DNA molecule for coding chimeric virus as well as preparation method and application of DNA molecule

Abstract

The invention relates to the field of bioengineering, and discloses a DNA molecule for coding a chimeric virus as well as a preparation method and application of the DNA molecule. The DNA molecule contains a 5'non-coding region sequence, a coding sequence of capsid protein C, a coding sequence of prM-E protein, a coding sequence of non-structural protein NS and a 3 'non-coding region sequence which are connected in series; wherein the coding sequence of the prM-E protein is derived from Uu figure virus, and the 5'non-coding region sequence, the coding sequence of the capsid protein C, the coding sequence of the non-structural protein NS and the 3 'non-coding region sequence are derived from encephalitis B virus. The DNA molecule and / or the chimeric virus have / has a good application prospect in the aspects of preventing Uusu virus infection and promoting secretion of Th1 cell factors.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and in particular to a DNA molecule encoding a chimeric virus and a preparation method and use thereof. Background Art

[0002] Flaviviruses are a class of single-stranded positive-sense RNA viruses, most of which are pathogens of zoonoses, and the diseases they cause have also received increasing attention. In recent years, new flaviviruses have continued to emerge and even large-scale outbreaks have posed severe challenges to the prevention and control of related diseases. Usutu virus belongs to the Flavivirus genus of the Flaviviridae family. It is a mosquito-borne flavivirus that was first discovered in Culex mosquitoes on the banks of the Usutu River in Swaziland, South Africa in 1959. It has now spread from Africa to many European countries, causing large-scale illness and death in many wild birds. In Europe, more than 100 cases of human infection with Usutu virus have been reported, most of which are asymptomatic, but neurological symptoms such as facial paralysis, meningitis and viral encephalitis have also appeared in infected people with low immunity or underlying diseases. With the continuous expansion of distribution space and infection range, Usutu virus may develop into a highly prevalent flavivirus that is common to humans and birds. At present, no vaccine or therapeutic drug for Usutu virus has been approved clinically, and it is necessary to quickly develop relevant vaccine candidate strains to respond to the sudden outbreak of Usutu virus at any time.

[0003] The full-length genome of Usutu virus is about 11kb, consisting of an open reading frame and non-coding regions at both ends. The viral genome encodes three structural proteins (capsid protein C, membrane protein M and envelope protein E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5). Among them, E protein is an important antigenic component of the virus, containing neutralizing antigenic epitopes and type-specific antigenic epitopes. Among the existing vaccine platforms, attenuated live virus vaccines have achieved great success in preventing flavivirus infections and diseases. Among the many strategies for constructing attenuated live virus vaccines, there have been many attempts to design and construct highly attenuated and immunogenic chimeric flaviviruses by replacing the corresponding genes in the existing vaccine genome with the structural protein regions of heterologous flaviviruses. The Japanese encephalitis attenuated vaccine strain SA14-14-2 has been shown to have good safety and protective efficacy. Summary of the invention

[0004] The purpose of the present invention is to overcome the problems existing in the prior art and provide a DNA molecule encoding a chimeric virus and a preparation method and use thereof.

[0005] In order to achieve the above-mentioned object, the first aspect of the present invention provides a DNA molecule encoding a chimeric virus, the DNA molecule comprising a 5' non-coding region sequence, a capsid protein C coding sequence, a prM-E protein coding sequence, a non-structural protein NS coding sequence and a 3' non-coding region sequence connected in series;

[0006] The coding sequence of the prM-E protein is derived from Usutu virus, and the 5' non-coding region sequence, the capsid protein C coding sequence, the non-structural protein NS coding sequence and the 3' non-coding region sequence are derived from Japanese encephalitis virus.

[0007] The second aspect of the present invention provides a method for preparing the above-mentioned DNA molecule, which comprises: replacing the coding sequence of the prM-E protein in the cDNA corresponding to the Japanese encephalitis virus genomic RNA with the coding sequence of the prM-E protein of the Usutu virus.

[0008] The third aspect of the present invention provides an expression cassette, a recombinant vector, a transgenic cell line, a recombinant bacterium or a recombinant virus containing the above-mentioned DNA molecule.

[0009] A fourth aspect of the present invention provides a chimeric virus, wherein the cDNA sequence corresponding to the genomic RNA of the chimeric virus is identical to the sequence of the above-mentioned DNA molecule.

