Transcription factor gene PagBES1 for regulating and controlling poplar wood yield and wood fiber length and application of transcription factor gene PagBES1

Abstract

The invention relates to a gene PagBES1 for regulating and controlling poplar wood yield and wood fiber length and application of the gene PagBES1, and belongs to the technical field of plant genetic engineering. The nucleotide sequence is shown as a sequence 3 in a sequence table, and the amino acid sequence is shown as a sequence 4 in the sequence table. The PagBES1 gene is transferred into the poplar, compared with a wild type, the plant height of the PagBES1 activated and expressed transgenic poplar is remarkably increased, the ground stem is remarkably thickened, the number of cell layers of stem vascular tissues is remarkably increased, the length and width of wood fibers are remarkably increased, secondary cell walls are remarkably deposited and thickened, and the phenotype of the PagBES1 inhibited and expressed transgenic poplar is opposite to the phenotype of the PagBES1 inhibited and expressed transgenic poplar. Therefore, the PagBES1 gene is a key regulatory gene for regulating the generation of poplar wood, and has important application value in the fields of forest gene engineering and clonal forestry.

Description

Technical Field

[0001] The invention relates to a key transcription factor gene on a brassinolide signal transduction pathway and an application thereof, in particular to a gene PagBES1 for regulating poplar wood yield and wood fiber length and an application thereof, belonging to the technical field of biological gene engineering. Background Art

[0002] Trees are the core components of terrestrial ecosystems. They can convert and store a large amount of photosynthetic products in wood, thus becoming an important renewable resource for human society. As a key link in the global carbon cycle, wood plays an important role as a carbon sink in terrestrial ecosystems and plays a vital role in maintaining global carbon balance. The severe shortage of wood resources and heavy reliance on imports have restricted the development of my country's papermaking industry. In industry, high-quality paper is obtained by plasticizing and dissolving the lignin in wood fiber cells, re-interweaving cellulose and hemicellulose. The improvement of wood fiber raw materials has great biological significance for the papermaking industry. The longer the fiber, the greater the aspect ratio, the higher the fiber ratio, the better the flexibility and elasticity, and the fiber raw materials with low lignin and high cellulose are more favorable as production raw materials.

[0003] Poplar is an economic tree species widely distributed around the world. Its wood is not only used for processing industry, but also an important raw material for plywood, fiberboard, papermaking, sanitary chopsticks and packaging industries. It not only has huge economic benefits, but also great ecological and social benefits. Therefore, it is urgent to develop new poplar varieties with increased wood yield and improved wood quality. Using molecular biology and genetic engineering technology to increase poplar wood yield and improve poplar wood quality has important theoretical significance and application value.

[0004] Wood yield and quality are determined by the division activity of meristematic stem cells in the vascular cambium and the differentiation activity of the xylem. Previous studies have shown that the division activity and xylem differentiation activity of the poplar vascular cambium are regulated by the hormone signal of brassinolide. The increase in brassinolide content promotes the formation of wood and significantly increases the biomass of wood tissue.

[0005] Brassinolide transmits signals to the downstream transcription factor BES1 through a series of signal cascade reactions, thereby regulating the transcription of BR-responsive genes. Therefore, studying the role of BES1 in plant development can further reveal the molecular mechanism of brassinolide regulating wood formation, which is conducive to creating new poplar varieties with high-quality wood quality.

[0006] Therefore, a gene PagBES1 that regulates poplar wood yield and wood fiber length and its application are provided. Based on molecular biology and genetic engineering technology, poplar is used as the research object to provide new ideas for analyzing the molecular mechanism of brassinolide regulating poplar wood formation, which is of great significance for forest breeding and improvement. Summary of the invention

[0007] In view of the deficiencies in the prior art, one of the objectives of the present invention is to provide a key transcription factor gene PagBES1 on the brassinolide signal transduction pathway that regulates the development of poplar vascular tissue and wood formation.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] A gene PagBES1 that regulates poplar wood yield and wood fiber length, the nucleotide sequence of which is shown in Sequence 3 in Table 3.

