Application of dsOdfoGSTo1 in prevention and control of odontotermes formosanus

Abstract

The invention discloses an application of dsOdfoGSTo1 in prevention and treatment of odontotermes formosanus, the dsOdfoGSTo1 is a double-stranded RNA (Ribonucleic Acid) of an odontotermes formosanus glutathione S-transferase OdfoGSTo1 gene, and the nucleotide sequence of the OdfoGSTo1 is as shown in SEQ ID NO: 1; and the nucleotide sequence of the dsOdfoGSTo1 is as shown in SEQ ID NO: 2. According to the present invention, the RNA interference (RNAi) system of the double-stranded RNA (dsRNA) of the odontotermes formosanus glutathione S-transferase (GST) OdfoGSTo1 gene on the odontotermes formosanus OdfoGSTo1 is successfully constructed based on the feeding method, the system can accurately and efficiently inhibit the expression of the OdfoGSTo1, and the dsOdfoGSTo1 and the insect growth regulator dsOdfoGSTo1 are combined through the system so as to significantly improve the prevention and control effect of the dsOdfoGSTo1 on the odontotermes formosanus. The invention provides a solid theoretical basis for developing green, environment-friendly, accurate and efficient detoxification enzyme inhibitors.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of dsOdfoGSTo1 in the prevention and treatment of black-winged soil termites. Background Art

[0002] Black-winged termites, scientifically known as Odontotermes formosanus (Shiraki), are a type of subterranean termite. In addition to causing damage to trees and crops, the most prominent harm of this termite is the damage to earth embankments (Xu Zhide et al., 2007; Zhou Aidong et al., 2018). They dig a large-scale underground cave system inside the earth embankment, causing serious damage to the pipeline structure inside the embankment, and eventually causing catastrophic consequences such as embankment collapse (Li Lining, 2019; Luo Peilie, 1981; Liu Xiangyang, 2011). In addition, the nests of black-winged termites are extremely hidden, which makes it difficult for people to accurately judge the extent and scope of their harm. Often, when they are discovered, they have already caused damage and losses that cannot be underestimated. In view of this, actively carrying out the prevention and control of black-winged termites is of extremely critical and irreplaceable significance for promoting the steady development of the economy and protecting the personal safety of the people.

[0003] In the field of termite control, chemical control is currently the most widely used. It is easy to operate and implement, and is extremely efficient in terms of efficacy, and can achieve significant control effects in a relatively short period of time. But at the same time, the negative effects of chemical control methods are also quite prominent. The use of chemical drugs will cause environmental pollution. Some persistent chemical agents may remain in the soil and water for a long time, causing harm to the ecosystem and posing a potential threat to human health. In the long run, it is not conducive to the sustainable development of the ecosystem and the maintenance of biodiversity. Therefore, the research and development of new biological agents is of great significance for the control of termites.

[0004] RNA interference (RNAi) technology is a technology that introduces double-stranded RNA (dsRNA) into host cells, silences related genes, and interferes with the growth and development of the host. It is widely used in the biological control of insects. As an emerging pest control technology, RNAi has shown many advantages in the process of pest control. RNAi technology has the advantages of specificity, broad spectrum, high efficiency, systemicity, and environmental safety (Whitten, 2019; Wang Cong et al., 2018). In recent years, with the legal status of RNAi biological drugs, products such as pest control sprays developed based on RNAi technology will enter the market. At the same time, with the unremitting research of many scientific researchers and the strong support of funds, RNAi biological control drugs continue to develop and become more and more perfect. It not only has the significant characteristics of green and environmental protection, and can effectively reduce the pollution and damage caused by traditional chemical control to the ecological environment, but also shows the advantages of convenience and efficiency in the application process, opening up a new and promising path for the biological control of agricultural and forestry pests, and is expected to promote agricultural and forestry production to move steadily towards a more sustainable and green ecological direction.