[0010] The fifth aspect of the present invention provides a method for preparing the above-mentioned chimeric virus, which comprises: replacing the coding sequence of the prM-E protein in the genome of the Japanese encephalitis virus with the coding sequence of the prM-E protein of the Usutu virus.

[0011] The sixth aspect of the present invention provides a vaccine, the active ingredient of which is the chimeric virus mentioned above.

[0012] The seventh aspect of the present invention provides the use of the above-mentioned DNA molecule or the above-mentioned chimeric virus in the preparation of a vaccine for preventing Usutu virus infection.

[0013] The eighth aspect of the present invention provides the use of the above-mentioned DNA molecule or the above-mentioned chimeric virus in promoting the secretion of Th1 cytokines by animal cells.

[0014] Through the above technical solution, the present invention has the following technical effects:

[0015] (1) The JE / Wusutu chimeric virus can replicate efficiently and stably in in vitro cell lines and has the potential for mass production; (2) The JE / Wusutu chimeric virus genome structure is stable and the possibility of reverting to a wild-type virus is extremely low; (3) The JE / Wusutu chimeric virus replicates only in the cytoplasm (i.e., the replication of the RNA virus genome, the assembly of the virus, the maturation and release of the virus are all carried out in the cytoplasm), and the viral genome it carries has no risk of integration into the host cell genome; (4) The JE / Wusutu chimeric virus can induce a good immune response to the envelope protein of the Wusutu chimeric virus; (5) The JE / Wusutu chimeric virus can protect animals from a lethal dose of exogenous chimeric Wusutu virus in an animal model; (6) The JE / Wusutu chimeric virus can promote cell secretion of the JE / Wusutu chimeric virus Th1 cytokines, especially at least one of interferon-γ, interleukin-2 and tumor necrosis factor-α. The Japanese encephalitis / Usutu chimeric virus provided by the present invention has good application prospects in being used as a Usutu virus vaccine for preventing and / or treating Usutu virus infection and promoting the secretion of Th1 cytokines. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a schematic diagram of the construction of the cDNA molecule of the full-length genome of the Japanese encephalitis / Usutu chimeric virus in Example 1;

[0017] Figure 2 This is the result of the cytopathic effect experiment of the rescue of the JE / Usutu chimeric virus in Example 2;

[0018] Figure 3 This is the plaque characteristic experimental result of the Japanese encephalitis / Usutu chimeric virus in Example 2;

[0019] Figure 4 is the result of the indirect immunofluorescence experiment of the JE / Usutu chimeric virus in Example 2;

[0020] Figure 5 These are the results of in vitro replication experiments of different cell lines of the JE / Usutu chimeric virus in Example 3;

[0021] Figure 6 These are the experimental results of plaque characteristics of different generations of the JE / Usutu chimeric virus in Example 3;

[0022] Figure 7 is the experimental result of neurotoxicity characteristics of Japanese encephalitis / Usutu chimeric virus in Example 4;

[0023] Figure 8 is the experimental result of the neuroinvasiveness characteristic of the JE / Usutu chimeric virus in Example 4;

[0024] Fig. 9is the IgG antibody level of the serum of mice immunized with the JE / Usutu chimeric virus in Example 5;

[0025] Fig.10 is the neutralizing antibody level of the serum of mice immunized with the JE / Usutu chimeric virus in Example 5;

[0026] Fig.11 is the cellular immunity level of mice immunized with JE / Usutu chimeric virus in Example 5;

[0027] Fig.12 This is the experimental result of the in vitro neutralization test in Example 5 to detect the protective effect of the Japanese encephalitis / Usutu chimeric virus on suckling mice. DETAILED DESCRIPTION

[0028] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0029] The first aspect of the present invention provides a DNA molecule encoding a chimeric virus, the DNA molecule comprising a 5' non-coding region sequence, a capsid protein C coding sequence, a prM-E protein coding sequence, a non-structural protein NS coding sequence and a 3' non-coding region sequence connected in series;

[0030] The coding sequence of the prM-E protein is derived from Usutu virus, and the 5' non-coding region sequence, the capsid protein C coding sequence, the non-structural protein NS coding sequence and the 3' non-coding region sequence are derived from Japanese encephalitis virus.

