1%) and shake it thoroughly. After shaking, filter out the spores and adjust the concentration to prepare a copper green beetle biocontrol agent. The spore concentration of the copper green beetle biocontrol agent is 10 6 Pieces / mL.

[0034] 2. Inoculation of insects

[0035] Dipping method: The copper green beetle was collected from the fields of Sizhuang Village, Houbai Town, Jurong City. The 3rd-instar copper green beetle larvae (at this time, the larvae are in the insect stage of large feeding and serious damage) were placed in a concentration of 10 6 The cells were immersed in a JSAFC 2053 spore suspension containing 10 spores / mL for 30 s and then transferred to a culture box (height and width: 15 cm×8 cm) with a soil depth of 10 cm.

[0036] Soil mixing method: Mix 2mL of 10 6 20 g of soil containing a spore suspension of JSAFC 2053 with spores / mL was transferred to a small culture cup, and then healthy mature larvae of A. corydalis were transferred to the culture cup (height and width: 4 cm×4.5 cm).

[0037] There were 3 replicates, with 10 test insects in each replicate. The test insects were treated with 0.1% Tween-80 solution as a control and fed with fresh potato strips during the experiment. All test insects were cultured in an incubator at 25°C, L / D=16h / 8h, and a relative humidity of 80%. Starting from the third day after treatment, the test insects were observed once a day, the number of test insect deaths was recorded, and the insect stages of the infected dead insects were recorded by taking photos.

[0038] The insect stages of the copper green beetle that died from infection with JSAFC 2053, such as Figure 3 The statistical results of the infection mortality of A. cooperi are shown in Table 2. As shown in Table 2, under the culture condition of 25°C, the mortality of A. cooperi larvae reached 80% after 30 days of inoculation by dipping method; the mortality of A. cooperi larvae reached 93% after 30 days of inoculation by soil mixing method. Although the mortality of A. cooperi larvae by soil mixing method was lower than that by dipping method in the first 14 days, the mortality of larvae by soil mixing method gradually exceeded that by dipping method after more than 14 days. The control group did not show any infection.

[0039] Table 2 Pathogenicity of JSAFC 2053 to the larvae of A. cooperi

[0040]

[0041] In summary, the JSAFC 2053 provided by the present invention is a biocontrol fungus that can be used to control A. coparis larvae. It has the characteristics of strong pathogenicity to A. coparis larvae, being environmentally friendly and pollution-free, and not being easy to develop drug resistance. It can be widely used for the control of A. coparis larvae before they emerge from the soil.

Claims

1. A biocontrol bacterium for Aglaonema corydalis, characterized in that: The strain number of the copper green beetle biocontrol bacteria is JSAFC 2053, which is preserved in the General Microbiology Center of the China Microbiological Culture Collection Administration. The preservation time is September 23, 2024, the preservation number is CGMCC41561, and the microbial classification name is Paraboeremia selaginellae.

2. The biocontrol bacteria of A. cooperi according to claim 1, characterized in that The nucleotide sequence of the rpb2 gene of the A. corydalis biocontrol bacterium is shown in SEQ ID NO.

1.

3. A biocontrol agent for Copper Green Scarab Beetle, characterized in that: The active ingredient of the A. corydalis biocontrol fungus agent is the A. corydalis biocontrol fungus, hyphae or conidia thereof as described in any one of claims 1 to 2.

4. Use of the biocontrol bacteria of A. coparisis according to any one of claims 1 to 2 and the biocontrol bacteria agent of A. coparisis according to claim 3 in inhibiting the growth of A. coparisis.

5. The use according to claim 4, characterized in that: The application is specifically to spray the spore suspension of the biocontrol bacteria of Copper Green Beetle according to any one of claims 1 to 2 on the larvae of Copper Green Beetle, or to add the spore suspension of the biocontrol bacteria of Copper Green Beetle into the soil containing the larvae of Copper Green Beetle.

6. The use according to claim 5, characterized in that: The preparation method of the spore suspension is: (1) inoculating the biocontrol bacterium Paraboeremia selaginellae JSAFC 2053 on PDA medium to prepare a culture; (2) placing the culture obtained in step (1) in a Tween-80 solution, filtering out the spores, and preparing a biocontrol agent for A. copper green beetle.

7. The method for preparing the biocontrol agent for Coprinus corydalis as claimed in claim 6, characterized in that: The culture conditions described in step (1) are: culture at 25° C. in the dark for 5-7 days.

8. The method for preparing the biocontrol agent for Coprinus corydalis as claimed in claim 5, characterized in that: The spore concentration of the copper green beetle biocontrol agent in step (2) is 10 6 Pieces / mL.

9. The method for preparing the biocontrol agent for Coprinus corydalis as claimed in claim 5, characterized in that: The amount of the spore suspension of the A. corydalis biocontrol bacteria added to the soil in step (2) is 1 mL / 10 g soil.

Images