Fungus laccase overexpression gene, plasmid, strain and laccase expression method

Abstract

The invention discloses a fungal laccase overexpression gene, a plasmid, a strain and an expression method of laccase, and provides the fungal laccase overexpression gene GME12003g, and the nucleotide sequence of the fungal laccase overexpression gene GME12003g is as shown in SEQ ID No: 1; in addition, the invention provides an overexpression strain of the fungal laccase, and the overexpression strain of the fungal laccase is a strain obtained by overexpressing the fungal gene GME12003g in Trametes hirsuta AH28-2, and the overexpression strain of the fungal laccase is an overexpression strain of the fungal gene GME12003g in the Trametes hirsuta AH28-2. The fungal laccase overexpression strain is named as Trametes hirsuta AH28-2 (GME12003g-OE-5), the laccase activity of the transformed strain can reach 1000U / L under the condition of no induction, which is three times that of a wild type strain, and the strain has the characteristic of efficiently expressing laccase.

Description

Technical Field

[0001] The present application relates to the field of microbial technology, and in particular to a fungal laccase overexpression gene, a plasmid, a strain and a laccase expression method. Background Art

[0002] Laccase (benzenediol: oxygen oxidoreductase, EC1.10.3.2) is a type of copper-containing polyphenol oxidase that plays an important role in the efficient degradation of lignocellulose. Lignocellulose is a renewable resource with abundant reserves in nature. If various technical means are used to achieve efficient degradation of lignocellulose, it can not only reduce environmental pollution, but also alleviate the shortage of fossil energy, and has a very broad application prospect. Microbial degradation is the use of microbial colonies (including fungi, bacteria, etc.) to achieve the degradation of lignocellulose. Studies have shown that fungi are more capable of degrading lignocellulose than bacteria. Laccase, as the main lignocellulose-degrading enzyme secreted by most fungi, not only plays an important role in the efficient degradation of lignocellulose, but also has its catalytic advantages such as broad substrate specificity, O2 as an electron acceptor and H2O as a byproduct, and is applied to various industries, such as food processing, textiles, biofuels, biosynthesis and repair, biosensors, and cosmetics industries. However, the secretion of wild-type fungal laccase is low, and the extracellular laccase activity is weak. How to prepare laccase cheaply and safely has become a problem of great concern to many scholars. In order to solve this problem, people usually choose to heterologously express fungal laccase to increase the laccase yield. However, the heterologous expression in the existing technology has low yield, long fermentation cycle and high cost, which is difficult to meet industrial requirements.

[0003] In order to increase the production of fungal laccase, most approaches are to induce the expression of fungal laccase, but the obtained strains need to be induced by aromatic compounds to significantly increase the production of laccase, and the aromatic compounds used, such as guaiacol and o-toluidine, are toxic, posing pollution and safety risks. Therefore, it is urgent to find a safer and more efficient method to increase the production of fungal laccase. Summary of the invention

[0004] In view of the problems of the prior art, the present invention develops a method for screening transcription factors that regulate the expression of laccase to construct an overexpression strain, so that the yield of laccase is greatly increased without induction. The enzyme activity of the overexpression strain in pure culture in XH medium for 7 days is increased to 1000U / L, while the enzyme activity of the wild-type strain in pure culture for 7 days is only 300U / L. The strain has the advantage of significantly more efficient production of laccase.

[0005] The present invention achieves the invention purpose through the following technical solutions:

[0006] Technical solution 1:

[0007] A fungal laccase overexpression gene GME12003_g, the nucleotide sequence of the fungal laccase overexpression gene GME12003_g is shown in SEQ ID No: 1.

[0008] Technical solution 2:

[0009] A fungal laccase overexpression plasmid comprises the fungal laccase overexpression gene GME12003_g. The fungal laccase overexpression plasmid comprises a linearized recombinant pYSK7 plasmid and a connected L22-GME12003_g-L24 sequence. The L22-GME12003_g-L24 sequence is formed by connecting an L22 sequence and an L24 sequence on both sides of the fungal laccase overexpression gene GME12003_g, respectively.

