Application of verticillium dahliae GH6 cellulase VdCel6D gene

Abstract

The invention is applicable to the technical field of functional genes, provides application of a verticillium dahliae GH6 cellulase VdCel6D gene, and particularly, the verticillium dahliae GH6 cellulase VdCel6D gene can be used for inhibiting verticillium dahliae from infecting plants. Wherein the VdCel6D gene can influence the growth, development and pathogenicity of verticillium dahliae, and the VdCel6D protein coded by the VdCel6D gene can degrade plant cell walls and inhibit plant immune response through cellulase to play a pathogenic role. Therefore, the invention has important theoretical value for prevention and control of verticillium dahliae and development of novel bactericides, and has important practical significance for promoting safety production of cotton.

Description

Technical Field

[0001] The invention belongs to the technical field of functional genes, and in particular relates to an application of a Verticillium dahliae GH6 cellulase VdCel6D gene. Background Art

[0002] Verticillium dahliae is a soil-borne fungal vascular disease that mainly infects the roots of plants and colonizes in the xylem vessels of different plant species. It can harm more than 400 plant species and has a wide host range. It is called the "cancer" of cotton. There are many reasons for the symptoms of cotton wilt, among which the production of toxins and vascular occlusion are the main reasons. In the early stage of infection by Verticillium dahliae, spores attach to the roots of plants. When conditions are suitable, spores will produce filamentous hyphae, which will penetrate the roots of plants and enter the xylem. The large amount of mycelium and plant defense-driven structures and biomacromolecules produced by parenchyma cells will block the vessels and interfere with the transportation of water and nutrients in plants. Once the water balance in the host plant is unbalanced, it will cause the leaves of the plant to wilt, turn yellow, and even die.

[0003] Plant cell wall is the first biological barrier during pathogen infection. Pathogens can produce a large amount of carbohydrate enzymes to degrade cell walls and facilitate the entry of pathogens. These carbohydrate enzymes that can degrade plant cell walls are divided into cellulases, xylanases, pectinases, etc. according to the different degradation substrates, and are also called cell wall degrading enzymes (CWDEs).

[0004] Glycoside hydrolases are widely present in pathogens and are the largest family in the Carbohydrate Active Enzyme Database (CAZy). Currently, there are 173 families of glycoside hydrolase families (GHs) in the CAZy database. In recent years, the role of multiple glycoside hydrolase families in pathogen invasion and pathogenicity has been confirmed. Cellulase is a complex enzyme. The degradation of cellulose mainly depends on the synergistic action of endoglucanase, exoglucanase and β-glucosidase to complete the degradation of cellulose. Endoglucanase hydrolyzes the β-1,4-glucosidic bonds in the amorphous region of the cellulose chain to release cellooligosaccharides; exoglucanase acts on short cellulose molecules and cellooligosaccharides to release disaccharides such as cellobiose; then, β-glucosidase cleaves cellobiose into glucose. The study found that cellulases of GH6 and GH7 contribute to the penetration of the host epidermis and the further invasion of plant pathogenic fungi.

[0005] Glycoside hydrolases 6 (GH6) family is an important hydrolase, which mainly hydrolyzes β-1,4-glycosidic bonds in cellulose through a reverse mechanism and converts insoluble polysaccharides into soluble sugars. The current study found that the cellulase of the GH6 family is mainly composed of two enzymes: endoglucanase (EG, EC 3.2.1.4) and exoglucanase (cellobiose, CBH, EC3.2.1.176 / 91). These two enzymes do not play a single hydrolytic role, but play a role in a mutually synergistic mode of action. Both can produce new chain ends.

[0006] At present, the GH6 family cellulases discovered in research play an important role in cellulose degradation and synergistic biocatalytic transformation. Their main characteristics are: (1) GH6 cellulases use a one-step, reverse mechanism to hydrolyze β-1,4-glycosidic bonds; (2) GH6 cellulases are likely to hydrolyze through the Grotthuss mechanism; (3) The GH6 family consists of CBHs and EGs, both of which are able to specifically degrade the non-reducing ends of crystalline cellulose; (4) GH6 protein CBHs exhibit disordered loops, forming a typical tunnel-like structure. These loops show significant flexibility in responding to mutations and ligand binding, which may be related to the mechanism of action or activity properties of GH6 CBHs; (5) GH6 cellulases play a key role in the synergistic activity of cellulase mixtures. They are the only known non-reducing end-specific cellulases and have been shown to generate new free chain ends for GH7 cellulases.

[0007] The GH6 family also plays a role in the interaction between pathogens and hosts. The cellulases secreted by pathogens when infecting host plants can hydrolyze crystalline cellulose in plant cell walls. The GH6 and GH7 family cellulases MoCel6A, MoCel7A and MgEGL1 secreted by rice blast fungus are transcribed and expressed in large quantities during the infection process. However, in the mutants, the transcription levels of target genes in KD_CEL1, KD_CEL2 and KD_sd1, the cellulase activity and the pathogenicity to the host are reduced, indicating that GH6 family cellulases are also involved in the infection process of pathogens.

