Application of StABI5 gene in regulation and control of autophagy of potatoes

Abstract

The invention belongs to the technical field of gene engineering, and discloses application of an StABI5 gene in regulation and control of autophagy of potatoes. The invention finds that the StABI5 gene has the function of regulating and controlling the size and thickness of potato leaves for the first time, clarifies the relationship between the StABI5 gene and potato autophagy, puts forward the regulation and control effect of the StABI5 gene on potato autophagy for the first time, has great significance on potato breeding by researching the relationship and action mechanism between the StABI5 gene and potato autophagy, and has a broad application prospect. And a foundation is laid for potato variety improvement and germplasm resource innovation.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an application of a StABI5 gene in regulating potato autophagy. Background Art

[0002] Potato (Solanum tuberosum L.) is the world's third largest food crop after rice and wheat. my country has become the world's largest potato producer and consumer. Potato is an important food crop. It has received widespread attention from all over the world for its strong adaptability, high yield, complete nutrients and long industrial chain. More than 1 billion people eat potatoes worldwide, and the total global potato production exceeds 374 million tons. In China, potatoes have become the fourth largest staple food crop after rice, wheat and corn. However, my country's potato varieties are relatively single, and the main potato varieties lack genetic diversity. With the implementation of my country's strategy of making potatoes a staple food, potato variety improvement and germplasm resource innovation have become urgent needs. Therefore, it is particularly urgent and important to cultivate new potato varieties through breeding methods. Crop breeding includes traditional genetic breeding and molecular breeding. Traditional genetic breeding has a long cycle; molecular breeding can be used to genetically improve specific traits of plants, which can greatly shorten the breeding cycle. The key to molecular breeding is to explore important functional genes and clarify their specific functional mechanisms.

[0003] ABI5 (ABAinsensitive 5) is a key basic leucine zipper (bZIP) transcription factor in the ABA signaling pathway. It plays a key role in ABA signal transduction, seed development and germination, stress response, and reproductive development. ABI5 is mainly involved in the response of plants to stress. In adverse environments such as drought and high salt, plants synthesize a large amount of ABA. As an important transcription factor in the ABA signaling pathway, ABI5 can regulate the expression of a series of genes related to stress resistance, thereby improving the stress resistance of plants. For example, ABI5 can bind to the cis-element ABRE to regulate the expression of a large number of downstream drought resistance, salt tolerance and other related functional genes, thereby enhancing the stress resistance of plants. In addition, ABI5 is also involved in regulating plant photosynthesis. The promoters of the chlorophyll decomposition genes SGR1 and NYC1 contain G-box elements. ABI5 activates the expression of these genes by binding to the G-box elements in the promoter regions of the SGR1 and NYC1 genes. These functions make ABI5 one of the important genes for studying plant growth and development and stress response.

[0004] Plant autophagy is an intracellular self-degradation process that degrades, recycles and reuses unnecessary or damaged proteins and organelles in cells to maintain normal cell function and growth and development. Autophagy plays an important role in maintaining normal plant cell lifespan, delaying aging, and resisting biotic and abiotic stresses. Under adverse environmental stress conditions, plants recycle excess nutrients in cells through autophagy to maintain their own growth and survival. The occurrence of autophagy requires the participation of many autophagy-related genes ATGs (Autophagy-related genes). More than 30 ATGs have been identified in Arabidopsis, including ATG8, ATG12, ATG13 and other autophagy-related genes, which play an important role in the formation of autophagosomes and the regulation of autophagy. Potato autophagy is an important biological process that plays an important role in maintaining cell homeostasis, coping with stress conditions, and regulating growth and development. At present, a large number of autophagy-related genes have been found in potatoes to participate in the autophagy process, including StATG8, StATG12 and StATG13. By regulating the potato autophagy process, new potato varieties with stronger stress resistance, higher yield and better quality can be bred. Potatoes have the ability to cope with adverse stresses such as drought resistance, low temperature resistance and barrenness resistance. However, the function of the potato StABI5 gene has yet to be studied in detail, and the role of StABI5 in potato resistance to adverse stress has not been elucidated, especially the relationship between StABI5 and potato autophagy is still unclear. Summary of the invention

[0005] The purpose of the present invention is to provide an application of StABI5 gene in regulating potato autophagy in view of the above problems.