[0010] Technical solution three:

[0011] The preparation method of the above-mentioned fungal laccase overexpression plasmid comprises the following steps:

[0012] a. The overexpressed gene GME12003_g and the pet-28a empty vector described in Technical Solution 1 were digested and connected with DNA ligase to obtain a connection vector;

[0013] b. Transform the ligated vector into E.coli DH5α competent cells for culture, and screen to obtain the recombinant plasmid;

[0014] c. Using L22-GME12003_g-F and L24-GME12003-R as primers, the recombinant plasmid obtained by screening in step b was used as a template to amplify the target sequence;

[0015] d. The obtained target sequence was purified and used as a template, and the L22 sequence and L24 sequence described in Technical Solution II were used as primers to amplify the L22-GME12003_g-L24 sequence;

[0016] e. The L22-GME12003_g-L24 sequence obtained in step d was connected to the linearized recombinant pYSK7 plasmid described in technical solution 2 by using the Saccharomyces cerevisiae homologous recombination method to obtain a fungal laccase overexpression plasmid.

[0017] As a further technical solution, the method for linearizing the recombinant pYSK7 plasmid is as follows: the recombinant pYSK7 plasmid is subjected to enzyme digestion, the enzyme digestion product is incubated at 37°C for 1.5 hours, and then purified by agarose gel method to obtain a linearized recombinant pYSK7 plasmid; the recombinant pYSK7 plasmid is a pYSK7 plasmid recombined with a promoter, and the nucleotide sequence of the promoter of the recombinant pYSK7 plasmid is shown in SEQ ID No: 2.

[0018] Technical solution 4:

[0019] A fungal laccase overexpression strain, wherein the fungal laccase overexpression strain is a strain obtained by overexpressing the fungal gene GME12003_g in Trametes shirsuta AH28-2;

[0020] The fungal laccase overexpression strain is named Trametes hirsuta AH28-2 (GME12003_g-OE-5), and the preservation unit is China Center for Type Culture Collection, address: Wuhan University, Wuhan, China, preservation date: November 12, 2024, and preservation number: CCTCCM20242538.

[0021] Technical solution five:

[0022] A method for preparing the above-mentioned fungal laccase overexpression strain comprises the following steps:

[0023] (1) Preparation of protoplasts of wild strain T. hirsuta AH28-2.

[0024] (2) The above-mentioned overexpression plasmid or the overexpression plasmid prepared by the above-mentioned preparation method is then transformed into the protoplasts described in step (1).

[0025] (3) Regenerating, pre-screening and re-screening the transformed protoplasts to obtain a strain overexpressing fungal laccase.

[0026] Technical solution six:

[0027] A method for expressing fungal laccase comprises culturing the above-mentioned overexpression strain or the overexpression strain prepared by the above-mentioned preparation method in a medium containing cellobiose (XH medium) for 144 hours, and then centrifuging the fermentation broth to remove the bacterial cells to obtain the fermentation supernatant to measure the laccase activity.

[0028] As a further technical solution, the components of the XH medium are as follows: 1.5% cellobiose, 0.1% trypsin, 0.15% DL-asparagine, 0.01% Na2HPO4, 0.1% KH2PO4, 0.001% CaCl2, 0.001% FeSO4.7H2O, 0.00257% adenine sulfate, 0.000005% vitamin B1, 0.0002% CuSO4.7H2O, sterilized at 115°C for 30 minutes.

[0029] In summary, the beneficial effects of the present invention are:

[0030] 1. The present invention screened out the fungal laccase overexpression gene GME12003_g, and overexpressed the gene in Trametes sp. AH28-2 by genetic means. The obtained strain can significantly increase the laccase production without any substance induction.

[0031] 2. The present invention provides an overexpression strain of the fungal laccase overexpression gene GME12003_g, named Tramete shirsuta AH28-2 (GME12003_g-OE-5). The constructed new strain can not only stably propagate and overexpress the above gene, but also the laccase yield can be increased by about 3 times compared with the wild T. hirsuta AH28-2 strain in the absence of any inducing substances. The strain has the advantage of significantly more efficient production of laccase. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the electrophoresis diagram of the GME12003_g sequence amplified in Example 1 of the present application;

[0033] Figure 2 This is a graph showing the changes in the transcription level of the laccase gene lacA in the GME12003_g overexpression strain;

[0034] Figure 3 This is a graph showing the changes in transcription levels of the GME12003_g gene in the GME12003_g overexpression strain;

[0035] Figure 4 The graphs of total laccase activity changes of overexpression strain and wild-type strain;

[0036] Figure 5 The diagram shows the changes in isozyme spectra of the overexpression strain and the wild-type strain. DETAILED DESCRIPTION

[0037] The present application is further described in detail below in conjunction with the accompanying drawings and embodiments.