[0010] Another object of the present invention is to provide the expression protein of the gene PagBES1 that regulates poplar wood yield and wood fiber length.

[0011] The above object of the present invention is achieved through the following technical solutions:

[0012] An expression protein of gene PagBES1 regulating poplar wood yield and wood fiber length, whose amino acid sequence is shown in sequence 4 in Table 4.

[0013] Another object of the present invention is to provide a plant expression vector of the gene PagBES1 that regulates poplar wood yield and wood fiber length.

[0014] The above object of the present invention is achieved through the following technical solutions:

[0015] A plant expression vector of gene PagBES1 for regulating poplar wood yield and wood fiber length, wherein the nucleotide sequence of the activation expression vector and the inhibition expression vector are shown in sequence 8 in Table 8 and sequence 12 in Table 12, respectively.

[0016] Another object of the present invention is to provide a method for constructing a plant expression vector of the gene PagBES1 that regulates poplar wood yield and wood fiber length.

[0017] The above object of the present invention is achieved through the following technical solutions:

[0018] A method for constructing a plant expression vector of the gene PagBES1 that regulates poplar wood yield and wood fiber length, the steps of which are as follows:

[0019] (1): Cloning of PagBES1 gene

[0020] Total RNA of 84K (P. alba × P. glandulosa) was extracted from tissue culture seedlings using the RNeasy Plant Mini kit and RNase-free DNase I kit (Qiagen, Hilden, Germany). 2.0 μg of RNA was extracted from each sample and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Primers were designed using Primer3 software (amplicon included the start codon and stop codon) with reference to the published genome sequence of P. trichocarpa, and gene amplification was performed. The gene was named PagBES1.

[0021] (2): Construction of plant expression vector of PagBES1 gene

[0022] The activation expression and inhibition expression vectors of PagBES1 gene were constructed by cloning technology, and the vector-specific PCR primers were designed by Oligo7 software. The previously amplified PagBES1 was used as a template for PCR amplification.

[0023] The CDS of PagBES1 gene was constructed into the destination vectors, which were pCAMBIA1300 (SEQ entry vector pCAMBIA1300: 10177 bp) and pCAMBIA3300 (SEQ entry vector pCAMBIA3300: 8429 bp);

[0024] (3) Digest the target vector with Hind III enzyme;

[0025] (4) The target gene with vector-specific primers at both ends was constructed into plant expression vectors pCAMBIA1300 and pCAMBIA3300 by homologous recombination reaction. The sequences of the final vectors constructed are shown in Sequence 8 in Table 8 and Sequence 12 in Table 12, respectively;

[0026] (5) The final constructed vectors were MASpro-PagBES1-VP16 and PagBES1pro-PagBES1-SRDX.

[0027] Preferably, in step (1), the PagBES1 CDS forward primer is as shown in Sequence 1 in Table 1, and the PagBES1 CDS reverse primer is as shown in Sequence 2 in Table 2; the high-fidelity PCR reaction system is as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5 μL, PagBES1 CDS forward primer (10 μM) 0.15 μL, PagBES1CDS reverse primer (10 μM) 0.15 μL, template (84K poplar cDNA) 0.8 μL, sterile ddH2O is added to 15 μL, reaction procedure: 98°C, 1 min; (98°C, 10 s; 56°C, 15 s; 72°C, 2 min: 35 cycles); 72°C, 3 min.

[0028] Preferably, in step (2), the PagBES1 vector-specific forward primer is shown as Sequence 5 in Table 5, and the PagBES1 vector-specific reverse primer is shown as Sequence 6 in Table 6.

[0029] Preferably, in step (3), the enzyme digestion system is as follows: 5 ng of target vector pCAMBIA1300 or pCAMBIA3300 (volume converted according to concentration); 3 μL of HindⅢ enzyme; 3 μL of 10×green buffer; ddH2O, made up to 30 μL, reaction system: 37°C, 30 min.