[0006] In order to achieve its purpose, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides a StABI5 gene mutant, whose nucleotide sequence is any one of the following:

[0008] (a) The 160 bp base A of the first exon of the StABI5 gene was deleted;

[0009] (b) The 376 bp C base of the first exon of the StABI5 gene is deleted;

[0010] The CDS sequence of the StABI5 gene is shown in SEQ ID NO.1.

[0011] The second aspect of the present invention provides an expression vector or a recombinant microorganism containing the above-mentioned StABI5 gene mutant.

[0012] The third aspect of the present invention provides the use of the StABI5 gene or the above-mentioned StABI5 gene mutant in regulating potato autophagy or in regulating the size and / or thickness of potato leaves.

[0013] In the above-mentioned application technology scheme, StABI5 protein and StATG8a bind to the promoter of StATG8h gene and activate the expression of downstream autophagy genes; overexpression of StABI5 can accelerate the autophagy process of transgenic potatoes induced by darkness.

[0014] In the above-mentioned application technology scheme, the above-mentioned StABI5 gene mutant causes the loss of StABI5 function, delays the yellowing and senescence of potato leaves, and the potato plants can partially restore the low photosynthetic efficiency in the dark, slowing down the autophagy process of potato plants.

[0015] The fourth aspect of the present invention provides an application of a gRNA for editing the potato StABI5 gene in regulating potato autophagy, the nucleotide sequence of the gRNA is shown in SEQ ID NO.10; the CDS sequence of the StABI5 gene is shown in SEQ ID NO.1.

[0016] The described regulation of potato autophagy causes StABI5 functional loss through mutation of the StABI5 gene, delays yellowing and senescence of potato leaves, and enables potato plants to partially recover low photosynthetic efficiency in darkness, slowing down the autophagy process of potato plants.

[0017] The StABI5 gene mutation is achieved by any of the following methods:

[0018] (a) The 160 bp base A of the first exon of the StABI5 gene was deleted;

[0019] (b) The base C at 376 bp of the first exon of the StABI5 gene is deleted.

[0020] The fifth aspect of the present invention provides a method for preparing a StABI5 gene mutant that regulates potato autophagy. First, a gRNA is designed for the potato StABI5 gene, and the synthesized gRNA sequence is inserted into a plant gene editing vector to obtain a recombinant vector. The recombinant vector is transferred into Agrobacterium, and positive clones are selected to transform potatoes to obtain a StABI5 gene mutant. The nucleotide sequence of the gRNA is shown in SEQ ID NO.10.

[0021] The above-mentioned preparation method first designs gRNA for the potato StABI5 gene, inserts the synthesized gRNA sequence between the EcoR I and Xba I restriction sites of the plant gene editing vector pP1C.4, obtains the recombinant vector pP1C.4-Cas9-StABI5, and transforms the recombinant vector into Agrobacterium, selects positive clones to transform potatoes, and obtains StABI5 gene mutants.

[0022] The beneficial effects of the present invention are as follows: the present invention discovers for the first time that the StABI5 gene has the function of regulating the size and thickness of potato leaves, clarifies the relationship between the StABI5 gene and potato autophagy, and proposes for the first time the regulatory effect of the StABI5 gene on potato autophagy. By studying the relationship and mechanism of action of StABI5 and potato autophagy, it has great significance for potato breeding and lays the foundation for potato variety improvement and germplasm resource innovation. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Potato StABI5 gene overexpression vector and transgenic potato identification results: Marker: Plus DNAMarker; De: Desiree.

[0024] Figure 2 This is the map of the potato StABI5 gene knockout vector.

[0025] Figure 3 This is the result of identifying the potato StABI5 gene knockout strain.

[0026] Figure 4 The growth phenotype of potatoes with overexpression and knockout of the StABI5 gene.

[0027] Figure 5 The phenotype of potato leaves with overexpression and knockout of StABI5 gene under dark conditions.