[0038] The present invention provides a fungal laccase overexpression gene GME12003_g, the nucleotide sequence of the fungal laccase overexpression gene GME12003_g is shown in SEQ ID No: 1. The screened fungal gene GME12003_g can be obtained from Trametes hirsuta AH28-2, and overexpressing the gene in Trametes hirsuta AH28-2 can significantly increase the laccase yield.

[0039] The present application provides an overexpression strain of fungal laccase, wherein the overexpression strain of fungal laccase is a strain obtained by overexpressing the fungal gene GME12003_g of the present application in Trametes hirsuta AH28-2; the overexpression strain is named Trametes hirsuta AH28-2 (GME12003_g-OE-5); the depository unit is China Center for Type Culture Collection, address: Wuhan University, Wuhan, China, the deposit date is November 12, 2024, and the deposit number is CCTCCM20242538.

[0040] The Trametes hirsuta AH28-2 used in the present application is a wild laccase-producing strain, deposited in China Center for Type Culture Collection; address: Wuhan University, Wuhan, China; deposit date: November 29, 2005; deposit number: CCTCCNO: M205134.

[0041] To make the purpose, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the present invention will be fully described below in conjunction with the embodiments.

[0042] The primer sequences used in this application are prepared by a third-party biological enterprise commissioned by the inventor of this application, and the primer sequences are independently designed by the inventor of this application.

[0043] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0044] Example 1

[0045] This embodiment provides a method for preparing a fungal laccase overexpression gene GME12003_g, comprising the following steps:

[0046] 1) Total RNA of T.hirsutaAH28-2 strain was extracted and reverse transcribed into a cDNA template for PCR amplification to obtain the full-length sequence of GME12003_g. The amplification primers are shown in Table 1, the amplification system is shown in Table 2, and the amplification conditions are shown in Table 3.

[0047] Table 1 Amplification primers

[0048] Primer name Sequence (5'-3') GME12003_g-F ATGAACATCCCTCTCTTCCAGTTCC GME12003_g-R TCATCTCCCCATCGCCATCGCGAGC

[0049] Table 2 PCR reaction system

[0050]

[0051]

[0052] Table 3 PCR reaction conditions

[0053] Reaction Procedure Reaction conditions Pre-denaturation 96℃,5min transsexual 96℃，15s annealing 58℃，10s Extension 1 72℃, 30s, 30cycles Extension 2 72℃,5min

[0054] 2) The amplified product obtained in step 1) is tested on agarose gel and the target fragment is recovered. The electrophoresis test result is as follows: Figure 1 shown.

[0055] The recovered target sequence fragment was sequenced, and after sequence comparison, it was found that the target fragment was completely consistent with the sequence of the fungal laccase overexpression gene GME12003_g in the present application, thereby successfully obtaining the fungal laccase overexpression gene GME12003_g.

[0056] Example 2

[0057] This embodiment provides a method for preparing a fungal laccase overexpression plasmid, comprising the following steps:

[0058] 1) The fungal laccase overexpression gene GME12003_g obtained in Example 1 and the pet-28a empty vector were double-digested with BamHI and XhoI, and then the digested products were ligated with T4 DNA ligase to obtain a ligated vector;

[0059] 2) Transforming the vector prepared in step 1) into E. coli DH5α competent cells, culturing and screening to obtain positive clones, and performing plasmid extraction after sequencing verification to obtain the pet-28a-GME12003_g recombinant plasmid;

[0060] 3) Using the recombinant plasmid obtained in step 2) as a template, PCR amplification was performed to obtain the target sequence, the amplified product was detected with 1% agarose gel, and the target fragment was recovered, wherein the amplification primers are shown in Table 4, the amplification system is shown in Table 5, and the amplification conditions are shown in Table 6;

[0061] Table 4 Amplification primers

[0062]

[0063] Table 5 PCR reaction system

[0064] Component name Addition amount pET-28a-GME12003_G plasmid 2μL 2 × Apex HFFLPCR Master Mix 25μL L22-GME12003_g-F 2μL L24-GME12003_g-R 2μL <![CDATA[ddH2O]]> Add to 50 μL

[0065] Table 6 PCR reaction conditions

[0066]

[0067]