[0008] Since the pathogenicity of Verticillium dahliae is very complex and the interaction mechanism between the pathogen and the host plant is unclear, the identification and functional analysis of the pathogenicity or virulence-related genes of this fungus will help reveal the molecular pathogenicity mechanism of Verticillium dahliae. Summary of the invention

[0009] The purpose of the embodiment of the present invention is to provide an application of the Verticillium dahliae GH6 cellulase VdCel6D gene, aiming to solve the problems raised in the background technology.

[0010] In view of the above problems, the present invention provides an application of a Verticillium dahliae GH6 cellulase VdCel6D gene in inhibiting Verticillium dahliae infection of plants, wherein the nucleotide sequence of the VdCel6D gene is shown in the sequence table SEQ ID NO.1.

[0011] Preferably, the plant comprises cotton.

[0012] Preferably, the VdCel6D gene exerts its pathogenic effect by degrading plant cell walls via cellulase and inhibiting plant immune response.

[0013] Another object of the present invention is to provide an application of the Verticillium dahliae GH6 cellulase VdCel6D gene in promoting the growth and development of Verticillium dahliae.

[0014] Preferably, said growth and development comprises propagule production.

[0015] Preferably, the propagules include microsclerotia and conidia.

[0016] Another object of the present invention is to provide an application of the Verticillium dahliae GH6 cellulase VdCel6D gene in influencing the pathogenicity of Verticillium dahliae.

[0017] Preferably, the pathogenicity includes at least one of disease index, hyphae penetration ability and host colonization ability.

[0018] Another object of the present invention is to provide an application of the Verticillium dahliae GH6 cellulase VdCel6D gene in influencing plant resistance.

[0019] Preferably, the plant comprises cotton.

[0020] Preferably, the plant resistance includes at least one of plant necrosis response and the ability to express disease resistance genes.

[0021] Preferably, the disease resistance gene includes at least one of NbAcre31, NbLOX and NbPR4.

[0022] The VdCel6D gene provided by the present invention affects the growth and pathogenicity of Verticillium dahliae, and the VdCel6D protein encoded by the gene plays its pathogenic role by degrading plant cell walls through cellulase and inhibiting plant immune response. Therefore, the present invention has important theoretical value for the prevention and control of Verticillium dahliae and the development of new fungicides, and has important practical significance for promoting safe cotton production. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the result of transcriptional expression of VdCel6D gene in different tissues of Verticillium dahliae; Figure 2 This is the result of transcriptional expression of VdCel6D gene at different times after cotton root induction; Figure 3 The figure shows the transcriptional expression results of VdCel6D gene induced by different substrates; Figure 4 The figure shows the result of VdCel6D inhibiting the immune response caused by BAX; Figure 5 is the relative expression level of defense-related genes NbAcre31, NbLOX, and NbPR4; Figure 6 The graph is a result of measuring the spore production of the Verticillium dahliae ΔVdCel6D mutant strain, the complementary strain and the wild-type strain V592 constructed in the present invention; Figure 7 The results of the determination of the pathogenicity of the Verticillium dahliae ΔVdCel6D mutant, the complementary strain and the wild-type strain V592 to cotton constructed by the present invention; A is the morphology of the pathogenic plant; B is the disease index result; Figure 8 This is the phenotypic observation diagram of the ΔVdCel6D gene mutant after Congo red staining. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0025] In the early stage of the present invention, cotton roots were used to induce the expression of Verticillium dahliae related genes. After analysis, it was found that the VdCel6D (GenBank accession number is VDAG_07210) gene was expressed in large quantities in the early stage of induction, and the gene belongs to the GH6 family.

[0026] Specifically, in the embodiments of the present invention, a new application of the Verticillium dahliae GH6 cellulase VdCel6D gene is provided, and it is clear that the VdCel6D gene can provide a basis for preventing and controlling Verticillium dahliae and developing new fungicides.

[0027] The nucleotide sequence of the VdCel6D gene is shown in SEQ ID NO: 1, specifically:

[0028] In order to clarify whether the knockout of VdCel6D gene affects the formation of conidia of Verticillium dahliae, the embodiment of the present invention constructs a mutant strain of Verticillium dahliae with the VdCel6D gene knocked out based on the wild-type strain V592 as the basic strain, and performs gene complementation on the basis of ΔVdCel6D to obtain a complementary strain EC-VdCel6D. The construction method of the mutant strain of Verticillium dahliae with the VdCel6D gene knocked out ΔVdCel6D is completed by the principle of homologous recombination. For details, refer to the prior art for obtaining knockout and complementary mutants (WANG S, XING H, HUA C, GUO HS, ZHANG J. An improved single-step cloning strategy simplifies the Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption method for Verticillium dahliae. Phytopathology, 2016, 106(6): 645-652.).