[0028] Figure 6 These are the results of chlorophyll fluorescence parameters of potato leaves with overexpression and knockout of StABI5 gene under dark conditions.

[0029] Figure 7 is the expression level of autophagy-related genes in potato under dark conditions.

[0030] Figure 8 These are the results of a dual luciferase experiment using the promoters of StABI5 and potato autophagy-related genes StATG8a and StATG8h. DETAILED DESCRIPTION

[0031] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0032] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0033] Example 1 Obtaining a StABI5-overexpressing transgenic potato line

[0034] ①Construction of StABI5 overexpression vector

[0035] The full-length CDS sequence of the StABI5 gene (as shown in SEQ ID NO. 1) was obtained through the potato genome database, and Nanjing GenScript Biotechnology Co., Ltd. was commissioned to synthesize the CDS sequence of StABI5 into the plant expression vector pTRANS_220 (purchased from Addgene plasmid library, Plasmid #91113), and the final vector containing the P35S::StABI5-HA expression cassette was obtained, which was named pK303-StABI5 ( Figure 1 A). The above vectors were transferred into GV3101 Agrobacterium and positive clones were screened. The positive clones were cultured in LB+Kana+Rif liquid medium at 28°C and 200 rpm until OD 600 =0.8. Pour the bacterial solution into a 50 mL sterile centrifuge tube and centrifuge at 5000 rpm for 10 minutes. Pour off the supernatant in a clean bench, then add 15 mL of MS solution containing 200 μM acetosyringone to resuspend the precipitate. Incubate slowly on a shaker at 22°C and 50 rpm for about 1 hour and set aside.

[0036] ②Transformation of potato with StABI5 overexpression vector

[0037] Cut the internodes (stem segments) about 10 mm long and with a cut surface diameter of not less than 2.5 mm from potato plants that have grown for about 4 weeks. Place the stem segments in a 90 mm round culture dish containing 15 mL of MS solution containing 200 μM acetosyringone to avoid drying. Add 1 mL of the Agrobacterium solution shaken in ① to the 90 mm round culture dish, then seal it with a sealing film and place it in a bacterial constant temperature shaker at 22°C and 50 rpm for 45 minutes. Pour the Agrobacterium suspension into the container and inactivate the Agrobacterium. Use sterile filter paper to absorb the moisture on the surface of the stem segment, and then place it on a co-culture solid culture medium (put 30 explants on each plate). After sealing the plate, transform in a 22°C incubator in the dark for 48 hours. Then transfer the transformed stem segments to a screening medium containing 50 mg / L kanamycin for culture, with about 10 stem segments on each plate. After sealing the plate, co-cultivate in a 22°C incubator under 16 hours of light (light intensity is 80-110 μE / m2 / s) and 8 hours of darkness. Replace the new screening medium every 2 weeks. When the positive seedlings grow out, carefully cut off the seedlings of about 5-10 mm in length and place them in the screening medium. After 14 days of cultivation in the screening medium, the potato seedlings that are still alive and can take root are subjected to subsequent PCR identification.

[0038] ③Identification of potato lines overexpressing StABI5 gene

[0039] A total of 15 potato plants that took root on kanamycin resistant medium were obtained, and the genome of the transgenic plants was extracted and positively detected by PCR. PCR amplification was performed using the primer 35S F (SEQ ID NO.2): 5'-CCATCGTTGAAGATGCCTCTGC-3' of the 35S promoter and the primer StABI5 R (SEQ ID NO.3): 5'-GCAACTAAAGCTCCTTCTCATCC-3' of the StABI5 gene, and the PCR enzyme was 2xTrans Start Fast Pfu PCRSuperMix (Quanshijin, China). The length of the amplified fragment was 1800 bp. The wild-type potato Desiree genome was used as a negative control. The results are shown in FIG. Figure 1 As shown in B, 11 transgenic strains were able to amplify bands of about 1800 bp, while the negative control had no band.