[0030] Preferably, in step (4), the homologous recombination reaction system: 80 ng of pCAMBIA1300 or pCAMBIA3300 digested with HindⅢ (the default amount of the target vector is 80 ng, and the volume is converted according to the concentration); 3.75 μL of homologous recombination enzyme; ddH2O, supplemented to 10 μL, reaction system: 37°C, 30 min.

[0031] Preferably, in step (5), a 35S small promoter is present downstream of the PagBES1 promoter and at the 5' end of the PagBES1 gene, so that the PagBES1 gene is efficiently expressed in poplar; and a strong terminator NOS is assembled at the 3' end of the PagBES1 gene to effectively terminate the transcription of the PagBES1 gene.

[0032] Another object of the present invention is to provide genetic transformation of the gene PagBES1 which regulates poplar wood yield and wood fiber length.

[0033] The above object of the present invention is achieved through the following technical solutions:

[0034] The invention discloses a genetic transformation of gene PagBES1 for regulating wood yield and wood fiber length of poplar, and the steps are as follows: constructing an activation expression vector MASpro-PagBES1-VP16 and an inhibition expression vector PagBES1pro-PagBES1-SRDX are transferred into Agrobacterium EHA105 by a cold shock method, and the PagBES1 gene is transferred into 84K poplar by an Agrobacterium-mediated leaf disc transformation method.

[0035] Another object of the present invention is to provide an application of gene PagBES1 for regulating poplar wood yield and wood fiber length.

[0036] The above object of the present invention is achieved through the following technical solutions:

[0037] The application of PagBES1, a gene that regulates poplar wood yield and wood fiber length, in regulating the growth and development of poplars, especially in regulating the development of poplar vascular tissue and wood formation.

[0038] The invention has the following advantages: the invention uses 84K silver gland poplar as material and clones the PagBES1 gene; at the same time, constructs an activation expression vector MASpro-PagBES1-VP16 and an inhibition expression vector PagBES1pro-PagBES1-SRDX, and a 35S small promoter is provided at the downstream of the PagBES1 own promoter and the 5' end of the PagBES1 gene, so that the PagBES1 gene is efficiently expressed in the poplar, thereby regulating the development of the poplar vascular tissue and the wood formation.

[0039] Compared with the prior art, the present invention transfers the PagBES1 gene into poplars. Compared with the wild type, the transgenic poplars with activated PagBES1 have significantly increased plant height, significantly thickened stems, significantly increased cell layers in the stem vascular tissue, significantly increased wood fiber length and width, and significantly deposited and thickened secondary cell walls, while the phenotype of the transgenic poplars with inhibited PagBES1 expression is the opposite. This indicates that PagBES1, a key transcription factor gene in the brassinolide signal transduction pathway of poplars, is an important regulatory factor controlling the development of poplar vascular tissues. The PagBES1 gene can significantly improve plant growth, and can promote vascular tissue development and wood formation, and has important application value in the fields of forest genetic engineering and forestry engineering.

[0040] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but this does not mean to limit the scope of protection of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 It is a schematic diagram of the structure of the plant activation expression vector MASpro-PagBES1-VP16 in Example 1 of the present invention.

[0042] Figure 2 It is a schematic diagram of the structure of the plant inhibitory expression vector PagBES1pro-PagBES1-SRDX in Example 1 of the present invention.

[0043] Figure 3 This is a comparison of plant height and ground stem phenotypes of transgenic poplars with activated and inhibited expression of PagBES1 and non-transgenic poplars in Example 1 of the present invention.

[0044] Figure 4 This is a fluorescence quantitative PCR detection diagram of the transcription level of transgenic poplars with activated and inhibited expression of PagBES1 in Example 1 of the present invention.

[0045] Figure 5-1 It is a comparison diagram of semi-thin sections of vascular tissues of transgenic poplars with activated and inhibited expression of PagBES1 and non-transgenic poplars in Example 1 of the present invention.

[0046] Figure 5-2 It is a statistical graph of the phloem thickness, cambium cell layer number and xylem cell layer number of the vascular tissue of the transgenic poplars with activated expression and inhibited expression of PagBES1 and the non-transgenic poplars in Example 1 of the present invention.