[0068] 4) Using the target fragment recovered in step 3) as a template, PCR amplification was performed again to obtain the L22-GME12003_g-L24 sequence, wherein the PCR primers used are shown in Table 7 below, the PCR system is shown in Table 8 below, and the PCR conditions used are the same as those in step 3);

[0069] Table 7 Amplification primers

[0070] Primers Sequence (5'-3') L22 ACATCCACCATCTCCGTTTTCCCCATCTACACACAACAAGCTTATCGCC L24 TGACTATAGCAGCCTCCTACCACTGGCCCTCTGGTCAACTATAATATTAT

[0071] Table 8 PCR reaction system

[0072] Component name Addition amount Glue recovery target fragment 4μL 2 × Apex HFFLPCR Master Mix 25μL L22 2μL L24 2μL <![CDATA[ddH2O]]> Add to 50 μL

[0073] 5) The recombinant pYSK7 plasmid was double-digested with BamHI and XhoI, incubated at 37°C for 1.5h, detected by 1% agarose gel electrophoresis, and the target fragment was recovered to obtain a linearized pYSK7 plasmid. The enzyme digestion reaction system is shown in Table 9;

[0074] Table 9 Double enzyme digestion reaction system

[0075]

[0076]

[0077] Wherein, the recombinant pYSK7 plasmid is a pYSK7 plasmid recombined with a promoter, and the nucleotide sequence of the promoter of the recombinant pYSK7 plasmid is shown in SEQ ID No: 2.

[0078] 6) Finally, using Saccharomyces cerevisiae competent cells, the L22-GME12003_g-L24 sequence prepared in step 4) was connected with the linearized pYSK7 plasmid prepared in step 5) by homologous recombination to obtain a fungal laccase overexpression plasmid.

[0079] The specific steps of the homologous recombination connection are as follows:

[0080] a. Mix 100 ng of overexpression plasmid and vector plasmid respectively and place them in pre-cooled Eppendorf tubes;

[0081] b. Boil the Carrier DNA in a boiling water bath for 5 minutes to denature it into a single-stranded state. After precooling, take 5 μL of Carrier DNA and add it to the mixed system;

[0082] c. Add 100 μL of Y1H competent cells melted on ice and flick to mix;

[0083] d. Add 500 μL PEG / LiAc solution (PEG3500, TE Buffer, LiAc in a ratio of 8:1:1), mix gently by pipetting, and react in a 30°C water bath for 30 min;

[0084] e. Centrifuge the reaction solution at 12000g for 10s, discard the supernatant, and add 1mL YPDA medium to resuspend the bacteria;

[0085] f. The resuspension was placed in a shaker at 30°C and 200 rpm for 1 h;

[0086] g. Centrifuge the resuspended solution at 12000g for 15s, discard the supernatant, and add 1mL of NaCl (0.9%) solution to resuspend the cells;

[0087] h. Centrifuge the resuspension at 12000g for 10s, discard the supernatant, spread 200μL of the bacterial solution on SD / -Ura solid medium, and culture in a 30°C incubator for 3 days;

[0088] i. Randomly pick 5 transformants and transfer them to 5 mL of liquid medium with Amp resistance added and shake culture at 30°C and 200 rpm;

[0089] j. Incubate on a shaking table for 16 hours; then centrifuge the culture solution at 12,000 g for 10 minutes, collect the bacteria, and store them in a -80°C refrigerator for later use;

[0090] k. Refer to the instructions of TIANGEN's yeast plasmid extraction kit to extract yeast plasmid, prepare overexpression plasmid and send it to the company for sequencing.

[0091] Example 3

[0092] This embodiment provides a method for constructing and screening a fungal laccase overexpression strain.

[0093] In this example, the wild laccase-producing strain T. hirsuta AH28-2 was selected as the basic strain.

[0094] The obtained overexpression plasmid was transformed into the protoplasts of T.hirsutaAH28-2 by PEG method, and the overexpression strain was obtained through regeneration, primary screening and secondary screening. The specific method is as follows:

[0095] (1) Preparation of protoplasts

[0096] The preparation of protoplasts specifically comprises the following steps:

[0097] A. Take 10 CPDA plates and culture the T.hirsutaAH28-2 strain. The culture environment is set at 28°C and the culture time is controlled at 7-8 days.