[0029] The embodiments of the present invention respectively use the knockout mutant ΔVdCel6D and the complementary vector of VdCel6D as experimental objects. Compared with the wild-type strain V592, there are no obvious differences in the colony morphology and growth rate of the VdCel6D gene knockout mutant, and the spore production of the VdCel6D knockout mutant decreases. The knockout of the VdCel6D gene causes a significant decrease in the pathogenicity of Verticillium dahliae, but does not affect the penetration ability of Verticillium dahliae. In summary, the VdCel6D gene is involved in the growth, development and pathogenicity of Verticillium dahliae.

[0030] In addition, in the present embodiment, in order to explore whether the VdCel6D protein has cellulase activity, all knockout mutant strains were inoculated on Czapek solid medium with sodium carboxymethyl cellulose (CMC) as the sole carbon source, and stained with Congo red solution. After the CMC combined with Congo red was degraded by cellulase, a transparent circle could be produced at the edge of the colony. The size of the transparent circle produced by the mutant reflected the effect of the gene on the cellulase activity. The results showed that the transparent circle produced by the VdCel6D knockout mutant strain was significantly smaller than that produced by the wild-type strain V592, indicating that the VdCel6D protein can degrade cellulose and has cellulase activity. The VdCel6D cellulose gene was transiently expressed in tobacco by Agrobacterium-mediated genetic transformation. The results showed that the VdCel6D protein could not cause allergic necrosis reaction in tobacco, but could inhibit the immune response caused by BAX protein, and the expression of defense-related genes (NbAcre31, NbLOX and NbPR4) was significantly inhibited. This indicates that VdCel6D protein plays a virulence role in the process of Verticillium dahliae infecting host plants by inhibiting plant immunity.

[0031] The embodiment of the present invention knocks out the VdCel6D gene and complements its function, and studies the function of the gene in the growth and development of Verticillium dahliae and its interaction with plants. The VdCel6D gene plays an important role in the growth and development, spore production and pathogenicity of Verticillium dahliae, and the encoded VdCel6D protein degrades the plant cell wall through cellulase and inhibits the plant immune response to exert its pathogenic effect. Therefore, the present invention has important theoretical value for the prevention and control of Verticillium dahliae and the development of new fungicides, and has important practical significance for promoting safe production of cotton.

[0032] The experimental methods in the following examples without specifying specific experimental conditions are usually carried out according to conventional experimental conditions or the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents, raw materials and equipment used in the present invention can be obtained from commercial sources.

[0033] Example 1: This example measures the expression of the cellulase VdCel6D gene in different tissues of V592, as follows: The wild-type V592 bacterial block was cultured in 100 mL Czapek-Dox liquid medium for 3 days, and then the spores were collected by filtering with four layers of gauze. At the same time, the wild-type V592 tissues cultured on PDA and BMM solid medium for 2 days and 20 days, respectively, were gently scraped with a high-temperature sterilized slide to obtain hyphae and microsclerotia. The obtained spores, hyphae and microsclerotia were quickly frozen in liquid nitrogen and RNA was extracted and cDNA was synthesized according to 2.2.3. The qPCR reaction system was prepared according to SYBR Select Master Mix. The internal reference gene was β-tubulin (DQ266153). Each reaction was repeated 3 times. The data were processed and analyzed by 2-△△Ct method and software SPSS 26.0. The results are shown in Figure 1 shown.

[0034] The results showed that the expression of VdCel6D in the microsclerotia of Verticillium dahliae was slightly higher than that in the conidia and hyphae, indicating that the GH6 cellulase VdCel6D gene may play a certain role in the spores, hyphae and microsclerotia of Verticillium dahliae.

[0035] Example 2: This example measures the expression of the Verticillium dahliae GH6 cellulase VdCel6D gene at different times of cotton root induction, as follows: Select several seeds of Junmian No. 1 with full grains, remove the seed coat, treat them with 0.1% HgCl2 for 3 min on a clean bench, wash them three times with sterile water, and place them on sterilized filter paper to dry the surface moisture; burn tweezers with an alcohol lamp and wait for the temperature to drop before picking up the seeds and placing them in a tissue culture bottle containing 50 mL MS solid culture medium, about 4 to 5 seeds per bottle, and place them in a 28 ℃ incubator for dark culture for 7 d, during which the seedlings are supported once.

[0036] On the clean bench, the wild-type V592 bacterial solution that had been shaken in a shaker at 26 °C for 3 days was filtered into a 50 mL centrifuge tube with four layers of gauze, centrifuged at 8000 r / min at 4 °C for 10 min, and resuspended with Czapek-Dox liquid medium. The bacterial solution was evenly distributed into conical flasks containing 100 mL Czapek-Dox liquid medium; the cotton roots cultured in MS solid medium were inoculated into each conical flask, shaken at 26 °C and 200 r / min, and induced for 8 h, 12 h, 24 h, 36 h, 48 h, and 60 h, respectively. The V592 bacterial solution without cotton root induction at different times was taken as the control; the induced bacterial solution was collected and quick-frozen in liquid nitrogen, and then RNA was extracted and cDNA was synthesized according to SYBR Select Master Mix was used to prepare the qPCR reaction system. The internal reference gene was β-tubulin (DQ266153). Each reaction was repeated 3 times. The data were processed and analyzed using the 2-△△Ct method and SPSS 26.0 software. The results are shown in the figure. Figure 2 shown.