[0047] Figure 6 This is a comparison diagram of the wood fiber length and width of transgenic poplars with activated and inhibited expression of PagBES1 and non-transgenic poplars in Example 1 of the present invention.

[0048] Figure 7 This is a comparison of the thickness of the secondary cell wall of wood fibers of transgenic poplars with activated and inhibited expression of PagBES1 and non-transgenic poplars in Example 1 of the present invention. DETAILED DESCRIPTION

[0049] The present invention is further described below in conjunction with specific examples. Operations not described in detail in the following examples can be implemented by referring to molecular cloning and the instructions for use of related kits.

[0050] Example 1

[0051] Step (1): Cloning of PagBES1 gene

[0052] Total RNA was extracted from 84K (P. alba X P. glandulosa) tissue culture seedlings using the RNeasy Plant Mini kit and RNase-free DNase I kit (Qiagen, Hilden, Germany). 2.0 μg of RNA was extracted from each sample and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Primers were designed using the Oligo7 software (amplicon included the start codon and stop codon) with reference to the published genome sequence of P. trichocarpa, and gene amplification was performed. The gene was named PagBES1.

[0053] Among them, the PagBES1 CDS forward primer is shown in sequence 1 in Table 1;

[0054] Table 1

[0055] name Sequence 1 PagBES1 CDS forward primer ATGACGTCAGATGGGGCCAC

[0056] The PagBES1 CDS reverse primer is shown as Sequence 2 in Table 2 ;

[0057] Table 2

[0058] name Sequence 2 PagBES1 CDS reverse primer ACTCCGAGCCTTGCCACCTC

[0059] The high-fidelity PCR reaction system was as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5 μL, forward primer (10 μM) 0.15 μL, reverse primer (10 μM) 0.15 μL, template (84K poplar cDNA) 0.8 μL, sterile ddH2O to 15 μL, reaction procedure: pre-denaturation at 98°C, 1 min; (denaturation at 98°C, 10 s; annealing at 56°C, 15 s; extension at 72°C, 2 min) for a total of 35 cycles; final extension at 72°C, 3 min;

[0060] The final gene cDNA sequence obtained was 954 bp, and the sequence is shown in Sequence 3 in Table 3 (SEQ PagBES1 gene cDNA: 954 bp);

[0061] Table 3

[0062]

[0063] The protein sequence compiled and expressed is shown in Sequence 4 in Table 4;

[0064] Table 4

[0065]

[0066] Step (2): Construction of plant expression vector of PagBES1 gene

[0067] The activation expression and inhibition expression vectors of PagBES1 gene were constructed by cloning technology, and the vector-specific PCR primers were designed by using Oligo7 software. The previously amplified PagBES1 was used as a template for PCR amplification; wherein the specific forward primer of PagBES1 activation expression vector is shown in Sequence 5 in Table 5;

[0068] Table 5

[0069] name Sequence 5 PagBES1 CDS-specific forward primer ATCGATACCGTCGAGATGACGTCAGATGGGGCCACT

[0070] The specific reverse primer of PagBES1 activation expression vector is shown as Sequence 6 in Table 6;

[0071] Table 6

[0072] name Sequence 6 PagBES1 CDS-specific reverse primer GATTAGCTTTGTTCACTCCGAGCCTTGCCACCTCC

[0073] The CDS of the PagBES1 gene was constructed into the target vector, the target vector was pCAMBIA1300 (SEQ entry vector pCAMBIA1300: 10177 bp); the target vector sequence is shown in Sequence 7 in Table 7;

[0074] Table 7

[0075]

[0076]

[0077]

[0078]

[0079] The target vector needs to be digested with HindⅢ enzyme first:

