Rice panicle blast resistance gene OsEXOIII-1 as well as encoding protein and application of rice panicle blast resistance gene OsEXOIII-1

Abstract

The invention discloses a rice panicle blast resistance gene OsEXOIII-1 encoding protein and application thereof, and relates to the technical field of gene engineering. The nucleotide sequence of the gene OsEXOIII-1 and the coding amino acid sequence of the gene OsEXOIII-1 are shown as SEQ IN NO.1 and SEQ IN NO.2 in sequence; when the OsEXOIII-1 gene is expressed in a rice variety susceptible to panicle blast, the panicle blast resistance function of transgenic rice can be enhanced; the OsEXOIII-1 gene in the mutant rice blast resistant variety can reduce the panicle blast resistance level, so that the gene can be introduced into a panicle blast sensitive rice variety as a target gene to improve the panicle blast resistance level of the panicle blast sensitive rice variety, and is of great significance to cultivation of the panicle blast resistant rice variety.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to a rice panicle blast resistance gene OsEXOIII-1 and its application in genetic engineering. Background Art

[0002] Rice blast is one of the most important fungal diseases threatening the safe production of rice in the world. In epidemic years, it can cause a reduction of more than 70% in rice production, posing a huge hidden danger to the safe production of rice in the world. It is listed as the first of the top ten fungal diseases. The harm of rice blast mainly presents in the form of seedling blast and panicle blast. Among them, panicle blast is particularly important because it infects the top internodes or the base of the panicle / spike and directly causes yield losses. Due to the huge workload of inoculation and the degree of disease being easily affected by external environmental factors, the phenotypic accuracy of panicle blast resistance identification has always restricted the development of genetic research on panicle blast resistance. At present, most of the cloned rice blast resistance genes are for seedling blast, and only a few genes such as Pigm, Pijx, Pb1, Pi64, etc. have been confirmed to have broad-spectrum resistance to panicle blast in the late growth period. However, the resistance to seedling blast and ear blast is often inconsistent. Related studies have also shown that seedling blast and ear blast have different resistance regulation pathways because they occur at different developmental stages (Dong J, et al. (2021) The OsOXO2, OsOXO3 and OsOXO4 positively regulate panicle blast resistance in rice. Rice 14:51; Yu Y, et al. (2022). Genome-wide association study identifies a rice panicle blast resistance gene, Pb2, encoding NLR protein. Int J Mol Sci 23:5668). For example, GF14b positively regulates ear blast resistance and negatively regulates seedling blast resistance through JA and SA signaling pathways (Liu Q, et al. (2016) OsGF14b positively regulates panicle blast resistance but negatively regulates leaf blast resistance in rice. Mol Plant Microbe Interact 29:46-56).However, the current molecular mechanism analysis of broad-spectrum resistance to rice blast is based on seedling blast. Only Pb1 directly interacts with transcription factor WRKY45 through its CC domain, and Pijx directly interacts with ATP synthase β subunit (ATPb) through its LRR domain, thereby regulating Pb1 and Pijx-mediated panicle blast resistance respectively (Inoue H, et al. (2013) Blast resistance of CC-NB-LRR protein Pb1 is mediated by WRKY45 through protein-protein interaction. Proc Natl Acad Sci USA 110:9577-9582; Xiao, N, et al. (2023) Piix confers broad-spectrum seedling and panicle blast resistance by promoting the degradation of ATP β subunit and OsRbohC-mediated ROS burst in rice. Mol Plant, 16:1832-1846). Therefore, discovering genes related to panicle blast resistance has important theoretical and practical application value.