[0037] The results showed that the expression of cellulase gene VdCel6D was continuously up-regulated with the increase of induction time, and the highest expression level was reached at 48 h of induction, which was up-regulated by 27.4 times. This indicates that VdCel6D gene plays an important role in the early stage of infection of host by Verticillium dahliae.

[0038] Example 3: This example analyzes the expression of the Verticillium dahliae GH6 cellulase VdCel6D gene induced by different substrates, as follows: 0.1 g of soluble starch, microcrystalline cellulose and sodium carboxymethyl cellulose were added to 100 mL of Czapek-Dox liquid medium, respectively. After high-temperature sterilization, the wild-type V592 bacterial solution was inoculated. The bacterial solution was collected after shaking culture at 26 ℃ and 200 r / min for 48 h, and then quick-frozen in liquid nitrogen and RNA was extracted and cDNA was synthesized. The qPCR reaction system was prepared according to SYBR Select Master Mix. The internal reference gene was β-tubulin (DQ266153). Each reaction was repeated 3 times. The data were processed and analyzed for significance using the 2-△△Ct method and software SPSS26.0. The results are shown in Figure 2. Figure 3 shown.

[0039] The results showed that the expression levels of VdCel6D increased significantly under the induction of three substrates, indicating that during the interaction between Verticillium dahliae and the host, the cellulase gene VdCel6D played a certain role in the host's cellulose.

[0040] Example 4: 1. Study on the ability of VdCel6D protein to inhibit plant resistance. In order to explore whether VdCel6 protein affects plant immune response, the specific experimental method is as follows: (1) Construction of the vector for transient expression of the VdCel6D gene: Using the cDNA of V592 as a template and using specific primers of the target gene for amplification, the PCR product was recovered according to the instructions of the PCR product recovery kit (OMEGA) and connected to the 1300-221-35S-6×Myc transient expression vector that had been linearized with the endonuclease BamHI (TaKaRa) using homologous recombination enzyme (ClonExpressⅡ One Step Cloning Kit, Vazyme). The ligation system was 1 μL 5×CE IIBuffer, 1 μL Exnase II, 1 μL 1300-221-35S-6×Myc, 1 μL PCR recovery product, and 6 μL ddH2O. The mixture was gently mixed and placed in a PCR instrument (Thermo Fisher Scientific) for reaction at 37°C for 30 min.

[0041] Heat shock transformation: Thaw the DH5α competent medium stored in a -80 ℃ refrigerator on ice. After 20 min, slowly transfer the ligation product to the thawed DH5α competent medium, gently mix evenly, and continue to stand on ice for 30 min; place the centrifuge tube containing the mixed solution in a 42 ℃ incubation box for incubation. After 50 s, add 400 μL LB liquid culture medium in a sterile environment and shake at 26 ℃ and 200 r / min for 45 min; spread the shaken bacterial solution on the LB solid culture medium containing Kanna; place it in a 37 ℃ incubator for 12 h. After a single colony grows, pick a single colony for PCR and Sanger sequencing, and extract the plasmid from the confirmed positive colony according to the instructions of the plasmid mini-extraction kit (Tian Gen).

[0042] Electroporation transformation: Place the competent Agrobacterium and electroporation cup stored in a -80 ℃ refrigerator on ice for 15 min; aspirate 2 μL of plasmid and slowly add it to 100 μL of competent Agrobacterium, and place it on ice for 20 min; transfer the mixed solution to the electroporation cup and electroporate at 1800V; in a sterile environment, add 500 μL of LB liquid culture medium to the electroporation cup, then transfer all the solution in the electroporation cup to a new centrifuge tube and shake it at 28 ℃ for 1 h; spread the shaken bacterial solution on the LB solid culture medium containing Kanna and Rif; after 2 days, pick a single colony for PCR verification; shake the successfully verified single colony in the LB liquid culture medium of Kanna and Rif to obtain the Agrobacterium bacterial solution containing the target gene plasmid and store it in a -80 ℃ refrigerator for later use.