[0080] The enzyme digestion system is as follows: the target vector pCAMBIA1300 is 5 ng (volume is calculated based on the concentration); HindⅢ enzyme 3 μL; 10x enzyme digestion buffer 3 μL; ddH2O is added to 30 μL; reaction system: 37°C, 30 min; through homologous recombination reaction, the target gene with vector-specific primers at both ends is constructed into the plant expression vector pCAMBIA1300, and the sequence of the final vector constructed is shown in Sequence 8 in Table 8; homologous recombination reaction system: pCAMBIA1300 digested with HindⅢ is 80 ng (the default amount of the target vector is 80 ng, and the volume is calculated based on the concentration); (target fragment mass / number of target fragment bases) / (target vector amount 80 ng / number of target vector bases) = 3; the target fragment mass can be obtained, and the target fragment volume can be converted based on the target fragment concentration; homologous recombination enzyme amount 3.75 μL; ddH2O is added to 10 μL; reaction system: 37°C, 30 min;

[0081] Table 8

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] The specific forward primer of the PagBES1 inhibition expression vector is shown in Sequence 9 in Table 9;

[0088] Table 9

[0089] name Sequence 9 PagBES1 CDS-specific forward primer ACAATTACAATTACCATGACGTCAGATGGGGCCACT

[0090] The specific reverse primer of PagBES1 activation expression vector is shown as Sequence 10 in Table 10;

[0091] Table 10

[0092] name Sequence 10 PagBES1 CDS-specific reverse primer GAATTCCTGCAGCCCACTCCGAGCCTTGCCACCTCC

[0093] The CDS of the PagBES1 gene was constructed into the target vector, the target vector was pCAMBIA3300 (SEQ entry vector pCAMBIA3300: 8429 bp); the target vector sequence is shown in Sequence 11 in Table 11;

[0094] Table 11

[0095]

[0096]

[0097]

[0098] The target vector needs to be digested with HindⅢ enzyme first:

[0099] The enzyme digestion system is as follows: 5 ng of target vector pCAMBIA3300 (volume converted according to concentration); 3 μL of HindⅢ enzyme; 3 μL of 10x enzyme digestion buffer; ddH2O is added to 30 μL; reaction system: 37°C, 30 min; through homologous recombination reaction, the target gene with vector-specific primers at both ends is constructed into the plant expression vector pCAMBIA3300, and the sequence of the final vector constructed is shown in Sequence 12 in Table 12; homologous recombination reaction system: 80 ng of pCAMBIA3300 digested with HindⅢ (the default amount of the target vector is 80 ng, and the volume is converted according to the concentration); (target fragment mass / number of target fragment bases) / (target vector amount 80 ng / number of target vector bases) = 3; obtain the target fragment mass, and convert the target fragment volume according to the target fragment concentration; 3.75 μL of homologous recombination enzyme; 10 μL of ddH2O is added; reaction system: 37°C, 30 min;

[0100] Table 12

[0101]

[0102]

[0103]

[0104]

[0105] The final constructed vectors are MASpro-PagBES1-VP16 and PagBES1pro-PagBES1-SRDX. The 5' end of the PagBES1 gene has a MAS constitutive promoter or a 35S small promoter, which enables the PagBES1 gene to be efficiently expressed in poplar. The strong terminator NOS is assembled at the 3' end of the PagBES1 gene to effectively terminate the transcription of the PagBES1 gene. Figure 1 As shown, it is a schematic diagram of the structure of the plant activation expression vector MASpro-PagBES1-VP16 in Example 1 of the present invention; Figure 2 , which is a schematic diagram of the structure of the plant inhibitory expression vector PagBES1pro-PagBES1-SRDX in Example 1 of the present invention;

[0106] The MASpro-PagBES1-VP16 vector finally constructed was assembled with hygromycin phosphotransferase HPT, which was used as a screening marker for transgenic poplars. Hygromycin can be used to screen transgenic poplars. PCR detection and sequencing verification confirmed that the activation expression vector was successfully constructed, and this type of transgenic poplar was named MASpro-PagBES1-VP16 (sequence 8); the PagBES1pro-PagBES1-SRDX vector finally constructed was assembled with a resistance gene encoding glufosinate acetyltransferase (PAT), which was used as a screening marker for transgenic poplars. Glufosinate can be used to screen transgenic poplars. PCR detection and sequencing verification were performed (SEQ MASpro-PagBES1-VP16: 11296bp); the inhibition expression vector was successfully constructed, and this type of transgenic poplar was named PagBES1pro-PagBES1-SRDX (sequence 12) (SEQ PagBES1pro-PagBES1-SRDX: 11429bp);