[0005] Glutathione S-transferase (GST) is a multifunctional enzyme system that can detoxify a variety of exogenous substances (such as pesticides). GST is related to the detoxification metabolism of pesticides such as organophosphorus, organochlorine and pyrethroids (Yu Quanyou et al., 2008, Li Yahong, 2014, Zhang Hongying et al., 2002). They can catalyze the reduction of glutathione thiol groups and combine with various electrophilic compounds to increase the solubility of endogenous and exogenous toxic substances and facilitate their excretion (Liu Jin et al., 2010). In resistant strains, GST enzyme activity is significantly enhanced, and GST genes are overexpressed, which enables insects to reduce the harm of pesticides to themselves by GST-related mechanisms when facing the stress of pesticides (Li Xiaofeng et al., 2024; Wang Zhenglei et al., 2023; Li Xinlian et al., 2023; Shen Guangrong et al., 2018).

[0006] Silencing the OdfoGSTo1 gene through double-stranded dsRNA can effectively reduce the detoxification and metabolic function of pests against the pesticide, thereby significantly enhancing the toxic effect of the pesticide on the pest. In this case, not only can the dosage of the pesticide be effectively reduced, but its actual effect in termite control can also be greatly improved. In view of this, making full use of RNAi technology, designing and synthesizing dsRNA adapted to the OdfoGSTo1 gene, can achieve the goal of reducing the amount of pesticide, further enhance the performance of the pesticide in the process of black-winged termite control, and thus create a new exploration path for termite control that is both efficient and environmentally friendly, which has extremely important potential value and far-reaching significance in promoting the innovation of termite control technology and the coordinated development of ecological environmental protection. Summary of the invention

[0007] The purpose of the present invention is to provide an application of black-winged soil termite dsOdfoGSTo1 in the control of black-winged soil termites. Among them, black-winged soil termite dsOdfoGSTo1 is synthesized by the applicant for the first time, and when introduced into the body of termites, it can significantly improve the control effect of the drug hydrazine on black-winged soil termites.

[0008] In order to achieve the above purpose, the specific technical solution adopted by the present invention is:

[0009] The invention relates to the use of dsOdfoGSTo1 in the control of black-winged termites, wherein the dsOdfoGSTo1 is a dsRNA of black-winged termites, and the nucleotide sequence of OdfoGSTo1 is shown in SEQ ID NO: 1; the nucleotide sequence targeted by the synthetic dsOdfoGSTo1 is shown in SEQ ID NO: 2.

[0010] Furthermore, the dsOdfoGSTo1 is amplified by PCR using an upstream primer dsOdfoGSTo1F and a downstream primer dsOdfoGSTo1R, wherein:

[0011] The upstream primer dsOdfoGSTo1F is: TCCCCCGGGCCAGAGAGTTCGCATTGTA;

[0012] The downstream primer dsOdfoGSTo1R is: ATTGCGGCCGCGAAGAAAGTAGTCCCTCGG.

[0013] Furthermore, dsOdfoGSTo1 and termite insecticide were used together to treat black-winged termites.

[0014] Furthermore, the insecticide is hydrazine.

[0015] The present invention also provides a recombinant expression vector, which expresses the dsOdfoGSTo1 mentioned above.

[0016] The present invention also provides a host bacterium, which is used to transform the above-mentioned recombinant expression vector.

[0017] The present invention also provides a method for preventing and controlling termites, which comprises treating termites with the above-mentioned dsOdfoGSTo1 and an insecticide.

[0018] Furthermore, the termites were first fed with dsOdfoGSTo1 and then fed with the insecticide.

[0019] Furthermore, the black-winged termites were first fed with 600 μL of dsOdfoGSTo1 with a concentration of 500 ng / μL for 24 hours, and then treated with 2.30 mg / mL of hydrazine solution for 96 hours.

[0020] The present invention also provides an application of a black-winged earth termite dsRNA in improving the toxicity of a termite insecticide, wherein the black-winged earth termite dsRNA is dsOdfoGSTo1.