[0043] (2) Transient expression of VdCel6D gene in Nicotiana benthamiana: The Agrobacterium culture containing the target gene plasmid stored in a -80 ℃ refrigerator was thawed on ice and then inoculated with a sterile toothpick onto a solid LB plate containing 50 μg / mL Kanna and 100 μg / mL Rif. After 2 days, a single colony was picked and transferred to 500 μL LB liquid culture medium for shaking culture at 26 ℃, 200 r / min, and 16 h. 200 μL of the fresh Agrobacterium culture was transferred to a 50 mL centrifuge tube containing 25 mL LB liquid culture medium containing 150 μM AS for culture. When the culture solution was shaken to orange-yellow, it was collected at 4 ℃, 5000 r / min. The supernatant was discarded, and the precipitated bacteria were resuspended in the Agrobacterium infection tobacco buffer and the OD was calculated. 600 After adjusting to 1.0, place it still at 28 ℃; after 2 hours, use a 1 mL syringe to draw an appropriate amount of Agrobacterium liquid and inject it on the back of the tobacco leaf; the injection area is a circular spot with a diameter of 1 cm, such as Figure 4 As shown in A, first inject Agrobacterium suspension containing VdCel6D gene into positions 2 and 3 with a 1 mL syringe. After 24 h of dark treatment, inject BAX Agrobacterium suspension into position 3. Inject BAX and 1300-221-35S-6×Myc Agrobacterium suspension into positions 1 and 4 as positive and negative controls, respectively. Observe the necrosis of tobacco leaves one week later and take photos for record. Figure 4 As shown in B.

[0044] The results showed that 6 days after inoculation with BAX, obvious cell necrosis occurred on tobacco leaves expressing the BAX gene alone, but when the BAX gene and VdCel6D gene were co-expressed, the necrosis symptoms on tobacco leaves were significantly alleviated, indicating that the VdCel6D protein cannot function as an effector, but can inhibit the immune response caused by BAX.

[0045] 2. Determination of the expression of related defense genes: In order to clarify whether VdCel6D will stimulate the expression of some defense-related genes in plants, the expression of the MTI response (Microbe-associated molecular patterns-triggered immunity) related gene NbAcre31, the pathogenesis-related gene NbPR4 and the jasmonic acid biosynthesis key enzyme gene NbLOX were detected. The specific method is as follows: According to the above method, tobacco leaves were injected and infected. RNA from tobacco leaves treated with different methods at 0 h, 12 h, 24 h, and 48 h after infection was extracted according to the instructions of the RNA extraction kit (Beijing Quanshijin Biotechnology). Then cDNA was synthesized. The reaction conditions were 42 °C and 15 min in a PCR instrument (Thermo Fisher Scientific). The expression levels of tobacco-related defense genes (NbAcre31, NbLOX, and NbPR4) were detected by qRT-PCR technology. The results are shown in Figure 2. Figure 5 shown.

[0046] The results showed that after BAX injection alone, the expression levels of NbAcre31, NbLOX and NbPR4 genes increased with time, reaching the highest expression level at 48 h. When BAX and VdCel6D cellulase gene were co-infected in tobacco for 48 h, the expression levels of NbAcre31, NbLOX and NbPR4 genes decreased significantly, decreasing by 4.69, 2.20 and 3.01 times, respectively. After VdCel6D cellulase gene and Agrobacterium suspension transiently expressing empty vector 1300-221-35S-6×MyC were injected alone, the gene expression levels of NbAcre31, NbLOX and NbPR4 were very low and did not change with time. The above results once again proved that VdCel6D protein can inhibit the immune response caused by BAX, indicating that VdCel6D protein plays a virulence role in the process of Verticillium dahliae infecting host plants by inhibiting plant immunity.

[0047] Example 5: This example provides a method for constructing a mutant strain ΔVdCel6D of Verticillium dahliae with a knockout of the VdCel6D gene, wherein primers are designed based on the upstream and downstream homology arms of the VdCel6D gene (nucleotide sequence as shown in SEQ ID NO: 1), a knockout vector is constructed, and a mutant strain is constructed using the wild-type strain V592 as the initial strain. The mutant strains of Verticillium dahliae with a knockout of the VdCel6D gene (ΔVdCel6D-1, ΔVdCel6D-2) are obtained.

[0048] The specific construction process is as follows: (1) Amplification of the homology arms of the target gene: Two pairs of primers were designed with the upstream and downstream of the VdCel6D gene as homology arms, and the genomic DNA of the deciduous strain V592 was used as a template. The upstream and downstream homology arms of the VdCel6D gene were amplified using I-5 2×High-Fidelity Master Mix high-fidelity DNA polymerase. Primers VdCel6D-sf and VdCel6D-sr were used to amplify the upstream homology arm of the VdCel6D gene, and primers VdCel6D-xf and VdCel6D-xr were used to amplify the downstream homology arm of the VdCel6D gene. PCR reaction system: 25 μL of I-5 2×High-Fidelity Master Mix, 1 μL each of VdCel6D-s(x)-f / VdCel6D-s(x)-r, and 1 μL of DNA were added to a 0.2 mL PCR tube and made up to 50 μL with ddH2O. The PCR reaction program was as follows: preheating at 98 °C for 1 min, melting at 98 °C for 15 s, annealing at 60 °C for 15 s, extension at 72 °C for 15 s, maintaining at 72 °C for 5 min, and ending the reaction at 20 °C for 2 min. 30 cycles were performed from the melting stage to the extension stage. 3~5 μL of PCR product was detected by gel electrophoresis in 1% agarose gel electrophoresis with Goldenview added, and observed and photographed under a UV gel imager. The remaining PCR product with the correct band was purified according to the steps of the Gel Extraction Kit of OMEGA Biotechnology Company and the concentration was determined.