[0107] Step (3) Genetic transformation of PagBES1 gene

[0108] The constructed target vector carrying the PagBES1 gene was transferred into Agrobacterium EHA105 by the cold shock method, and the PagBES1 gene was transferred into 84K poplar by the Agrobacterium-mediated leaf disc method. The transformation steps were as follows: the 84K tissue culture seedlings used for genetic transformation were cultured at a temperature of 22-25°C, a light intensity of 16 / 8h (day / night), and a light intensity of 50μmol*m -2* s -1The target vector carrying the PagBES1 gene was transferred into Agrobacterium EHA105. The Agrobacterium infected 84K leaf discs at OD600 = 0.6-0.8. The infected leaf discs were co-cultured in a co-culture medium (WPMS (Woody Plant Medium Screen) containing 100 μM acetosyringone (AS)) at a temperature of 22±2°C in the dark for 2 days. The leaf discs infected with the Agrobacterium carrying the activated expression vector after co-culture were transferred to a screening medium (WPMS, supplemented with 1.0 mg / L hygromycin B and 200 mg / L Timentin) 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.1 mg / L kinetin, continue dark culture for one and a half months; transfer the rice-sized callus to a differentiation medium (WPMD, supplemented with 0.05 mg / L naphthaleneacetic acid (NAA), 0.5 mg / L 6-benzylaminopurine (6-BA)) and 0.05 mg / L thiadiazole (TDZ) containing 2 mg / L hygromycin B and 200 mg / L Timentin) until resistant adventitious buds are induced, and the resistant adventitious buds are transferred to a rooting medium, and DNA from leaves of rooted plants is extracted and verified by PCR; the leaf discs infected with Agrobacterium carrying the inhibition expression vector after co-culture are transferred to a screening medium (WPMS, supplemented with 1.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.1 mg / L kinetin, continue dark culture for one and a half months; transfer rice-sized callus to differentiation medium (WPMD, added with 0.05 mg / L naphthaleneacetic acid (NAA), 0.5 mg / L 6-benzylaminopurine (6-BA)) and 0.05 mg / L thidiazuron (TDZ) containing 5 mg / L glufosinateammonium and 200 mg / L Timentin, until resistant adventitious buds are induced, transfer the resistant adventitious buds to rooting medium, extract DNA from leaves of rooted plants, and verify by PCR;

[0109] Step (4): Application of PagBES1 gene

[0110] Under the same growth conditions, wild-type 84K and transgenic poplars were cultured for 60 days, the external growth status of the plants was observed, the stems were sliced ​​to observe the accumulation of wood biomass, and the length of wood fiber cells was compared using the wood separation method;