[0003] Exonuclease III (EXOIII) is a member of the Rad2 exonuclease family. It has 3'→5' double-stranded DNA exonuclease activity and is mainly used to remove single strands in double-stranded DNA or RNA molecules. It participates in multiple DNA metabolism and repair pathways, including mismatch repair, mitotic and meiotic recombination, Okazaki fragment maturation, response to UV damage, and telomere processing and maintenance. Studies have shown that exonuclease family proteins are involved in the innate immune response of viruses and humans. For example, the exonuclease domain of the Lassa virus nucleoprotein is critical to avoid RIG-I signaling and to inhibit the innate immune response (Reynard S, et al. (2014) Exonuclease domain of the Lassa virus nucleoprotein is critical to avoid RIG-I signaling and to inhibit the innate immune response. J Virol 88: 13923-13927). The human exonuclease homolog gene TREX1 plays an important role in controlling autoimmune diseases. Amino acid mutations in its core conserved domain EXOIII lead to loss of exonuclease activity, thus causing a series of human immune diseases such as Aicardi-Goutieres syndrome, familial chilblain lupus, systemic lupus erythematosus and retinal vascular disease (Grieves JL, et al. (2015) Exonuclease TREX1 degrades double-stranded DNA to prevent spontaneous lupus-like inflammatory disease. Proc Natl Acad Sci USA 112: 5117-5122; Gunther C, et al. (2015) Familial chilblain lupus due to a novel mutation in the exonuclease III domain of 3'repair exonuclease 1 (TREX1). JAMA Dermatol 151: 426-431). Exonucleases are also involved in the regulation of plant growth and development and abiotic stress response. Maternal inheritance of organelles (such as chloroplasts and mitochondria) is the genetic rule in most eukaryotic organisms.In tobacco, cold stress during pollen development leads to the inactivation of exonucleases that degrade organelle DNA, thereby promoting paternal plastid transmission and breaking the maternal inheritance of organelles (Anon. (2023) Chilling stress and loss of an exonuclease lead to biparental inheritance of plastids. Nat Plants 9: 9-10). In addition, the cotton exonuclease gene GhWRN regulates cotton maturity and flower bud differentiation (Xue Yujun, et al. (2021) Cloning and functional verification of cotton exonuclease gene GhWRN. Cotton Science, 33 (3): 189-199), while the barley exonuclease gene Bnuc1 is induced to express under salt stress or exogenous abscisic acid (ABA) treatment (Muramoto Y, et al. (1999) Enhanced expression of a nuclease gene in leaves of barley plants under salt stress. Gene 234: 315-321).

[0004] EXOIII genes, as members of the exonuclease family, have multiple functions in the responses of animals and plants to biotic and abiotic stresses. However, the function of its homologous gene OsEXOIII-1 in rice in responding to rice blast infection at the heading stage has not been reported. Summary of the invention

[0005] In order to solve the above problems, the present application discovered for the first time that the OsEXOIII-1 gene has the function of regulating rice panicle blast resistance, and further provided the application of the OsEXOIII-1 gene, the encoded protein or the biological material related thereto in rice panicle blast resistance.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] Firstly, the present invention provides an OsEXOIII-1 gene for regulating rice panicle blast resistance, and its CDS nucleotide sequence encoding the EXOIII domain protein is shown in SEQ ID NO.1.

[0008] Secondly, the present invention provides the encoded protein of the above OsEXOIII-1 gene, and its amino acid sequence is shown in SEQ ID NO.2.

[0009] Third, the present invention provides an application of an OsEXOIII-1 gene having a nucleotide sequence as shown in SEQ IN NO.1 or a biological material containing the OsEXOIII-1 gene in improving rice resistance to rice blast; that is, the OsEXOIII-1 gene or a biological material containing the OsEXOIII-1 gene is introduced into target rice through genetic engineering means (such as Agrobacterium tumefaciens) to promote the expression of OsEXOIII-1 protein in rice and improve the target rice resistance to rice blast.

[0010] Preferably, the biological material containing the OsEXOIII-1 gene comprises one or more of the following:

[0011] 1) a nucleic acid molecule containing the OsEXOIII-1 gene with a nucleotide sequence as shown in SEQ IN NO.1;

[0012] 2) an expression cassette containing the nucleic acid molecule described in 1);

[0013] 3) a recombinant vector containing the nucleic acid molecule described in 1);

[0014] 4) a recombinant microorganism containing the nucleic acid molecule described in 1);

[0015] 5) A transgenic plant cell line containing the nucleic acid molecule described in 1);

[0016] 6) Transgenic plant tissue containing the nucleic acid molecule described in 1);

[0017] 7) a recombinant vector containing the expression cassette described in 2);

[0018] 8) A recombinant microorganism containing the expression cassette described in 2);

[0019] 9) A transgenic plant cell line containing the expression cassette described in 2);

[0020] 10) A transgenic plant tissue containing the expression cassette described in 2).