[0049] Among them, the upstream and downstream homology arm primers are as follows: VdCel6D-sf: CTTGCTGAGGTCTTAATTAATGTTTCTCTTCGCTTGAATGTG (as shown in SEQ ID NO: 2); VdCel6D-sr: AGTGCTGAGGCATTAATTAATGTGAGAGTAGAGAACGCAA (as shown in SEQ ID NO: 3); VdCel6D-xf: CCCGCTGAGGACTTAATTAATAAGCGGTTGATTCTCGCGT (as shown in SEQ ID NO: 4); VdCel6D-xr: CTCGCTGAGGGTTTAATTAAATGGTCGAGCTGCAGAAGGA (as shown in SEQ ID NO:5).

[0050] (2) The knockout vector used in this example is pGKO-HPT. The vector plasmid was linearized with PacⅠ, and the system was as follows: 5 μL of PacⅠ, 35 μL of vector plasmid, 5 μL of 1×Cutsmart, ddH2O was added to 50 μL, and the enzyme digestion was carried out in a 37 ℃ water bath for 10-12 h. The next day, 3~5 μL of PCR product was taken for gel electrophoresis detection in 1% agarose gel electrophoresis with Goldenview added, and the enzyme digestion band was observed under a UV gel imager to detect the enzyme digestion band. The target fragment was carefully cut out and the linearized vector fragment was purified using the Gel Extraction Kit steps of OMEGA Bio Company. After gel electrophoresis verification again, the purified vector fragment was packaged and its concentration was determined, and it was stored in a -20 ℃ refrigerator for use to avoid repeated freezing and thawing.

[0051] (3) In-fusion cloning: The upstream and downstream homology arms of the target gene obtained after amplification and purification and the vector fragment obtained after linearization and purification were connected with the In-fusion enzyme. The system is as follows: 3 μL of the purified products of the upstream and downstream homology arms of the target gene, 1 μL of 5×CE Multis Buffer and Exnase Multis, and 2 μL of the linearized vector. The above solution was placed in a 37 ℃ water bath for 30 min, placed on ice for subsequent experiments or temporarily stored in a -20 ℃ refrigerator, heat-shocked to transform E. coli and extract the recombinant plasmid.

[0052] (4) Agrobacterium-mediated genetic transformation: Electroporation of Agrobacterium: Take out the recombinant plasmid and Agrobacterium competent cells from the -20 ℃ refrigerator and -80 ℃ refrigerator respectively, and quickly thaw them on ice; take out 1 μL of the recombinant plasmid and add it to the Agrobacterium competent cells, and place it on ice for 10 min; wipe off the water on the wall of the sterilized and pre-cooled electroporation cup, add the mixed solution and place it in the electroporation instrument for instantaneous electroporation; add 500 μL of LB liquid culture medium without any antibiotics, pipette to mix and aspirate the mixed solution in the electroporation cup, place it in a 1.5 mL centrifuge tube, and shake it at 200 rpm in a 28 ℃ shaker for 45 min; centrifuge briefly, discard 500 μL of the supernatant, mix the remaining bacterial solution thoroughly with a pipette, and evenly spread the bacterial solution on the LB solid culture medium containing Kan and Rif antibiotics in the clean bench, and place it in a 28 ℃ constant temperature incubator for dark incubation for 2 to 3 days. Positive transformants were screened by PCR, and the correct colonies were shaken to obtain Agrobacterium culture. 100 μL of Agrobacterium culture was added to 10 mL of IMAS (containing Kan) liquid medium, and shaken at 200 rpm at 28 °C until OD 600The value was about 0.5. The collected conidia of Verticillium dahliae were thawed on ice in advance. The conidia of Verticillium dahliae and Agrobacterium were mixed evenly in a ratio of 1:1. 200 μL of the mixture was evenly spread on the sterilized IMAS solid medium, and repeated 3 times. The plate coated with only the conidia of Verticillium dahliae was used as the positive control, and the plate coated with only the bacterial solution of the recombinant plasmid of Agrobacterium was used as the negative control. After 48 hours, the filter paper was peeled off from the IMAS solid medium and placed on the PDA (containing HygB+Cef+Car+F2dU) plate, and cultured in the dark at 26 ℃ for 5-7 days. After the transformants grew out, a single fungal colony was picked on the clean bench, streaked and inoculated on the PDA (containing Cef+HygB) medium, and cultured in the dark at 26 ℃ for 10 About 1 day, during which the growth of fungi in the plate was observed. Only knockout transformants of homologous recombination would grow on the resistant plate, while false positive transformants would not grow. When positive transformants grew out, single spores were isolated and subsequent tests were performed. Finally, two knockout transformants were obtained.