[0021] Beneficial effects of the present invention:

[0022] The present invention innovatively uses the cutting-edge technology of HT115 (DE3) to expand dsRNA and successfully synthesizes dsOdfoGSTo1 of black-winged termites. dsOdfoGSTo1 was designed with the OdfoGSTo1 gene as a precise target, and an RNA interference system of dsOdfoGSTo1 of black-winged termites based on feeding method was deeply explored and constructed. Experimental observations show that the feeding operation achieves significant gene interference results in black-winged termites, which builds a solid theoretical framework and reliable technical support for the application of RNAi technology of dsOdfoGSTo1. At the same time, the dsRNA expression system is constructed with the help of HT115 (DE3) strain, which effectively reduces the interference cost and greatly improves the economy and feasibility of the technology. The dsOdfoGSTo1 synthesized by this system accurately and efficiently interferes with the expression of the OdfoGSTo1 gene. Further studies have found that when the OdfoGSTo1 gene is successfully silenced, the toxicity of hydrazine to black-winged termites is significantly enhanced. Experimental data show that when dsOdfoGSTo1 is used in conjunction with hydrazine, the mortality rate of black-winged termites rises sharply, which strongly proves that it can significantly improve the control efficiency of insect growth regulators. The present invention not only lays a theoretical foundation for the development of green, environmentally friendly, precise and efficient detoxification enzyme inhibitors, but also opens up a new path for my country's green and sustainable development. It is of great significance and has broad prospects in many aspects such as ecological protection and agricultural and forestry production. It can reduce ecological damage and help agricultural and forestry production, and has great value and application expansion potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The mortality rate of black-winged termites after being treated with a combination of hydrazine and the GST inhibitor diethyl maleate (DEM);

[0024] Note: “*” indicates significant differences among different treatments

[0025] Figure 2 OdfoGST for the treatment of black-winged termites with hydrazine O The relative expression of 1;

[0026] Figure 3OdfoGST was fed with dsRNA for 6h, 12h, 24h and 48h O The relative expression of 1;

[0027] Figure 4 for dsOdfoGST O 1 and hydrazine treatment to black-winged termites.

[0028] Note: ABCD are the mortality rates at 24h, 48h, 72h and 96h respectively, and E is the survival curve DETAILED DESCRIPTION

[0029] The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0030] Experimental materials and methods involved in the examples:

[0031] (1) Test insects: Black-winged termites were collected from Nanjing, Jiangsu Province. After the ant nests were collected, they were kept in an insect incubator under dark conditions of 25±1°C and relative humidity of 90±5%.

[0032] (2) Preparation of hydrazine solution

[0033] The original drug of food-inhibiting hydrazine was dissolved in acetone solution to prepare drug solutions with concentrations of 2.30 mg / mL and 8.72 mg / mL.

[0034] (3) Determination of the toxicity of hydrazine to black-winged termites

[0035] The toxicity of hydrazine to black-winged termites was determined by referring to Part 8 "Filter Paper Film Method" of the "Guidelines for Indoor Bioassay Tests of Pesticides" and modifying it.

[0036] The present invention is further described in detail below in conjunction with specific embodiments. The embodiments will help to understand the present invention, but the protection scope of the present invention is not limited to the following embodiments.

[0037] Example 1 Toxicity determination of the combined use of hydrazine and GST inhibitor diethyl maleate (DEM) against black-winged termites

[0038] Dissolve the hydrazine in acetone and prepare it to a concentration of 8.72 mg / mL (LC of hydrazine against black-winged termites at 48 h). 50 ) solution, and DEM was added to the hydrazine solution to make the final concentration of DEM 50mg / L. Filter paper was placed on the bottom of each culture dish with a diameter of 70mm and moistened with water. 600μL of the hydrazine solution without DEM (LC 50treatment group) and DEM hydrazine solution (LC 50 &DEM treatment group), after acetone volatilized, 30 black-winged soil termites were placed in a culture dish, and acetone was used instead of the drug solution as a control (CK), and each treatment was repeated 5 times. The treated black-winged soil termites were placed in a dark environment with a temperature of 25±1℃ and a relative humidity of 90±5%, and the death was observed and recorded every 12 hours. The mortality was corrected by the Abbott formula: (TC) / (100-C)×100% (where T represents the mortality of the treatment group and C represents the mortality of the control group).