[0021] Fourth, the present invention provides a method for cultivating transgenic rice with improved panicle blast resistance, comprising increasing the expression of OsEXOIII-1 protein or its encoding gene in target rice by genetic engineering means to obtain transgenic rice with improved panicle blast resistance; the improved panicle blast resistance is that the panicle blast resistance of the transgenic rice is higher than the panicle blast resistance of the target rice. The increasing the expression of the protein or its encoding gene in the target rice is achieved by introducing the encoding gene of the protein into the target rice by genetic engineering means.

[0022] Fifth, the present invention provides a method for cultivating transgenic rice with reduced ear blast resistance, comprising reducing or destroying the expression or function of the gene encoding the OsEXOIII-1 protein in the target rice through genetic engineering means to obtain transgenic rice with reduced ear blast resistance; the above-mentioned reduced blast resistance means that the ear blast resistance of the transgenic rice is lower than the ear blast resistance of the target rice.

[0023] The function of destroying the gene encoding the protein in the target rice is achieved by editing the target rice using CRISPR-Cas9-mediated gene editing technology; that is, by editing the target rice using CRISPR-Cas9-mediated gene editing technology, the expression level of the gene encoding the protein in the target rice is reduced.

[0024] Compared with the prior art, the present application first discovered the OsEXOIII-1 gene and protein that regulate rice panicle blast resistance. The CDS sequence of the OsEXOIII-1 gene includes the sequence shown in SEQ ID NO.1, and the OsEXOIII-1 protein includes a protein with an amino acid sequence as shown in SEQ ID NO.2. The present application first discovered that the OsEXOIII-1 protein has the function of regulating rice panicle blast resistance. Overexpressing the OsEXOIII-1 gene and increasing the expression level of the OsEXOIII-1 protein can improve the level of rice panicle blast resistance; while knocking out the OsEXOIII-1 gene and reducing the expression level of the OsEXOIII-1 protein can reduce the level of rice panicle blast resistance, indicating that the gene is related to rice panicle blast resistance and has genetic engineering application value. In the embodiments of the present application, by constructing an OsEXOIII-1 gene overexpression vector and transforming rice, a transgenic plant with improved resistance to rice blast is obtained, and a rice variety with panicle blast resistance can be cultivated. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is the homozygous mutation type in the editing site and OsEXOIII-1 mutant in Example 2;

[0026] Among them, A: CRISPR / Cas9 editing target site in OsEXOIII-1, where the dark gray rectangle represents the CDS region, the inverted triangle represents the editing target site, the target sgRNA sequence is represented in green, and the PAM is represented in red; B: mutation sequence information of T2 generation CRISPR / Cas9 homozygous transgenic plants.

[0027] Figure 2 The disease resistance phenotype verification result of the OsEXOIII-1 gene in Example 4;

[0028] Among them, A is the photo of the ear blast resistance detection of the complementary strain, and B is the statistical result of the ear blast resistance detection of the complementary strain. It can be seen that the ear blast resistance of the complementary strain is significantly better than that of its recipient parent MSJ18; C is the photo of the ear blast resistance detection of the gene knockout strain, and D is the statistical result of the ear blast resistance of the gene knockout strain. It can be seen that the ear blast resistance of the gene knockout strain is significantly lower than that of its recipient parent Yangjing 7311; CT: using the gene's own promoter for transgenic function complementation; KO: using the CRISPR-Cas9 system for gene knockout. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0030] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, culture media, reagents, etc. used in the following examples are conventional culture media in the art or commercially available products.

[0031] The rice materials MSJ13 and MSJ18 used in the embodiment are conventional rice in the art, such as the rice varieties disclosed in the document "Wu YY, et al. Identification and fine mapping of qPBR10-1, a novel locus controlling panicle blast resistance in Pigm-containing P / TGMS line. Mol Breeding, 2021, 41: 75", which are respectively resistant and susceptible to panicle blast rice photothermal sterile lines; Yangjing 7311 (NIL-Pigm) and 07GY31 are disclosed in the document "Wu YY, et al. Development and evaluation ofnear isogenic lines with different blast resistance alleles at Piz locus injaponica rice from the lower region of Yangtze River, China. Plant Disease, 2017, 101 (7): 1283-1291.", which are resistant and susceptible to panicle blast japonica rice lines, respectively. The above materials are available to the public from the Institute of Agricultural Sciences in Lixiahe Region, Jiangsu Province.