[0053] Example 6: This example provides a method for constructing a VdCel6D gene complementation mutant EC-VdCel6D of Verticillium dahliae, as follows: The mutant strain ΔVdCel6D of Verticillium dahliae constructed in Example 5 was used as the initial strain to obtain the complementary mutant of the VdCel6D gene of Verticillium dahliae (EC-VdCel6D). The vector used was p1300-Neo-oLiC-Cas9-TtrpC, and 50 μL of Xba I and Bam HI double enzyme digestion system was prepared by double enzyme digestion linearization with XbaI and Bam HI: p1300-Neo-oLiC-Cas9-TtrpC 20 μL, Xba I 1 μL, Bam HI 1 μL, 1×M buffer 2.5 μL, ddH2O 25.5 μL. The digestion was carried out at 37°C overnight, and the target band was recovered by gel cutting the next day. The complementary recombinant plasmid was constructed using ClonExpress®II One Step Cloning Kit, and the p1300-Neo-oLiC-Cas9-TtrpC and VdCel6D genes were connected using Exnase II enzyme. The single fragment connection system of p1300-NeO-LiC-Cas9-TtrpC was as follows: 5×CE II buffer 2 μL, p1300-Neo-oLiC-Cas9-TtrpC 200 ng, target gene fragment 80 ng, Exnase II 1 μL, ddH2O up to 10 μL, and connection at 37°C for 30 min.

[0054] The remaining methods are the same as those for knockout. The difference from the acquisition of knockout positive transformants is that the acquisition of knockout mutants is to convert 1.0×10 conidia of wild-type V592 of Verticillium dahliae into 6 conidia / mL and Agrobacterium containing the knockout vector were mixed in equal proportions, and the positive transformants of the complementary mutants were obtained by mixing 1.0×10 conidia of the VdCel6D knockout mutant 6 conidia / mL is mixed with Agrobacterium containing complementary vector in equal proportions; secondly, the first screening culture medium of positive transformants of different complementary mutants of resistance screening culture medium is PDA+HygB+Cef+Tim+G418, and the second screening culture medium is PDA+Cef+G418.

[0055] Example 7: In order to clarify whether VdCel6D gene knockout affects the formation of conidia of Verticillium dahliae, the specific determination method is as follows: The concentration was 1.0×10 6 CFU / mL of the knockout mutant (the strain constructed in Example 5), the complementation strain (the strain constructed in Example 6), and V592 were inoculated into Czapek-Dox liquid culture medium, and cultured at 26°C and 200 r / min for 5 days to separate spores. 6 100 μL of spore suspension with CFU / mL was inoculated into Cha's medium (containing kan). Three biological replicates were set for each strain, and the culture was shaken at 200 r / min in a 26°C shaker. During the period, 1 mL of bacterial solution was drawn every 24 h. The spore concentration was measured with a hemocytometer for 7 consecutive days and the data were recorded. The results are shown in Figure 6 shown.

[0056] The results showed that the VdCel6D gene had an effect on the spore production ability of Verticillium dahliae. Compared with the wild-type strain V592, the spore production of the VdCel6D gene knockout mutant was significantly reduced. On the 7th day, the spore production of the VdCel6D gene knockout mutant was 0.54 and 0.58 times that of the wild-type strain V592. This indicates that the VdCel6D gene is involved in regulating the spore production ability of Verticillium dahliae.

[0057] Example 8: In order to clarify the effect of VdCel6D gene knockout on the pathogenicity of Verticillium dahliae, the pathogenicity of the VdCel6D gene knockout mutant to cotton was determined using the wild-type strain V592 and the complemented strain as controls. The pathogenicity determination method is as follows: The knockout mutants, complementation strains and V592 constructed above were inoculated into Czapek-Dox liquid medium at 26°C and shaken at 200 r / min for 5 days. After the fifth true leaf of the cotton seedlings grew out, 200 mL of 1.0×10 7 CFU / mL of bacterial solution, each strain was replicated in 3 hydroponic boxes (a total of 36 cotton seedlings). Observe every day after inoculation. Figure 7 As shown in A, the disease index is counted every 3 days from the onset of disease and generally recorded until one month after the onset of disease. The disease grading standard is: 0: no disease; 1: 1 to 2 cotyledons are diseased; 2: 1 true leaf is diseased; 3: 2 true leaves are diseased; 4: 3 or more true leaves are diseased. The disease index is calculated according to the following formula.

[0058] Disease index = [ΣNumber of diseased plants at each level × number of levels / (total number of plants × highest disease level)] × 100; The disease index is the average of three biological experiments repeated. Figure 7 As shown in B.

[0059] The results showed that the knockout mutant of the VdCel6D gene showed reduced pathogenicity compared with the wild-type strain V592. On the 26th day of inoculation, the disease index of the wild-type strain V592 was 97.92, while the knockout mutant of the VdCel6D gene showed reduced pathogenicity, indicating that cellulase genes are involved in the pathogenicity of Verticillium dahliae.