[0040] To verify whether the StABI5 gene was successfully expressed in transgenic potatoes, RNA was extracted from transgenic plants, and the expression level of the StABI5 gene in different transgenic plants was detected by fluorescence quantitative RT-PCR. The total RNA of the above samples was extracted using an RNA extraction kit (Invitrogen, USA); then cDNA was synthesized using FastKing-RT SuperMix (Tiangen, China); and quantitative PCR was performed on QuantStudio 3Real-Time PCRSystem (ABI, USA) using SuperReal PreMix Plus (Tiangen, China). StACTIN58 was used as an internal reference gene. Fluorescence quantitative RT-PCR primer sequences:

[0041] RT-StABI5 F(SEQ ID NO.4):5'-TCCTGGTTTATCCGCCACTTC-3',

[0042] RT-StABI5 R (SEQ ID NO.5):5'-TGGGAATCCACTGCCTCTTT-3';

[0043] RT-StACTIN58 F (SEQ ID NO.6):5'-GCTTCCCGATGGTCAAGTCA-3';

[0044] RT-StACTIN58 R (SEQ ID NO. 7): 5'-GGATTCCAGCTGCTTCCATTC-3'.

[0045] Three biological replicates were performed for each sample, and the data were expressed as 2 -ΔΔCt The top three transgenic potato lines with the highest StABI5 gene expression levels were OE8, OE16, and OE25. Figure 1 C. Potato lines OE8 and OE25 were selected for subsequent analysis.

[0046] Example 2 Obtaining potato StABI5 gene knockout strain

[0047] ①Construction of StABI5 knockout vector

[0048] CRISPR / Cas9 gene editing technology was used to knock out the function of StABI5 gene in potato. Potato Desiree variety was selected as the receptor material for gene editing. The full-length CDS sequence of StABI5 gene was input into http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPRR website for target design, and Target1 (underlined sequence of SEQ ID NO.8) and Target2 (underlined sequence of SEQ ID NO.9) were obtained. Target 1 and Target 2 were inserted into the front end of gRNA to obtain gRNA1 (Target 1_gRNA) and gRNA2 (Target 2_gRNA) sequences, and the expression of gRNA1 and gRNA2 were driven by AtU3 and AtU6 promoters of Arabidopsis thaliana, respectively. P AtU3 :gRNA1 and P AtU6 :gRNA2 were concatenated, and EcoR I (GAATTC) and Xba I (TCTAGA) restriction sites were added at the front and back ends of the sequence, respectively. The final sequence was named StABI5-gRNA, and the sequence is as follows:

[0049] gRNA1 (SEQ ID NO.8) (the underlined part is the Target1 sequence):

[0050] AACACACTGTTTGCGAGAGT GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT.

[0051] gRNA2 (SEQ ID NO.9) (the underlined part is the Target2 sequence):

[0052] AGCGTAAGTGAGCCCTGTCT GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT.

[0053] StABI5-gRNA (SEQ ID NO.10) (underlined are restriction enzyme cleavage sites):

[0054] GAATTC ATAAGCTTATGATTTCTTTTTTCTTACGAATTTTGCGTCCCACATCGGTAAGC

[0055] GAGTGAAGAAATAACTGCTTTATATGGCTACAAAGCACCATTGGTCAAACACACT

[0056] GTTTGCGAGAGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTA

[0057] TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTGTTTTAGTTCCACCACGA

[0058] TTATATTTGAAATTTACGTGAGTGTGAGTGAGACTTGCATAAGAAAATAAAATCTTTA

[0059] GTTGGGAAAAAAATTCAATAATATAAATGGGCTTGAGAAGGAAGCGAGGGATAGGCC

[0060] TTTTTCTAAAATAGGCCCATTTAAGCTATTAACAATCTTCAAAAGTACCACAGCGCTT

[0061] AGGTAAAGAAAGCAGCTGAGTTTATATATGGTTAGAGACGAAGTAGTGATTGAGCGT

[0062] AAGTGAGCCCTGTCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT TCTAGA .

[0063] Nanjing GenScript Biotechnology Co., Ltd. was commissioned to synthesize the StABI5-gRNA sequence and insert it between the EcoR I and Xba I restriction sites of the plant gene editing vector pP1C.4 to obtain the final vector pP1C.4-Cas9-StABI5. The vector map is shown in Figure 2 The above vectors were transformed into GV3101 Agrobacterium, and positive clones were obtained by screening.