[0031] Among them, "derived from" as used in the present invention means constructing a coding sequence (DNA) of a certain protein based on the gene sequence (RNA) of the virus, and is not limited to extracting the gene sequence from the viral genome. For example, the sequence derived from the attenuated strain of Japanese encephalitis virus refers to a sequence that has more than 90% (it can be 92%, 95%, 96%, 97%, 98%, 99% or the range formed by any two of the above values ​​and the values ​​within the range, preferably 100%) identity with the gene sequence of the attenuated strain of Japanese encephalitis virus; "tandem connection" means connecting polynucleotide (or polypeptide) elements in a functional manner without interfering with each other's expression or performance, and the connected polynucleotide (or polypeptide) sequences are continuous.

[0032] In the present invention, the Usutu virus may be the Usutu virus Bologna 2009 strain.

[0033] In the present invention, the coding sequence of the prM-E protein is positions 477-2477 shown in SEQ ID NO: 2, or a sequence having more than 90% (which can be 92%, 95%, 96%, 97%, 98%, 99% or a range formed by any two of the above values ​​and a value within the range, preferably 100%) identity with positions 477-2477 shown in SEQ ID NO: 2.

[0034] In the present invention, the Japanese encephalitis virus is preferably an attenuated strain of SA14-14-2.

[0035] The attenuated strain SA14-14-2 was obtained from the wild strain SA14 through continuous passage in cells and animals and multiple rounds of plaque purification. Compared with the wild strain SA14, the virulence of the attenuated strain SA14-14-2 is significantly weakened, and its pathogenicity to adult mice, monkeys and other animals is almost completely lost. The live attenuated Japanese encephalitis virus vaccine developed using this attenuated strain is used by more than 300 million people in my country, and there has been no report of disease caused by vaccination, and it is safe and reliable.

[0036] In the present invention, the 5' non-coding region sequence, the capsid protein C coding sequence, the non-structural protein NS coding sequence and the 3' non-coding region sequence may be derived from the same strain of Japanese encephalitis virus or from different strains of Japanese encephalitis virus.

[0037] Preferably, the 5' non-coding region sequence is positions 1-95 shown in SEQ ID NO:2, or a sequence having more than 90% (which can be 92%, 95%, 96%, 97%, 98%, 99% or a range formed by any two of the above values ​​and a value within the range, preferably 100%) identity with positions 1-95 shown in SEQ ID NO:2.

[0038] Further preferably, the coding sequence of the capsid protein C is positions 96-476 shown in SEQ ID NO:2, or a sequence that has more than 90% (which can be 92%, 95%, 96%, 97%, 98%, 99% or the range formed by any two of the above values ​​and the values ​​within the range, preferably 100%) identity with positions 96-476 shown in SEQ ID NO:2.

[0039] Preferably, the coding sequence of the non-structural protein NS is positions 2478-10394 shown in SEQ ID NO: 2, or a sequence having 90% or more identity (which may be 92%, 95%, 96%, 97%, 98%, 99% or a range formed by any two of the above values ​​and a value within the range, preferably 100%) with positions 2478-10394 shown in SEQ ID NO: 2;

[0040] More preferably, the 3' non-coding region sequence is position 10395-10977 shown in SEQ ID NO: 2, or a sequence having more than 90% (which can be 92%, 95%, 96%, 97%, 98%, 99% or a range formed by any two of the above values ​​and a value within the range, preferably 100%) identity with position 10395-10977 shown in SEQ ID NO: 2.

[0041] Preferably, the DNA molecule sequence is a sequence having an identity of more than 90% (which may be 92%, 95%, 96%, 97%, 98%, 99% or a range formed by any two of the above values ​​and a value within the range, preferably 100%) to positions 1-13312 as shown in SEQ ID NO:2 or positions 1-13312 as shown in SEQ ID NO:2.

[0042] The second aspect of the present invention provides a method for preparing the above-mentioned DNA molecule, which comprises: replacing the coding sequence of the prM-E protein in the cDNA corresponding to the Japanese encephalitis virus genomic RNA with the coding sequence of the prM-E protein of the Usutu virus (connected in series), thereby obtaining the DNA molecule.

[0043] The third aspect of the present invention provides an expression cassette, a recombinant vector, a transgenic cell line, a recombinant bacterium or a recombinant virus containing the above-mentioned DNA molecule.

[0044] The expression cassette can be obtained by connecting a reporter gene commonly used in the art to the DNA molecule of the present invention.