[0098] B. Under sterile conditions, add 5 mL of sterile water to each CPDA plate to soak the mycelium, scrape the mycelium on the surface of the plate with a sterile spoon, filter through a spore filter, and retain the filtrate;

[0099] C. The filtrate was centrifuged at 3000 g for 10 min, and the supernatant was discarded under sterile conditions to obtain the mycelium precipitate;

[0100] D. Add 8 mL of MM buffer to the mycelium sediment to resuspend and wash the spores, count briefly, and centrifuge again to discard the supernatant to obtain the mycelium;

[0101] E. Resuspend the spores with 1 mL (depending on the amount of spores) of cell wall lysing enzyme solution (containing 0.5% chitinase and 1.5% cellulase), and place in a 37°C constant temperature incubator for lysis for 5 h. Observe the degree of spore enzymolysis under a microscope every 1 h. When the generation rate of protoplasts reaches more than 50%, add 5 mL of MMC solution to terminate the enzymolysis reaction and obtain a cell suspension;

[0102] F. Centrifuge the cell suspension at 640g for 10 min, and slowly discard the supernatant under sterile conditions to obtain a cell pellet;

[0103] G. Add 400 μL of the sterilized MMC buffer to the cell pellet again to prepare T. hirsuta AH28-2 protoplasts.

[0104] (2) Protoplast transformation

[0105] The specific steps are as follows:

[0106] A. The successfully constructed overexpression plasmid was inoculated into LB liquid culture medium, and the plasmid was prepared by SDS lysis method;

[0107] B. Take 100 μL of protoplasts, 25 μL of PEG solution and 2 μg of overexpression plasmid into a sterile pre-cooled EP tube and mix well. Let stand at low temperature for 20 min. Add 500 μL of sterile PEG solution and mix well. Then react at room temperature for 5 min.

[0108] C. Add 1 mL of sterilized STC buffer to the system, mix well, apply 350 μL of the mixture on the regeneration medium, and culture at 28°C for 24 h;

[0109] D. Cover the regeneration medium with 5 mL of regeneration medium containing hygromycin (final concentration of 300 μg / mL) and culture at 28° C. for 72 h to obtain transformants.

[0110] (3) Screening of positive transformants

[0111] The following steps are involved:

[0112] A. Aseptically remove a single clone transformant using an inoculation loop and transfer it to a regeneration medium containing hygromycin at a final concentration of 300 μg / mL;

[0113] B. After 3 days, the selected transformed strains with hygromycin resistance were transferred to new CPDA medium and cultured for 7-8 days;

[0114] C. After the culture was completed, the mycelium was scraped from the plate, and 50 μL of the fungal genome extraction reagent MightyPrep was added thereto. The mixture was vortexed and mixed. The mixture was quickly frozen in liquid nitrogen after being placed in a boiling water bath for 10 min. The mixture was quickly frozen in liquid nitrogen after being placed in a boiling water bath for 10 min again. The mixture was finally placed in a boiling water bath for 5 min. The mixture was centrifuged at 12,000 g for 1 min, and the supernatant was transferred to a sterile EP tube to obtain a genome solution.

[0115] D. Using L22 sequence and L24 sequence as upstream and downstream primers, and genome solution as template solution, PCR amplification was performed. The PCR reaction system is shown in Table 10. The PCR amplification conditions are: 96°C pre-denaturation for 5 min, 96°C denaturation for 15 s, 58°C annealing for 10 s, 72°C extension for 30 s, a total of 30 cycles, and finally 72°C extension for 5 min.

[0116] Table 10 PCR reaction system

[0117] Component name Addition amount Genome 6μL 2 × Apex HFFLPCR Master Mix 10μL L22 0.5μL L24 0.5μL <![CDATA[ddH2O]]> Add to 20 μL

[0118] E. The amplified products were detected by 1% agarose gel. All transformed strains with target gene bands were successfully transformed with fungal laccase overexpression plasmid.

[0119] (4) Transcription level screening of overexpression strains

[0120] The following steps are involved:

[0121] 1) Extract RNA from wild type and positive transformants screened by PCR, and reverse transcribe into cDNA;

[0122] 2) Using the cDNA obtained in step 1) as a template, designing trans-intron fluorescence quantitative PCR primers, using glyceraldehyde triphosphate dehydrogenase gene (GAPDH) as an internal reference gene, and using a specific primer set on a LightCycler 96 (Roche) according to the SYBR Premix Ex TaqTMII kit (Takara), the transcription levels of lacA and GME12003_g were analyzed by qRT-PCR; the sequence of the specific primer set is shown in Table 11 below, the qRT-PCR reaction system is shown in Table 12, and the amplification conditions are shown in Table 13;