[0032] Example 1 Cloning of Rice Panicle Blast Resistance Gene OsEXOIII-1

[0033] In this example, a rice panicle blast resistance gene OsEXOIII-1 was isolated and cloned from rice, and its nucleotide sequence is shown in SEQ IN NO.1. The protein encoded by it is named OsEXOIII-1 protein, and its amino acid sequence is shown in SEQ IN NO.2. The specific cloning method is as follows:

[0034] 1) Extraction of total RNA

[0035] The photothermosensitive sterile rice material "MSJ13" (anti-ear blast line) was selected. After the rice entered the booting stage, it was inoculated with a suspension of rice blast fungi spores. The relevant method adopted the artificial inoculation method of the intermediate test of rice varieties in Jiangsu Province (Qi Zhongqiang et al., Evaluation of the resistance of new rice varieties (lines) and main varieties to rice blast in Jiangsu Province from 2016 to 2020, Jiangsu Agricultural Science, 2022, 50(01), 91-96). The young panicles were taken at 0h, 8h, 24h, 48h, and 72h after treatment, and immediately frozen with liquid nitrogen and stored in a -80℃ refrigerator. Part of the young panicles were taken, and the total RNA of the young panicles of rice material MSJ13 was extracted using a plant total RNA extraction kit (DP432, Tiangen), and its integrity was detected by 1% agarose electrophoresis.

[0036] 2) Cloning of the rice gene OsEXOIII-1

[0037] NCBI searched for OsEXOIII-1 sequence information, obtained the 1284bp CDS sequence of rice gene OsEXOIII-1, and designed two end primers P1 and P2:

[0038] P1: 5'-ATGTTGGCGAAGACGATGGC-3' (SEQ IN NO.3);

[0039] P2: 5'-CTACCTGCAGTGTACAACCA-3' (SEQ IN NO.4);

[0040] The first-chain cDNA synthesized by reverse transcription of the total RNA obtained in step 1) was used as a template, P1 and P2 were used as primers, and PCR amplification was performed using a high-fidelity enzyme (purchased from Nanjing Novozymes). The PCR program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 45 sec, 35 cycles, and a final extension at 72°C for 5 min. The PCR amplification product was stored at 4°C.

[0041] After amplification, the PCR product was purified and recovered according to a common DNA product purification kit (DP204, Tiangen), and then connected to a pLB vector (pLB zero background quick ligation kit, Tiangen) and transformed into Escherichia coli DH5α. A single colony was picked and sequenced by General Biotechnology (Anhui) Co., Ltd. to obtain the CDS nucleotide sequence of the rice gene OsEXOIII-1 as shown in SEQ ID NO.1, and the amino acid sequence of the protein OsEXOIII-1 composed of 428 amino acids encoded by it is shown in SEQ IN NO.2.

[0042] Example 2: Obtaining transgenic strains of rice panicle blast resistance gene OsEXOIII-1

[0043] According to the sequence information of OsEXOIII-1, primers P3 and P4 were designed to amplify the 2516 bp sequence upstream of the start codon ATG as the promoter using the cDNA of MSJ13 as a template, and primers P5 and P6 were designed to amplify the 1284 bp OsEXOIII-1 CDS sequence.

[0044] P3: 5'-CAGTCGTCTCACAACTATGGATAGTTTCATCCGC-3'(SEQ INNO.5)

[0045] P4: 5'-CGATCGTCTCATTGTGTGTTGTGGCTAGCTC-3'(SEQ INNO.6)

[0046] P5: 5'-CAGTCGTCTCAACAAATGTTGGCGAAGACGATGGC-3'(SEQ INNO.7)

[0047] P6: 5'-CAGTCGTCTCATACACTACCTGCAGTGTACAACCA-3'(SEQ INNO.8)

[0048] After ligation, an OsEXOIII pro::2×FLAG-OsEXOIII recombinant plasmid (OsEXOIII pro represents the selected promoter) with pCAMBIA1301 (commercially available) as the vector backbone was constructed, transformed into E. coli competent DH5α, and screened with LB medium of corresponding resistance. The obtained positive monoclonal colonies were sequenced and verified, and then plasmids were extracted and transformed into Agrobacterium EHA105.