[0045] The recombinant vector may be a recombinant cloning vector or a recombinant expression vector. According to one embodiment of the present invention, the recombinant vector may be a recombinant vector in which the DNA molecule is inserted into the multiple cloning site of the pANCR vector, and the pANCR vector sequence is a sequence having an identity of more than 90% (which may be 92%, 95%, 96%, 97%, 98%, 99% or a range formed by any two of the above values ​​and a value within the range, preferably 100%) to positions 10978-13312 as shown in SEQ ID NO:2 or positions 10978-13312 as shown in SEQ ID NO:2.

[0046] The transgenic cell line may be a cell containing the recombinant vector of the present invention, for example, it may be obtained by transferring the recombinant vector of the present invention into cells (such as HB101 competent cells, BHK-21 cells or Vero cells).

[0047] The recombinant bacteria may be a strain containing the recombinant vector of the present invention, for example, it may be obtained by transferring the recombinant vector of the present invention into a competent strain (such as Escherichia coli competent strain MC1061 or Top10).

[0048] The recombinant virus of the present invention can be obtained by introducing the recombinant vector into in vitro mammalian cells (such as BHK-21 cells).

[0049] A fourth aspect of the present invention provides a chimeric virus, wherein the cDNA sequence corresponding to the genomic RNA of the chimeric virus is identical to the sequence of the above-mentioned DNA molecule.

[0050] The fifth aspect of the present invention provides a method for preparing the above-mentioned chimeric virus, which comprises: replacing the coding sequence of the prM-E protein in the genome of the Japanese encephalitis virus with the coding sequence of the prM-E protein of the Usutu virus.

[0051] The sixth aspect of the present invention provides a vaccine, the active ingredient of which is the chimeric virus described above, wherein the vaccine may also contain various adjuvants conventionally used in the art, such as aluminum salt adjuvants and protein adjuvants.

[0052] The seventh aspect of the present invention provides the use of the above-mentioned DNA molecule or the above-mentioned chimeric virus in the preparation of a vaccine for preventing Usutu virus infection.

[0053] The method for preventing Usutu virus infection provided by the present invention comprises inoculating the above vaccine into a subject. The inoculation amount of the vaccine can be confirmed according to the antibody production situation. The subject can be a human and / or a mouse.

[0054] The eighth aspect of the present invention provides the use of the above-mentioned DNA molecule or the above-mentioned chimeric virus in promoting the secretion of Th1 cytokines by animal cells.

[0055] Preferably, the Th1 cytokine includes at least one of interferon-γ (IFN-γ), interleukin-2 (IL-2) and tumor necrosis factor-α (TNF-α);

[0056] Preferably, the cells are spleen cells;

[0057] Preferably, the animal is a mammal, more preferably a human and / or a mouse.

[0058] The present invention will be described in detail below by way of examples. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. Room temperature refers to a temperature of 25°C.

[0059] (Japanese encephalitis virus) SA14-14-2 attenuated strain: purchased from Chengdu Institute of Biological Products, also recorded in the article "Wu Yonglin, Zhao Yu, Huang Yuxian, et al., Dynamic distribution of Japanese encephalitis virus attenuated strain SA14-14-2 in mice, Chinese Journal of Biological Products, Issue 03, 2007".

[0060] Example 1

[0061] Construction of full-length cDNA clone of JE / Usutu chimeric virus with attenuated JE virus strain as gene backbone

[0062] In this embodiment, the attenuated strain of Japanese encephalitis virus SA14-14-2 is used as the gene skeleton to construct a Japanese encephalitis / Usutu chimeric virus, wherein the plasmid containing the full-length genomic cDNA sequence of the attenuated strain of Japanese encephalitis SA14-14-2 is shown in SEQ ID NO: 1 in the sequence table, wherein positions 1 to 95 from the 5′ end are 5′UTR; positions 96 to 476 are the coding gene (C) of capsid protein C; positions 477 to 2477 are the coding gene (prM-E) of membrane protein and envelope protein prM-E; positions 2478 to 10394 are the coding gene (NS) of non-structural protein NS; positions 10395 to 10977 are 3′UTR, and nucleotides 10978 to 13312 are pACNR vector sequences.