[0123] Table 11 Specific primer set sequences

[0124] Primer name Sequence (5'-3') lacA-qF TCCTTCGTGTTGAATGCCGA lacA-qR GTTGATACCGCCCGCAAATC GME12003_g-qF ACAAGGATGGCGAAGAGGGT GME12003_g-qR TGCACTGATTGCACCGACG GAPDH-qF GCCGCTTCAAGGGCAAAGTC GAPDH-qR TGTAGTCGGCACCAACGGA

[0125] Table 12 qRT-PCR reaction system

[0126] Component name Addition amount T.hirsutaAH28-2cDNA 1μL 2×SYBR Premix Ex Taq II 10μL lacA-qF / GME12003_g-qF 1μL lacA-qR / GME12003_g-qR 1μL <![CDATA[ddH2O]]> 7μL Total 20μL

[0127] Table 13 PCR reaction conditions

[0128]

[0129]

[0130] 3) The strains of the present application in which the transcription level of the fungal laccase overexpression gene GME12003_g is significantly higher than that of the wild-type T. hirsuta AH28-2 are selected by rescreening, thereby obtaining the fungal laccase overexpression strain.

[0131] In this example, the strain with the highest transcription level of the fungal laccase overexpression gene GME12003_g was selected, and the results obtained by detection and analysis were as follows: Figure 2 and Figure 3 shown.

[0132] Depend on Figure 2 and Figure 3 It can be seen that, compared with the wild-type T. hirsuta AH28-2 strain, the transcription level of the laccase gene lacA in the fungal laccase overexpression strain finally screened in this example increased by more than 1.4 times, and the transcription level of the GME12003_g gene increased by more than about 2 times.

[0133] The strain sent for preservation was used as the basic strain, and after subculture, the bacteria obtained by subculture were taken and qRT-PCR detection was performed again, using the same operation steps as the qRT-PCR rescreening in this embodiment. After detection, the expression level of the laccase gene lacA and the expression level of the GME12003_g gene in the bacteria obtained by subculture were not significantly different from those of the basic strain, so the fungal laccase overexpression strain of the present application can stably subculture and overexpress the fungal laccase overexpression gene GME12003_g.

[0134] Example 4: Preparation of fungal laccase overexpressing strain laccase

[0135] This example selects the Trametes hirsutaAH28-2 (GME12003_g-OE-5) strain of the present invention, and specifically includes the following steps:

[0136] 1) Inoculate the overexpression strain into a CPDA plate for activation. Take a piece of bacterial cell from the glycerol tube and inoculate it into the center of the CPDA solid culture medium plate. Place it in a 28°C incubator for static culture and continue to observe. When the hyphae grow to 1 cm from the edge of the culture dish (7-8 days), the activation is complete.

[0137] 2) Use a cork puncher to take 6 pieces of mycelium with a diameter of about 0.5 cm from the activated plate, and place them in 100 mL of XH medium for shaking culture at 28°C and 120 rpm;

[0138] 3) After four days of culture, the cells were homogenized, and 5% (v / v) of the cells were taken out and placed in a new 100 mL XH medium, and cultured at 28°C and 120 rpm;

[0139] The XH medium has the following components: 1.5% cellobiose, 0.1% tryptone, 0.15% DL-asparagine, 0.01% Na2HPO4, 0.1% KH2PO4, 0.001% CaCl2, 0.001% FeSO4.7H2O, 0.00257% adenine sulfate, 0.000005% vitamin B1, 0.0002% CuSO4.7H2O, sterilized at 115°C for 30 min;

[0140] 4) After three days of cultivation, a sample was taken and marked as 0h. After centrifugation at 4°C, the supernatant was taken to measure the enzyme activity. The fermentation liquid was then taken every 24h and marked according to the time. When the enzyme activity reached the highest (about 144h), the fermentation was stopped.

[0141] 5) The fermentation broth is centrifuged to remove the supernatant, and then concentrated and purified by ultrafiltration to obtain laccase.

[0142] Detection experiment:

[0143] The wild-type T.hirsutaAH28-2 strain was used as a control, and the same steps as in this example were used to detect the laccase activity of the Trametes hirsutaAH28-2 (GME12003_g-OE-5) strain and the wild-type T.hirsutaAH28-2 strain, respectively. At 0h, 24h, 48h, 72h, 96h, 120h and 144h of fermentation, samples were taken to determine the total laccase activity and isozyme spectrum.