[0049] The gene was transferred into the callus tissue of the rice blast susceptible rice variety MSJ18 through the Agrobacterium-mediated rice transgenic system, and plants with overexpression material were obtained through a series of conventional processes such as screening, differentiation, and rooting. Finally, after positive verification, two MSJ18 complementary homozygous transgenic strains were obtained and named OsEXOIII-CT-1 and OsEXOIII-CT-2.

[0050] Example 3 Construction of OsEXOIII-1 gene mutant using CRISPR / Cas9 gene editing technology

[0051] 1) Construction of OsEXOIII-1 gene editing vector

[0052] According to the OsEXOIII-1 genome sequence, combined with CRISPR-P 2.0 of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ), the predicted target with high on-target efficiency and low off-target efficiency was screened out. The nucleotide sequence of the target was TAGTAGGGCGATGGTCGAGGAGG (SEQ IN NO. 9, the last three bases are PAM sites).

[0053] The target sequence was inserted into the intermediate vector pYLsgRNA-LacZ-OsU6a, and then the fragment was inserted into the final vector pYLCRISPR-Cas9PUbi-H using the BsaI restriction site through Golden Gate cloning (for specific construction steps, refer to the literature "Ma X, Zhang Q, Zhu Q, et al. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular Plant, 2015, 8: 1274-1284.").

[0054] 2) Obtaining OsEXOIII-1 gene-edited transgenic plants

[0055] The successfully constructed knockout vector pylcrispr / Cas9-OsEXOIII-1 plasmid was transferred into the japonica rice recipient line Yangjing 7311 by using the Agrobacterium EHA105-mediated genetic transformation method. The transformation steps are as follows: extract the pylcrispr / Cas9-OsEXOIII-1 plasmid, transform it into Agrobacterium EHA105, infect the callus of the japonica rice recipient line Yangjing 7311 with the Agrobacterium EHA105 containing the pylcrispr / Cas9-OsEXOIII-1 plasmid, and then transfer it to the co-culture medium for dark culture at 26°C for 2-4 days, and transfer the washed callus to the selection medium containing hygromycin for resistance screening, and transfer the selected resistant callus to the differentiation medium for 10-14 days, and then transfer it to the differentiation medium for light culture, and when the seedlings grow to 2-4 cm, transfer it to the rooting medium to induce the occurrence of adventitious roots. When the seedlings grow to about 10 cm in height, take them out, wash the attached solid culture medium with sterile water, move them into soil, and cultivate them in a greenhouse. After the plants are strong, take samples for PCR identification.

[0056] Using wild-type and T0 generation leaf genomic DNA as template, PCR amplification was performed with Hyg-F / Hyg-R primers (Hyg-F: 5'-AGCCTGACCTATTGCATCTCCC-3' (SEQ IN NO.10); Hyg-R: 5'-CTGCTCCATACAAGCCAACCAC-3' (SEQ IN NO.11)). Plants with specific amplified bands were transgenic positive plants.

[0057] Design specific primers P7 on both sides of the editing target sequence:

[0058] 5-GTTCATGACTTGACGTCACCAG-3' (SEQ IN NO. 12) and P8: 5'-CTCCGCGACCTCAACCAG-3' (SEQ IN NO. 13) were sequenced and analyzed for different transgenic plants in the T1 generation.

[0059] After sequencing verification, two different types of homozygous transgenic strains were obtained, which the applicant named OsEXOIII-KO-2 and OsEXOIII-KO-6 ( Figure 1 ).