[0060] Example 9: Determination of cellulase activity of VdCel6D knockout mutants. In order to clarify the effect of VdCel6D gene on cellulase activity, the specific experimental method is as follows: mycelium of different strains was picked with a sterile toothpick and inoculated into Czapek solid medium with sodium carboxymethyl cellulose as the sole carbon source (NaNO3 2 g / L, KCl 0.5 g / L, K2HPO4 1 g / L, FeSO4 0.01 g / L, MgSO4·7H2O 0.5 g / L, sodium carboxymethyl cellulose 5 g / L, agar 15 g / L), and cultured in the dark at 26°C for 15 days. Then, the culture was stained with 1 mg / mL Congo red solution. After 10 min, the Congo red solution was discarded, and the culture was rinsed 3 times with 1 mol / L NaCl solution. After standing for 3 min, the size of the transparent circle produced by the colony was measured and recorded, as shown in FIG. Figure 8 SPSS 26.0 software was used to process and analyze the data. The results showed that the transparent zone produced by the VdCel6D knockout mutant strain was significantly smaller than that of the wild-type strain V592, indicating that the VdCel6D protein can degrade cellulose and has cellulase activity.

[0061] The embodiment of the present invention provides the application of the cellulase gene VdCel6D of Verticillium dahliae in enhancing the pathogenicity of Verticillium dahliae. The expression of the VdCel6D gene in different times and different tissues was analyzed. The results showed that the expression of the VdCel6D gene was continuously upregulated with the increase of the induction time, and the expression level was the highest at 48 days of induction, indicating that the VdCel6D cellulase gene played an important role in the early stage of Verticillium dahliae infection of the host. According to the principle of homologous recombination, a knockout vector with VdCel6D as the target gene was constructed, and the conidia of the cotton Verticillium wilt V592 strain were transformed by Agrobacterium-mediated genetic transformation (ATMT), and two VdCel6D gene knockout mutants were obtained by screening; at the same time, a complementary vector with the VdCel6D gene as the target was constructed, and two VdCel6D complementary strains were obtained by screening. Compared with the wild-type strain V592 and the complemented strain, the colony morphology of the knockout mutant and the complemented mutant of VdCel6D was not significantly different from that of V592, but the spore production of the VdCel6D knockout mutant was significantly reduced. On the 7th day, the spore production of the VdCel6D knockout mutant was 0.54 and 0.58 times that of the wild-type strain V592. The knockout of VdCel6D caused a significant decrease in the pathogenicity of Verticillium dahliae, but did not affect the penetration ability of Verticillium dahliae. The size of the transparent circle produced by the mutant reflected the effect of the gene on the cellulase activity. It was found that the transparent circle produced by the VdCel6D knockout mutant strain was significantly smaller than that of the wild-type strain V592, indicating that the VdCel6D protein can degrade cellulose and has cellulase activity. The VdCel6D cellulose gene was transiently expressed in tobacco through Agrobacterium-mediated genetic transformation. The results showed that VdCel6D protein could not cause allergic necrosis in tobacco, but it could inhibit the immune response caused by BAX protein, and the expression of defense-related genes (NbAcre31, NbLOX and NbPR4) was significantly inhibited. This indicates that VdCel6D protein plays a toxic role in the process of Verticillium dahliae infecting host plants by inhibiting plant immunity.

[0062] In summary, the VdCel6D gene is involved in the growth, development and pathogenicity of Verticillium dahliae, affects the growth and development of plants, and also has a pathogenic effect.

[0063] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Use of the Verticillium dahliae GH6 cellulase VdCel6D gene in inhibiting Verticillium dahliae infection of plants, characterized in that: The nucleotide sequence of the VdCel6D gene is shown in the sequence listing SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The plants include cotton.

3. The use according to claim 1, characterized in that: The VdCel6D gene exerts its pathogenic effect by degrading plant cell walls through cellulase and inhibiting plant immune response.

4. Application of the Verticillium dahliae GH6 cellulase VdCel6D gene in promoting the growth and development of Verticillium dahliae, characterized in that: The nucleotide sequence of the VdCel6D gene is shown in the sequence listing SEQ ID NO.

1.

5. The use of the Verticillium dahliae GH6 cellulase VdCel6D gene in influencing the pathogenicity of Verticillium dahliae, characterized in that: The nucleotide sequence of the VdCel6D gene is shown in the sequence listing SEQ ID NO.

1.

6. The use according to claim 5, characterized in that: The pathogenicity includes at least one of disease index, hyphae penetration ability and host colonization ability.

7. Application of the Verticillium dahliae GH6 cellulase VdCel6D gene in influencing plant resistance, characterized in that: The nucleotide sequence of the VdCel6D gene is shown in the sequence listing SEQ ID NO.

1.

8. The use according to claim 7, characterized in that: The plants include cotton.

9. The use according to claim 7, characterized in that: The plant resistance includes at least one of a plant necrosis response and the ability to express a disease resistance gene.

10. The use according to claim 9, characterized in that: The disease resistance gene includes at least one of NbAcre31, NbLOX and NbPR4.

Images