[0064] ②Screening and identification of StABI5 gene knockout potato lines

[0065] According to the potato genetic transformation method in Example 1, Agrobacterium containing the pP1C.4-Cas9-StABI5 vector was transformed into potatoes, and positive transgenic potato seedlings were obtained by hygromycin resistance screening. The RNA of the rooted transgenic plants was extracted, and the total RNA of the above plants was extracted respectively using an RNA extraction kit (Invitrogen, USA); then, FastKing-RT SuperMix (Tiangen, China) was used to reverse transcribe it into cDNA. The CDS sequence of StABI5 was amplified using the primers StABI5 F (SEQ ID NO.11: 5'-ATGGGAGTACCAGAATCAGAGATG-3') and StABI5 R (SEQ ID NO.3: 5'-GCAACTAAAGCTCCTTCTCATCC-3') of StABI5, and the product size was 1281bp. PCR amplification was performed using 2x TransStart Fast Pfu PCR SuperMix (Quanshijin, China), and the amplified product was directly connected to Zero Cloning Vector (Quanshijin, China) was used to identify positive clones and sequence them to determine whether the StABI5 gene was edited. Sequencing verification found that the StABI5 gene of two potato lines (StABI5-KO4 and StABI5-KO37) was mutated ( Figure 3 ), among which, the StABI5-KO4 strain lacked the base A at the 160bp of the first exon of the StABI5 gene, resulting in a frameshift mutation, causing loss of StABI5 function. The StABI5-KO37 strain lacked the base C at the 376bp of the first exon of the StABI5 gene, resulting in a frameshift mutation, causing loss of StABI5 function ( Figure 3 ).

[0066] Example 3 Growth phenotype of potato with overexpression and knockout of StABI5 gene

[0067] The transgenic lines StABI5-OE8, StABI5-OE25, StABI5-KO4 and StABI5-KO37 in Example 1 and Example 2 and the control line Desiree were propagated in the laboratory. When the plants grew to about 5 cm, the well-growing and relatively uniform-sized test-tube seedlings were selected and transplanted into culture pots. Each pot was filled with the same weight of nutrient soil, and one test-tube seedling was planted in each pot. Five plants were transplanted for each line, and three replicates were set. The culture pots were placed at a temperature of 22°C and a light intensity of 200 μmol / m 2 / s, and the light-dark cycle was 16h light and 8h dark in a culture room. During the growth period, all plants were managed in the same way, and the same volume of water was poured into each pot each time. The growth phenotype of the plants was observed. Figure 4 The phenotype of the plant at one month of growth was found in potato plants that overexpressed the StABI5 gene, with larger and thicker leaves and stronger stems. The average leaf area was about 1 times larger than that of wild-type potato leaves. There was no significant difference between potato plants with StABI5 gene mutations and wild-type controls.

[0068] Example 4: StABI5 regulates potato autophagy

[0069] The transgenic lines StABI5-OE8, StABI5-OE25, StABI5-KO4 and StABI5-KO37 in Example 1 and Example 2 and the control line Desiree were propagated in the laboratory. When the plants grew to about 5 cm, the well-growing and relatively uniform-sized test tube seedlings were selected and transplanted into culture pots. Each pot was filled with the same weight of nutrient soil. One test tube seedling was planted in each pot, and 5 plants were transplanted for each line. The culture pots were placed at a temperature of 22°C and a light intensity of 200 μmol / m 2 / s, and a light-dark cycle of 16h light and 8h darkness in a culture room. During the growth period, all plants adopted the same management mode, and the same volume of water was poured into each pot each time. After one month of cultivation, leaves of the above strains were taken and treated in the dark to observe the senescence of the leaves. Leaves of the same size were taken and treated in the dark for 0, 2, and 4 days, respectively, to observe the senescence of the leaves and detect the chlorophyll fluorescence parameters Fv / Fm and Y(II). Fv / Fm is the maximum quantum yield of PS II, which reflects the potential maximum photosynthetic capacity (photosynthetic efficiency) of the plant; Y(II) reflects the actual light energy conversion efficiency of the leaves under light. Through phenotypic observation, it was found that transgenic potatoes overexpressing StABI5 can significantly accelerate the yellowing and senescence of leaves in the dark, while potato plants with mutations in the StABI5 gene can delay the yellowing and senescence of leaves ( Figure 5 ), indicating that StABI5 is involved in potato autophagy. The results of chlorophyll fluorescence parameters Fv / Fm and Y(II) showed that overexpression of StABI5 in transgenic potatoes reduced the photosynthetic efficiency of leaves in the dark, while potato plants with StABI5 gene mutations were able to partially restore the low photosynthetic efficiency in the dark ( Figure 6 ).