[0111] The experimental results are as follows Figures 3 to 7 As shown, Figure 3As shown, it is a comparison of plant height and ground stem phenotype of transgenic poplars with activated expression of PagBES1 and inhibited expression of PagBES1 and non-transgenic poplars in Example 1 of the present invention (photographed by Nikon Z30, at a distance of 1m and a focal length of 16-50mm), wherein the upper figure is a comparison of plant height of transgenic poplars with activated expression of PagBES1 and inhibited expression of PagBES1 and non-transgenic poplars, and the lower figure is a comparison of ground stem phenotype of transgenic poplars with activated expression of PagBES1 and inhibited expression of PagBES1 and non-transgenic poplars; the leftmost is a non-transgenic poplar, one of which was selected for mapping, and the statistical data is for three replicates, MAS-BES1-VP16 is a PagBES1 overexpression vector, wherein 1, 2, and 3 are three strains; BES1-SRDX is a PagBES1 inhibition expression vector, wherein 1, 2, and 3 are three strains); as Figure 4 As shown in , it is the result of fluorescence quantitative PCR experiment on transcription level of transgenic poplars with activated expression of PagBES1 and inhibited expression of PagBES1 in Example 1 of the present invention. The bar graph in the figure shows the expression amount of PagBES1 gene in wild type (84K) and transgenic poplars respectively (MAS-BES1-VP16 is a PagBES1 activation expression vector, wherein 1, 2, 3 are three strains; BES1-SRDX is a PagBES1 inhibition expression vector, wherein 1, 2, 3 are three strains); as shown in 5-1, it is a comparison diagram of semi-thin sections of vascular tissue of transgenic poplars with activated expression of PagBES1 and inhibited expression of PagBES1 and non-transgenic poplars in Example 1 of the present invention (Thermo Fisher EVOS FLAuto2, photographed under 10x conditions), Figure 5-1 In the figure, the wild type is on the far left, and the transgenic poplar is on the right; Figure 5-2 As shown, it is a statistical diagram of the thickness of phloem, the number of cambium cell layers and the number of xylem cell layers of the vascular tissue of transgenic poplars with activated and inhibited expression of PagBES1 and non-transgenic poplars in Example 1 of the present invention; Figure 6 As shown, it is a comparison diagram of the wood fiber cell sizes of the transgenic poplar with activated expression of PagBES1 and inhibited expression of PagBES1 and the non-transgenic poplar in Example 1 of the present invention, wherein A is a comparison diagram of the wood fiber cell sizes of the transgenic poplar with activated expression of PagBES1 and inhibited expression of PagBES1 and the non-transgenic poplar in Example 1 of the present invention (Thermo Fisher EVOS FLAuto2, photographed under 10x conditions); B is a statistical diagram of the length of the wood fiber cells of the wild type (84k) and the transgenic poplar; C is a statistical diagram of the width of the wood fiber cells of the wild type (84k) and the transgenic poplar; as shown Figure 7, which is a comparison diagram of the thickness of the secondary cell wall of wood fibers of transgenic poplars with activated expression of PagBES1 and inhibited expression of PagBES1 and non-transgenic poplars in Example 1 of the present invention, wherein A is a comparison diagram of the thickness of the secondary cell wall of wood fibers of transgenic poplars with activated expression of PagBES1 of the present invention and wild-type 84K poplar; B is a comparison diagram of the thickness of the secondary cell wall of wood fibers of transgenic poplars with inhibited expression of PagBES1 of the present invention and wild-type 84K poplar (JEOL JEM-1230, JAPAN, photographed under 200000×); the left side is the wild type, the right side is the transgenic poplar, and C is a bar graph showing the statistical graph of the thickness of the secondary cell wall of wood fibers of wild type (84k) and transgenic poplars.

[0112] The results show that compared with the wild type, the transgenic poplars with activated expression of PagBES1 had significantly increased plant height, significantly thickened ground stems, significantly increased cell layers in stem vascular tissue, significantly increased wood fiber length and width, and significantly deposited and thickened secondary cell walls, while the phenotype of transgenic poplars with inhibited expression of PagBES1 was the opposite. This indicates that PagBES1, a key transcription factor gene in the poplar brassinolide signaling pathway, is an important regulatory factor controlling the development of poplar vascular tissue. The PagBES1 gene can significantly improve plant growth, promote vascular tissue development and wood formation, and has important application value in the fields of forest genetic engineering and forestry engineering.

[0113] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A gene PagBES1 for regulating poplar wood yield and wood fiber length, characterized in that: Its nucleotide sequence is shown in SEQ ID NO:

3.

2. The expression protein of the gene PagBES1 for regulating poplar wood yield and wood fiber length as claimed in claim 1, whose amino acid sequence is shown in Sequence No.

4.

3. A plant expression vector of the gene PagBES1 that regulates poplar wood yield and wood fiber length, characterized in that: The nucleotide sequence of the plant activation expression vector MASpro-PagBES1-VP16 is shown in Sequence 8, and the nucleotide sequence of the plant inhibition expression vector PagBES1pro-PagBES1-SRDX is shown in Sequence 12.