[0039] like Figure 1 As shown in Table 1, DEM can significantly increase the toxicity of hydrazine to black-winged termites. The toxicity data of hydrazine to black-winged termites are shown in Table 1. At 36h, the LC 50 The adjusted mortality rate of the treatment group was 39.42%, LC 50 The corrected mortality rate of the DEM treatment group was 64.23%; at 48h, LC 50 The adjusted mortality rate of the treatment group was 45.74%, LC 50 The adjusted mortality rate of the DEM-treated group was 82.95%.

[0040] Example 2 Cloning of the full-length gene of OdfoGSTo1

[0041] (1) Primer design: Based on the sequence of OdfoGSTo1 obtained from the transcriptome data, primers were designed using Primer Premier5 software:

[0042] c-OdfoGSTo1F:ATGAGCGAAGAACACCTTTC;

[0043] c-OdfoGSTo1R:TTACAGATTGTCAAACTCTGG.

[0044] (2) cDNA amplification and TA cloning:

[0045] The total RNA of Coptotermes nigropteroides was extracted by Trizol method, and the total RNA was used as template for reverse transcription according to the instruction of HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) of Vazyme Company. The reverse transcription system is shown in Table 1.

[0046] Table 1. Reverse transcription system

[0047]

[0048]

[0049] Using cDNA as a template, primers OdfoGSTo1F and OdfoGSTo1R were used for amplification, and PCR amplification reaction was performed according to the instructions of 2×Rapid Taq Master Mix of Vazyme. The PCR amplification system is shown in Table 2, and the PCR amplification reaction conditions are: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 54°C annealing for 30 s, 72°C extension for 30 s, for a total of 35 cycles; 72°C final extension for 5 min.

[0050] Table 2. PCR reaction system

[0051]

[0052] The PCR amplification products were detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. The identified correct PCR products were purified and recovered by a gel recovery kit. TA cloning was performed according to the instructions of Vazyme's Ultra-Universal TOPO Cloning Kit. The TA cloning system is shown in Table 3.

[0053] Table 3. TA cloning ligation system

[0054]

[0055] The ligation product was then transformed into DH5α competent cells. The transformation steps of the ligation product were as follows:

[0056] (1) Gently mix the ligation product with 50 μL of competent cells (DH5α) and immediately place on ice for 30 min;

[0057] (2) Heat shock in a 42°C water bath for 45 seconds, then immediately place in ice water for 2 minutes;

[0058] (3) Add 500 μL of LB liquid medium without resistance and incubate at 37°C, 200 rpm / min for 60 min with shaking;

[0059] (4) Centrifuge the resuscitated product at 8000 rpm for 2 min;

[0060] (5) After centrifugation, aspirate part of the supernatant, retain 100-120 μL, mix by pipetting, and aspirate 35-50 μL, spread it evenly on LB solid medium containing Amp penicillin (final concentration 50 μg / mL) using sterilized glass beads, and culture inverted in a 37°C incubator overnight;

[0061] (6) Pick a single colony from the cultured colonies and place it in liquid LB medium supplemented with Amp penicillin (final concentration 50 μg / mL) and culture at 200 rpm / min until turbidity;

[0062] (7) The cultured single colony liquid is verified by PCR, and the qualified bacterial liquid is sent to the company for sequencing.

[0063] The sequence is shown in SEQ ID NO. 1. The full-length sequence contains an open reading frame of 723 bp and encodes a polypeptide of 240 amino acids.