[0060] The OsEXOIII-KO-2 knockout transgenic strain had a deletion of 2 deoxyribonucleotides (GT) at the target site, resulting in a frameshift mutation, a change in the amino acid sequence of OsEXOIII-1 and premature termination of translation; the OsEXOIII-KO-6 knockout transgenic strain had a deletion of 39 deoxyribonucleotides at the target site, resulting in the loss of 13 amino acids in OsEXOIII-KO-2.

[0061] Example 4 OsEXOIII-1 complementation and resistance identification of gene-edited transgenic lines

[0062] The two independent transgenic complementary strains prepared in Example 2 and the two gene-edited mutants obtained in Example 3 and the resistant and susceptible controls MSJ13, MSJ18, Yangjing 7311 and 07GY31 were selected. Each test material was planted into a plot of 120 plants, with 10 rows in each plot, 12 plants in each row, and a plant-row spacing of 13.3 cm × 25 cm. A completely randomized block design (RCBD) was adopted. Each test material was planted twice, and conventional water and fertilizer management was used. In early August, the ear buds with a distance of about 3-4 cm between the flag leaf pulvinus and the second leaf at the booting stage were selected for inoculation. The ear blast inoculation method was carried out with reference to the method in Example 1. The inoculated strain was the 85-14 strain collected from Zhejiang, and the spore inoculation concentration was 5×10 4 / mL, 30 ears were inoculated in each plot, and the inoculated rice ears were marked. The disease situation was investigated 21 days after inoculation, and the panicle blast identification and evaluation was carried out according to the standards disclosed in "Wu YY, Xiao N, Li YH, et al. Identification and fine mapping of qPBR10-1, a novel Diseased grain rates locus controlling panicle blast resistance in Pigm-containing P / TGMS line. Mol Breeding, 2021, 41: 75", and the diseased grain rate per ear (DGR, Diseased grain rates) was evaluated.

[0063] The results of ear blast inoculation showed that the resistance phenotypes of the two complementary families were significantly different from those of the control MSJ18. The diseased grain rates per ear of the two complementary families were distributed between 9.43%-14.67% and 10.24%-19.33%, respectively, which were significantly lower than 83.24%-100% of MSJ18 ( Figure 2 The results show that after the introduction of OsEXOIII-1 gene, the resistance level of recipient rice to panicle blast was significantly improved.

[0064] In addition, the two mutant families showed obvious ear blast phenotypes. The diseased kernel rates per ear of the two mutant families were distributed between 68.34%-80.33% and 69.65%-90.28%, respectively, which were significantly higher than the control Yangjing 7311 (0.00%-8.32%). Figure 2 (as shown in C and D).

[0065] The above results indicate that the function of the OsEXOIII-1 gene is related to rice panicle blast resistance, and this gene can be used to improve rice varieties, thereby increasing rice panicle blast resistance.

[0066] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A rice panicle blast resistance gene OsEXOIII-1, whose nucleotide sequence is shown in SEQ ID NO.

1.

2. The protein encoded by the rice panicle blast resistance gene OsEXOIII-1 as claimed in claim 1, whose amino acid sequence is shown in SEQ ID NO.

2.

3. Use of the OsEXOIII-1 gene or a biological material containing the OsEXOIII-1 gene as claimed in claim 1 in improving the resistance of rice to rice blast disease; that is, introducing the OsEXOIII-1 gene or a biological material containing the OsEXOIII-1 gene into a target rice to improve the resistance of the target rice to rice blast disease.

4. The use according to claim 3, characterized in that The biological material containing the OsEXOIII-1 gene comprises at least one of the following: 1) A nucleic acid molecule containing the OsEXOIII-1 gene with a nucleotide sequence as shown in SEQ IN NO.1; 2) an expression cassette containing the nucleic acid molecule described in 1); 3) a recombinant vector containing the nucleic acid molecule described in 1); 4) A recombinant microorganism containing the nucleic acid molecule described in 1); 5) A transgenic plant cell line containing the nucleic acid molecule described in 1); 6) Transgenic plant tissue containing the nucleic acid molecule described in 1); 7) a recombinant vector containing the expression cassette described in 2); 8) a recombinant microorganism containing the expression cassette described in 2); 9) A transgenic plant cell line containing the expression cassette described in 2); 10) A transgenic plant tissue containing the expression cassette described in 2).

Images