[0070] Example 5 StABI5 activates the expression of autophagy-related genes in potato

[0071] ① Detection of autophagy-related gene expression levels

[0072] In order to verify whether the accelerated senescence of transgenic potato leaves overexpressing StABI5 under dark conditions is related to autophagy, we detected the expression levels of autophagy-related genes. The leaves were treated under dark conditions for 0, 2, 4, and 6 days according to Example 4, and then RNA from the treated leaves was extracted. Fluorescence quantitative PCR was performed according to the method in Example 1, and the primers for quantitative PCR are shown in the following table:

[0073]

[0074]

[0075] The autophagy-related gene ATG8 has been widely used as an autophagy marker gene in plants to detect plant autophagy. When autophagy occurs, the expression level of ATG8 is significantly upregulated. The results of qRT-PCR showed that the expression levels of potato autophagy-related genes StATG8a and StATG8h were upregulated after dark treatment of potato leaves, indicating that dark treatment can induce potato autophagy. Moreover, compared with wild-type Desiree leaves, transgenic potato leaves overexpressing StABI5 can significantly promote the expression of StATG8a and StATG8h genes under dark conditions. The expression level reached the maximum after 2 days of darkness, and continued dark treatment reduced its expression level ( Figure 7 In addition, the StATG12 and StATG13 genes did not change significantly in the leaves of wild-type Desiree under continuous darkness, but were significantly upregulated in the leaves of transgenic potatoes overexpressing StABI5, and their expression levels reached the maximum after 2 days of darkness, and their expression levels decreased after continued darkness treatment ( Figure 7 ). These results indicate that darkness treatment can induce autophagy in potato, and overexpression of StABI5 in transgenic potato can accelerate the darkness-induced autophagy process, thereby accelerating leaf senescence.

[0076] ②StABI5 binds to the promoter of autophagy-related genes

[0077] The CDS sequence of StABI5 (as shown in SEQ ID NO.1) was synthesized at Nanjing GenScript Biotechnology Co., Ltd. and constructed into the multi-cloning site of the universal dual-luciferase vector pGreenII 62-SK, and named StABI5. The promoter sequences PStATG8a and PStATG8h of the StATG8a and StATG8h genes were synthesized at Nanjing GenScript Biotechnology Co., Ltd. and constructed into the multi-cloning site of the universal dual-luciferase vector pGreenII 0800-LUC, and named PStATG8a and PStATG8h, respectively. The StABI5, PStATG8a and PStATG8h vectors were respectively transferred into GV3101 Agrobacterium, and positive clones were screened. The positive clones were cultured in LB+Kana+Rif liquid medium at 28°C and 200rpm until OD 600 = 0.8. Then, the cells were collected by centrifugation at 4000 rpm for 10 min, and the Agrobacterium cells were suspended in infection solution (10 mM MgCl2, 10 mM MES, 200 μM acetosyringone) and allowed to stand at room temperature for 3 h.