[0064] Example 3 Response of the OdfoGSTo1 gene of the black-winged termite to hydrazine

[0065] (1) Toxic experiment:

[0066] Filter paper was placed on the bottom of each petri dish with a diameter of 70 mm and moistened with water. 600 μL of 2.30 mg / mL (LC value of hydrazine for black-winged termites at 48 h) was added to the filter paper. 20 ) of hydrazine degrading agent, after acetone volatilized, 40 black-winged soil termites were placed in a culture dish, and acetone was used instead of hydrazine degrading agent as a control (CK), and each treatment was repeated 3 times. The treated black-winged soil termites were placed in a dark environment with a temperature of 25±1°C and a relative humidity of 90±5%, and samples were collected at 12h, 24h, 36h and 48h, and stored in a -80°C environment.

[0067] (2) cDNA amplification:

[0068] Extraction of total RNA from Coptotermes nigropteroides using Trizol

[0069] Using total RNA as a template, rapid reverse transcription was performed according to the instructions of Vazyme's HiScript IIQ RT SuperMxi for qPCR (+gDNAwiper) to synthesize cDNA. The rapid reverse transcription system is shown in Table 4:

[0070] Table 4. Rapid reverse transcription system

[0071]

[0072] (3) Real-time quantitative PCR (RT-qPCR):

[0073] LC testing by RT-qPCR 20 After the treatment with hydrazine, the expression levels of OdfoGSTo1 in the control group and the treatment group at 12h, 24h, 36h and 48h, with RPS18 and GAPDH as internal reference genes, and the primers used for detection are as follows:

[0074] q-OdfoGSTo1 F:TGTCGGCGCTATCAATACAG

[0075] q-OdfoGSTo1 R:GAAGAAAGTAGTCCCTCGGTTC

[0076] q-RPS18 F:ATGGCAAACCCCCGTCAGTA

[0077] q-RPS18 R:CATACCACGATGCGCACGAA

[0078] q-GAPDH F:TCGTATTGGCCGTCTTGTGC

[0079] q-GAPDH R: AGCGACCATGGGTGGAATCAT;

[0080] The expression of genes was detected using Vazyme's ChamQ Blue Universal SYBR qPCR Master Mix. The RT-qPCR reaction system is shown in Table 5:

[0081] Table 5. RT-qPCR system

[0082]

[0083] Reaction procedure:

[0084] Stage 1: 95℃30s

[0085] Stage 2: 95℃10s, 60℃30s, 40cycles

[0086] Stage 3: 95℃15s, 60℃1min, 95℃15s

[0087] After obtaining the CT values ​​of the target gene and the internal reference gene, use 2 -ΔΔt Methods The relative expression levels of target genes were calculated, and the obtained data were analyzed for significant differences through independent sample T test using SPSS26.0 software.

[0088] like Figure 2 As shown in the figure, through the fluorescence quantitative experiment, it was found that OdfoGSTo1 was significantly upregulated after the black-winged termite was treated with 2.30 mg / mL of hydrazine for 36 hours. (*** represents P < 0.001, ** represents P < 0.01, * represents P < 0.05, ns represents no difference).

[0089] Example 4 Synthesis and inducible expression of dsOdfoGSTo1 of Coptotermes nigropteroides

[0090] (1) Primer design for synthesizing dsOdfoGSTo1 of Coptotermes pygmaeus.

[0091] The sidirect online software (https: / / sidirect2.rnai.jp / ) predicted that the OdfoGSTo1 gene had 11 potential RNAi target sites in the 93-480 bp region. Based on the cloned OdfoGSTo1 sequence, PrimerPremier 5 software was used to design primers, and restriction sites Sma I and Not I were introduced upstream and downstream (where italic letters are protection bases, and bold letters are restriction sites):

[0092] dsOdfoGSTo1 F:TCCCCCGGGCCAGAGAGTTCGCATTGTA;

[0093] dsOdfoGSTo1 R:ATTTTGCGGCCGCGAAGAAAGTAGTCCCTCGG

[0094] At the same time, the primers for GFP were designed, and restriction sites Sac I and HindⅢ were introduced upstream and downstream:

[0095] dsGFP F: ATCGGAGCTCAGTTGAACGGATCCATCTTCA;

[0096] dsGFP R:CCCAAGCTTAGAACTTTTCACTGGA;

[0097] All primers were synthesized by Tianjin Qingke Biotechnology Co., Ltd.