[0144] The test results are as follows Figure 4 and Figure 5As shown, the results show that the laccase activity of the Trametes hirsuta AH28-2 (GME12003_g-OE-5) strain of the present invention can reach 1000U / L without induction, which is about 3 times that of the wild-type strain. The strain has the characteristic of efficiently expressing laccase.

[0145] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A fungal laccase overexpression gene GME12003_g, characterized in that: The nucleotide sequence of the fungal laccase overexpression gene GME12003_g is shown in SEQ ID No:

1.

2. A fungal laccase overexpression plasmid, characterized in that: The invention comprises the fungal laccase overexpression gene GME12003_g as described in claim 1, and the fungal laccase overexpression plasmid comprises a linearized recombinant pYSK7 plasmid and a connected L22-GME12003_g-L24 sequence, wherein the L22-GME12003_g-L24 sequence is formed by connecting L22 sequence and L24 sequence on both sides of the fungal laccase overexpression gene GME12003_g, respectively.

3. A method for preparing a fungal laccase overexpression plasmid as claimed in claim 2, characterized in that: The following steps are involved: a. digesting the overexpressed gene GME12003_g and the empty vector of pet-28a according to claim 1 and connecting them with DNA ligase to obtain a connection vector; b. Transform the ligated vector into E.coli DH5α competent cells for culture, and screen to obtain the recombinant plasmid; c. Using L22-GME12003_g-F and L24-GME12003-R as primers, the recombinant plasmid obtained by screening in step b was used as a template to amplify the target sequence; d. The obtained target sequence was purified and used as a template, and the L22 sequence and L24 sequence according to claim 2 were used as primers to amplify the L22-GME12003_g-L24 sequence; e. The L22-GME12003_g-L24 sequence obtained in step d was connected to the linearized recombinant pYSK7 plasmid according to claim 2 by homologous recombination of Saccharomyces cerevisiae to obtain a fungal laccase overexpression plasmid.

4. The method for preparing the fungal laccase overexpression plasmid according to claim 2 or the fungal laccase overexpression plasmid according to claim 3, characterized in that: The method for preparing the linearized recombinant pYSK7 plasmid is as follows: the recombinant pYSK7 plasmid is subjected to enzyme digestion, the digestion product is incubated at 37° C. for 1.5 h, and then purified by agarose gel method to obtain a linearized recombinant pYSK7 plasmid; the recombinant pYSK7 plasmid is a pYSK7 plasmid recombined with a promoter, and the nucleotide sequence of the promoter of the recombinant pYSK7 plasmid is shown in SEQ ID No:

2.

5. A fungal laccase overexpression strain, characterized in that: The fungal laccase overexpression strain is a strain obtained by overexpressing the fungal gene GME12003_g in Trametes hirsutaAH28-2; The fungal laccase overexpression strain is named Trametes hirsuta AH28-2 (GME12003_g-OE-5), and the preservation unit is China Center for Type Culture Collection, address: Wuhan University, Wuhan, China, preservation date: November 12, 2024, and preservation number: CCTCCM20242538.

6. A method for preparing the fungal laccase overexpression strain according to claim 5, characterized in that: The following steps are involved: (1) Preparation of protoplasts of wild strain T. hirsuta AH28-2. (2) The overexpression plasmid according to claim 2 or the overexpression plasmid prepared by the preparation method according to claim 3 is then transformed into the protoplasts described in step (1). (3) Regenerating, pre-screening and re-screening the transformed protoplasts to obtain a strain overexpressing fungal laccase.

7. A method for expressing fungal laccase, characterized in that: The overexpression strain according to claim 5 or the overexpression strain prepared by the preparation method of claim 6 was cultured in XH medium for 144 hours, the fermentation broth was centrifuged to remove the bacterial cells, and the fermentation supernatant was obtained to measure the laccase activity.

8. The method for expressing fungal laccase according to claim 7, characterized in that: The XH medium has the following components: 1.5% cellobiose, 0.1% trypsin, 0.15% DL-asparagine, 0.01% Na2HPO4, 0.1% KH2PO4, 0.001% CaCl2, 0.001% FeSO4.7H2O, 0.00257% adenine sulfate, 0.000005% vitamin B1, 0.0002% CuSO4.7H2O, and sterilized at 115°C for 30 min.

Images