4. A method for constructing a plant expression vector of the gene PagBES1 for regulating poplar wood yield and wood fiber length as claimed in claim 3, comprising the following steps: (1) Cloning of PagBES1 gene Using 84K silver gland poplar as material, the total RNA of 84K tissue culture seedlings was extracted; the first chain of cDNA was synthesized; primers, including PagBES1 CDS forward primer and PagBES1 CDS reverse primer, were designed to amplify the full length of the gene; (2) Construction of plant expression vector of PagBES1 gene The activation expression vector and the inhibition expression vector of PagBES1 gene were constructed by cloning technology, and vector-specific PCR primers were designed, including PagBES1 vector-specific forward primer and PagBES1 vector-specific reverse primer. PagBES1 amplified from 84K cDNA was used as a template for PCR amplification. The CDS of PagBES1 gene was constructed into the target vector, which was pCAMBIA1300 and pCAMBIA3300. (3) The target vector needs to be digested with HindIII enzyme first; (4) The target gene with vector-specific primers at both ends was constructed into the plant expression vectors pCAMBIA1300 and pCAMBIA3300 through homologous recombination reaction; (5) The final constructed vectors were MASpro-PagBES1-VP16 and PagBES1pro-PagBES1-SRDX.

5. The method for constructing the plant expression vector of the gene PagBES1 for regulating poplar wood yield and wood fiber length according to claim 4, characterized in that: In step (1), the PagBES1 CDS forward primer is shown in Sequence 1, and the PagBES1 CDS reverse primer is shown in Sequence 2; the high-fidelity PCR reaction system is as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5 μL, 10 μM PagBES1 CDS forward primer 0.15 μL, 10 μM PagBES1 CDS reverse primer 0.15 μL, template 84K poplar cDNA 0.8 μL, sterile ddH2O is added to 15 μL, reaction program: 98°C, 1 min; 98°C, 10 s; 56°C, 15 s; 72°C, 2 min, 35 cycles; 72°C, 3 min.

6. The method for constructing the plant expression vector of the gene PagBES1 for regulating poplar wood yield and wood fiber length according to claim 5, characterized in that: In step (2), the PagBES1 vector-specific forward primer is shown in Sequence 5, and the PagBES1 vector-specific reverse primer is shown in Sequence 6.

7. The method for constructing the plant expression vector of the gene PagBES1 for regulating poplar wood yield and wood fiber length according to claim 6, characterized in that: In step (3), the enzyme digestion system is as follows: target vector pCAMBIA1300 or pCAMBIA3300 5 ng; HindⅢ enzyme 3 μL; 10x green buffer 3 μL; ddH2O, make up to 30 μL, reaction system: 37°C, 30 min.

8. The method for constructing the plant expression vector of the gene PagBES1 for regulating poplar wood yield and wood fiber length according to claim 7, characterized in that: In step (4), the homologous recombination reaction system: 80 ng of pCAMBIA1300 and pCAMBIA3300 digested with HindⅢ; 3.75 μL of homologous recombination enzyme; ddH2O, supplemented to 10 μL, reaction system: 37°C, 30 min; in step (5), a 35S small promoter is present downstream of the PagBES1 promoter itself and at the 5' end of the PagBES1 gene, so that the PagBES1 gene is efficiently expressed in poplar; a strong terminator NOS is assembled at the 3' end of the PagBES1 gene to effectively terminate the transcription of the PagBES1 gene.

9. The genetic transformation of the gene PagBES1 for regulating poplar wood yield and wood fiber length as claimed in claim 2, wherein the steps are as follows: the constructed activation expression vector MASpro-PagBES1-VP16 and the inhibition expression vector PagBES1pro-PagBES1-SRDX are transferred into Agrobacterium EHA105 by the cold shock method, and the PagBES1 gene is transferred into 84K poplar by the Agrobacterium-mediated leaf disc transformation method.

10. Use of the gene PagBES1 for regulating poplar wood yield and wood fiber length according to claim 1 in regulating the growth and development of poplars, especially in regulating the development of poplar vascular tissue and wood formation.

Images