[0098] (2) cDNA amplification

[0099] The total RNA of Coptotermes pygmaea was extracted by Trizol method.

[0100] Total RNA was used as a template and reverse transcription was performed according to the instructions of HiScipt II Strand cDNA Synthesis Kit of Vazyme to synthesize cDNA. The reverse transcription system is shown in Table 6:

[0101] Table 6. Reverse transcription system

[0102]

[0103] (3) Synthesis of dsOdfoGSTo1 in Coptotermes pygmaea

[0104] The obtained cDNA was used as a template, and PCR amplification was performed using upstream and downstream primers designed for synthesizing dsRNA; the reaction conditions for PCR amplification were: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 54℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles; 72℃ final extension for 10min. The PCR amplification products were detected by 1% agarose gel electrophoresis, and the correctly identified PCR products were purified and recovered by a gel recovery kit. The recovered target fragment and the L4440 vector were digested and linked, and the L4440-dsOdfoCYP301A1 recombinant plasmid was successfully constructed, and the L4440-dsGFP recombinant plasmid was constructed in the same way.

[0105] Taking L4440-dsOdfoGSTo1 as an example, its synthesis process is as follows: First, Sma I and Not I are used to perform double enzyme digestion on the PCR product; at the same time, the same two enzymes are used to perform double enzyme digestion on the expression vector L4440. The specific composition of the double enzyme digestion system is shown in Table 7. Subsequently, the double enzyme digestion product is detected by 1% agarose gel electrophoresis technology, and the identified product is purified and recovered by a gel recovery kit. Next, according to the system in Table 8, T4 DNA ligase is used to connect the target fragment and the target vector. After that, the connection product is transformed into HT115 (DE3) by a two-step method. Specifically, the connection product is first transformed into DH5α competent cells, placed on LB solid culture medium containing ampicillin and cultivated for 12 hours, and a single colony is selected. After PCR verification of its accuracy, it is sent to a sequencing company for sequencing analysis. The sequencing results are compared with the sequence of the target fragment, and the plasmid in the bacterial solution that matches the target fragment is extracted. Finally, the extracted plasmid was transformed into HT115 (DE3) again, and cultured on LB solid medium containing ampicillin and tetracycline for 12 hours. A single colony was selected, and its correctness was verified by PCR and then sent to a sequencing company for sequencing. The bacterial solution used to synthesize dsRNA with correct sequencing results was properly stored and expanded, thereby providing sufficient experimental material basis for subsequent related research and applications.

[0106] Table 7. Double enzyme digestion system for target fragments

[0107]

[0108] 37℃ overnight (the specific enzyme cutting time should be adjusted according to the actual situation)

[0109] Table 8. Connection system

[0110]

[0111] 16℃ overnight (the specific enzyme cutting time should be adjusted according to the actual situation)

[0112] (4) Induced expression and extraction of dsRNA.

[0113] The HT115 (DE3) strain containing L4440-dsOdfoGSTo1 and L4440-dsGFP recombinant plasmids were induced to express dsRNA, and the target fragment size was 388 bp and 500 bp, respectively. Then, the total RNA after induced expression was digested with DNaseⅠ and RNase A.

[0114] Taking L4440-dsOdfoGSTo1 as an example, after the sequencing is completed and the results are correct, the L4440-dsOdfoGSTo1 recombinant plasmid is accurately transformed into HT115 (DE3) competent cells, and then evenly coated on LB solid culture medium containing ampicillin (concentration of 75μg / mL) and tetracycline (concentration of 12.5μg / mL), placed in an environment of 37°C and cultured in an inverted state overnight. Next, carefully pick a single clone and inoculate it into LB liquid culture medium containing the same concentration of ampicillin and tetracycline, and shake and culture it at 37°C at a speed of 180rpm / min until the OD of the bacterial solution reaches 0.04. 600 When the value reaches the range of 0.5 to 0.6, IPTG is added at a final concentration of 0.8 mM, and then the culture is continued at 37°C and 180 rpm / min for 4 hours. After the culture is completed, the dsRNA is extracted using the Trizol method. After the extraction is completed, the extracted dsRNA is digested with RNAse A and DNAse I. Finally, the concentration of dsRNA is determined by the Eppendorf BioSpectrometer basic instrument and stored in a low temperature environment of -80°C for use.