[0078] Use a sterilized 1mL syringe needle to pierce 2 to 3 holes on the back of the tobacco plant leaves, use a needleless syringe to absorb the static bacterial solution, and inject 100μL of bacterial solution from the leaf wound. After the injection, place it in a 22℃ artificial culture room for normal culture for two days. Pick the leaves, apply the fluorescein potassium salt working solution (concentration 0.2mg / ml) on the back of the leaves, place it in the dark for 5-10min and take pictures. The leaves are photographed under an automatic luminescence detector (Tanon, model: Tanon 5200). At the same time, collect the infected leaf samples for liquid nitrogen grinding, take 0.2g of the ground sample and add 100μL of lysis buffer, stand at room temperature or shake for lysis for 5min, blow and absorb the cell lysis product into a 1.5mL centrifuge tube, centrifuge at 12000g for 2min at room temperature, and take the supernatant for subsequent detection. Add 100 μL of luciferase substrate equilibrated to room temperature to the test tube or ELISA plate, carefully pipette 20 μL of cell lysis supernatant into the test tube or ELISA plate well, quickly mix and immediately detect the luciferase reporter gene activity in an ELISA instrument. Figure 8As shown in the figure, it can be seen from the photographic results that the experimental group (PStATG8a+StABI5 and PStATG8h+StABI5) presents bright light, and the negative control (PStATG8a and PStATG8h) only presents blue light, indicating that the StABI5 protein can bind to the promoter region of the StATG8a and StATG8h genes. In addition, the results of the microplate reader assay showed that the luciferase activity of the experimental group was higher than that of the negative control group. The above results show that the StABI5 protein can bind to the promoters of the StATG8a and StATG8h genes and activate the expression of downstream autophagy genes.

[0079] The CDS sequence of StABI5 (SEQ ID NO.1) is shown below, and the underlined bases are the deletion mutation bases of StABI5-KO4 and StABI5-KO37:

[0080]

Claims

1. A StABI5 gene mutant, characterized in that: Its nucleotide sequence is any of the following: (a) The 160 bp base A of the first exon of the StABI5 gene was deleted; (b) The 376 bp C base of the first exon of the StABI5 gene is deleted; The CDS sequence of the StABI5 gene is shown in SEQ ID NO.

1.

2. An expression vector or recombinant microorganism containing the StABI5 gene mutant according to claim 1.

3. Use of the StABI5 gene or the StABI5 gene mutant according to claim 1 in regulating potato autophagy or in regulating potato leaf size and / or thickness.

4. The use according to claim 3, characterized in that: StABI5 protein and StATG8a bind to the promoter of StATG8h gene and activate the expression of downstream autophagy genes; overexpression of StABI5 can accelerate the autophagy process of transgenic potatoes induced by darkness.

5. The use according to claim 3, characterized in that: The StABI5 gene mutant described in claim 1 causes loss of StABI5 function, delays yellowing and senescence of potato leaves, enables potato plants to partially recover low photosynthetic efficiency in darkness, and slows down the autophagy process of potato plants.

6. An application of gRNA for editing potato StABI5 gene in regulating potato autophagy, characterized in that: The nucleotide sequence of the gRNA is shown in SEQ ID NO.10; the CDS sequence of the StABI5 gene is shown in SEQ ID NO.

1.

7. The use according to claim 6, characterized in that: The described regulation of potato autophagy causes StABI5 functional loss through mutation of the StABI5 gene, delays yellowing and senescence of potato leaves, and enables potato plants to partially recover low photosynthetic efficiency in darkness, slowing down the autophagy process of potato plants.

8. The use according to claim 7, characterized in that: The StABI5 gene mutation is achieved by any of the following methods: (a) The 160 bp base A of the first exon of the StABI5 gene was deleted; (b) The base C at 376 bp of the first exon of the StABI5 gene is deleted.

9. A method for preparing a StABI5 gene mutant for regulating potato autophagy, characterized in that: First, gRNA was designed for the potato StABI5 gene, and the synthesized gRNA sequence was inserted into a plant gene editing vector to obtain a recombinant vector. The recombinant vector was transferred into Agrobacterium, and positive clones were selected to transform potatoes to obtain StABI5 gene mutants. The nucleotide sequence of the gRNA is shown in SEQ ID NO.

10.

10. The preparation method according to claim 9, characterized in that: First, gRNA was designed for the potato StABI5 gene, and the synthesized gRNA sequence was inserted between the EcoR I and Xba I restriction sites of the plant gene editing vector pP1C.4 to obtain the recombinant vector pP1C.4-Cas9-StABI5. The recombinant vector was transferred into Agrobacterium, and the positive clones were selected to transform potatoes to obtain the StABI5 gene mutants.

Images