[0115] Example 5 Determination of OdfoGSTo1 expression after dsOdfoGSTo1 interference

[0116] First, dsOdfoGSTo1 with a concentration of 500 ng / μL was mixed with a 0.1% Nile blue sulfate solution in a volume ratio of 1:1, and then 600 μL of the mixture was dripped onto the filter paper at the bottom of a 70 mm diameter petri dish. For the negative control, dsGFP was used to replace dsOdfoGSTo1, while the blank control was a combination of ddH2O and 0.1% Nile blue sulfate solution. Thirty black-winged termite workers were placed in each petri dish, and three replicates were set for each group. Subsequently, the petri dishes were placed in a dark environment with a temperature of 25±1℃ and a relative humidity of 90±5%. Termites with blue abdomens were collected at 6h, 12h, 24h, and 48h, and quickly placed in a low-temperature environment of -80℃ for storage. The expression level of OdfoGSTo1 at different times and under different treatments was tested by RT-qPCR experiments, with RPS18 and GAPDH as internal reference genes. The primers used for detection are as follows:

[0117] q-OdfoGSTo1 F:TGTCGGCGCTATCAATACAG

[0118] q-OdfoGSTo1 R:GAAGAAAGTAGTCCCTCGGTTC

[0119] q-RPS18 F:ATGGCAAACCCCCGTCAGTA

[0120] q-RPS18 R:CATACCACGATGCGCACGAA

[0121] q-GAPDH F:TCGTATTGGCCGTCTTGTGC

[0122] q-GAPDH R: AGCGACCATGGGTGGAATCAT;

[0123] The RT-qPCR reaction system is shown in Table 9:

[0124] Table 9. RT-qPCR system

[0125]

[0126] Reaction procedure:

[0127] Stage 1: 95℃30s

[0128] Stage 2: 95℃10s, 60℃30s, 40cycles

[0129] Stage 3: 95℃15s, 60℃1min, 95℃15s

[0130] After obtaining the CT values ​​of the target gene and the internal reference gene, use 2 -ΔΔt Methods The relative expression of target genes was calculated, and the obtained data were analyzed by one-way analysis of variance using SPSS26.0 software.

[0131] In order to detect the changes in the expression of the target gene at different time periods after dsRNA feeding, RT-qPCR detection was performed on the cDNA samples of the control group (CK) and the dsRNA treatment group of black-winged termites. The results showed that at 6 hours, the inhibition rate of dsOdfoGSTo1 on the OdfoGSTo1 gene of black-winged termites was 44.74%; at 12 hours, the inhibition rate of dsOdfoGSTo1 on the OdfoGSTo1 gene of black-winged termites was 60.91%; at 24 hours, the inhibition rate of dsOdfoGSTo1 on the OdfoGSTo1 gene of black-winged termites was 80.11%; at 48 hours, the inhibition rate of dsOdfoGSTo1 on the OdfoGSTo1 gene of black-winged termites was 77.25% (as shown in Figure 2). Figure 3 Different lowercase letters indicate significant differences among treatments).

[0132] It can be seen that dsOdfoGSTo1 reaches the maximum interference efficiency at 24h, and 24h is the best interference time for dsOdfoGSTo1.

[0133] Example 6 Effect of dsOdfoGSTo1 treatment on the toxicity of hydrazine to inhibit feeding

[0134] dsOdfoGSTo1 (500ng / μL) was mixed with Nile blue sulfate solution (0.1% w / w) in a volume ratio of 1:1, and then 600μL was dripped on the filter paper at the bottom of a 70mm diameter culture dish; dsGFP was used to replace dsOdfoGSTo1 in the negative control, and ddH2O and Nile blue sulfate solution (0.1% w / w) were used as blank controls. Thirty black-winged termite workers were added to each culture dish. They were placed in a dark environment at a temperature of 25±1℃ and a relative humidity of 90±5% for 24h. Afterwards, the treated termites were divided into a hydrazine-treated group (2.30mg / mL hydrazine-treated solution) and an acetone-treated group (control group), and the treated termites were placed in a dark environment at a temperature of 25±1℃ and a relative humidity of 90±5%, and the mortality rate was observed and calculated at intervals of 24h.

[0135] Through bioassay experiments, it was found that after being treated with dsOdfoGSTo1, the toxicity of hydrazine to black-winged termites was significantly increased. At 24h, the mortality rate of the dsOdfoGSTo1 and hydrazine combined treatment group was the highest, reaching 22.67%, followed by the dsOdfoGSTo1 treatment group, with a mortality rate of 13.33%; at 48h, the dsOdfoGSTo1 and hydrazine combined treatment group showed the highest mortality rate, which was 57.33%, while the mortality rate of the dsOdfoGSTo1 treatment group was 41.33%; at 72h, the mortality rate of the dsOdfoGSTo1 and hydrazine combined treatment group was the highest, which was 77.33%, followed by the dsOdfoGSTo1 treatment group, with a mortality rate of 56.00%; at 96h, the mortality rate of the dsOdfoGSTo1 and hydrazine combined treatment group was 98.00%, while the mortality rate of the dsOdfoGSTo1 treatment group was 71.33%. The survival curve showed that the survival rate of the dsOdfoGSTo1 and hydrazine combined treatment group was significantly lower than that of the dsGFP and hydrazine combined treatment group and the dsOdfoGSTo1 treatment group ( Figure 4 ). *** represents P < 0.001, ** represents P < 0.01, * represents P < 0.05, and ns represents no difference.

[0136] The above is only a preferred embodiment of the present invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. ds OdfoGSTo1 The application in the control of black-winged termites is characterized in that: The ds OdfoGSTo1 is the dsRNA of black-winged termite, OdfoGSTo1 The nucleotide sequence is shown in SEQ ID NO: 1; the synthetic ds OdfoGSTo1 The targeted nucleotide sequence is shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that The ds OdfoGSTo1 Upstream primer ds OdfoGSTo1 F and downstream primer ds OdfoGSTo1 R is amplified by PCR, where Upstream primer ds OdfoGSTo1 F is: TCC CCCGGGCCAGAGAGTTCGCATTGTA; Downstream primer ds OdfoGSTo1 R is: ATTT GCGGCCGCGAAGAAAGTAGTCCCTCGG.

3. The use according to claim 1, characterized in that ds OdfoGSTo1 Use with termite insecticide to treat black-winged termites.

4. The use according to claim 3, characterized in that The insecticide is hydrazine.

5. A recombinant expression vector, characterized in that: It expresses the ds described in claim 1 OdfoGSTo1 .

6. A host bacterium, characterized in that The recombinant expression vector according to claim 5 is transformed therein.

7. A method for preventing and controlling termites, characterized in that: Using the ds according to claims 1-4 OdfoGSTo1 Use with insecticide to treat termites.

8. The method according to claim 7, characterized in that Use ds first OdfoGSTo1 After feeding the termites, feed them insecticide.

9. The method according to claim 7, characterized in that: First, use 600 μL of 500 ng / μL ds OdfoGSTo1 After feeding on black-winged termites for 24 hours, the black-winged termites were treated with 2.30 mg / mL hydrazine solution for 96 hours.

10. A use of dsRNA of black-winged termites for improving the toxicity of termite insecticides, characterized in that: The black-winged termite dsRNA is ds OdfoGSTo1 .

Images