[0063] The bases 477-2477 of the JE virus plasmid were replaced with the deoxyribonucleotide sequence encoding the prM-E protein of the Usutu virus to obtain the full-length genome cDNA clone of the JE / Usutu chimeric virus. The schematic diagram of its structure is shown in Figure 1 The cDNA sequence corresponding to the JE / Usutu chimeric virus RNA rescued by the JE virus SA14-14-2 reverse genetics system is shown in SEQ ID NO: 2. The nucleotides 1-476 from the 5' end of the plasmid are the 5'UTR and C protein DNA molecules of the JE SA14-14-2 backbone, the nucleotides 477-2477 are the Usutu virus prM-E protein sequence, the nucleotides 2478-10977 are the JE SA14-14-2 backbone non-structural protein and 3'UTR sequence, the nucleotides 10978-13312 are the pACNR vector sequence, and the nucleotides 13327-13569 are the SP6 promoter.

[0064] The specific steps are as follows:

[0065] 1. Using the plasmid SEQ ID NO:1 with the full-length genomic cDNA sequence of the attenuated Japanese encephalitis strain SA14-14-2 as a template, using F1 and R1 in Table 1, and using a high-fidelity DNA polymerase premix ( Max, purchased from TAKARA) was used for PCR amplification to obtain the amplified product vector fragment DNA-JEV, with a length of 11569 bp; the specific amplification system is shown in Table 2, and the PCR program is shown in Table 3. The plasmid sequence of the synthetic Usutu virus prM-E protein sequence is shown in SEQ ID NO:3+SEQ ID NO:23 (commissioned to Shanghai Sangon Biotechnology Co., Ltd. for synthesis) as a template, using F2 and R2 in Table 1, using a high-fidelity DNA polymerase premix ( High-Fidelity 2X Master Mix, purchased from NEB, was used for PCR amplification to obtain an amplified product, an insert fragment DNA-USUV, with a length of 2000 bp. The specific amplification system is shown in Table 4, and the PCR program is shown in Table 5.

[0066] Table 1

[0067]

[0068]

[0069] Table 2

[0070] Reagents Dosage (μL) DNA-1 1 High-fidelity DNA polymerase master mix 25 Primer F1 2.5 Primer R1 2.5 water 19 Total volume 50

[0071] Table 3

[0072]

[0073] Table 4

[0074] Reagents Dosage (μL) DNA-2 1 High-fidelity DNA polymerase master mix 25 Primer F2 2.5 Primer R2 2.5 water 19 Total volume 50

[0075] Table 5

[0076]

[0077]

[0078] 2. Use In-Fusion Seamless Cloning Kit ( HD Cloning Plus, purchased from TAKARA), the vector fragment JEV-1 and the insert fragment USUV-1 were connected in vitro. The ligation product was transformed into HB101 competent cells (purchased from TAKARA), and the recombinant plasmid was extracted and digested with EcoRV for identification, and fragments of approximately 2568bp, 4129bp, and 6872bp were obtained, indicating that the digestion map was correct. The clones with the correct digestion map were sequenced, and finally the clones with correct sequencing and no mutations that did not meet the pre-taken mutations were selected to obtain the recombinant plasmid. The recombinant plasmid was named pANCR-ChinUSUV and used as the full-length cDNA cloning plasmid of Japanese encephalitis / Usutu chimeric virus.

[0079] Example 2

[0080] Rescue of JE / Usutu chimeric viruses

[0081] 1. In vitro transcription of full-length cDNA clone of JE / Usutu chimeric virus

[0082] The full-length cDNA clone plasmid pANCR-ChinUSUV of the Japanese encephalitis / Usutu chimeric virus was extracted using a plasmid extraction kit (purchased from Qiagen), and then extracted with phenol chloroform after Xho I digestion. The linearized plasmid was quantified and aliquoted and stored at -20°C for later use. The linearized full-length cDNA clone plasmid of the chimeric virus was used as a template, and in vitro transcription was performed using SP6 RiboMAX ExpressLarge Scale RNAProduction Systems (purchased from Promega) according to the instructions, and the reaction was carried out at 37°C for 6 hours. Then 2μl DNase was added and the reaction was carried out at 37°C for 20 minutes. 7.5M LiCl solution (purchased from Invitrogen) was added to purify the synthesized transcript RNA and quantify it, and the aliquoted was stored at -80°C for later use.

[0083] 2. Rescue of chimeric viruses

[0084] Lipofectamine TM MessengerMAX TM The transcript RNA obtained above was transfected into a monolayer of BHK-21 cells as follows: BHK-21 cells were seeded into a 24-well plate and cultured overnight at 37°C and 5% CO2 until the cell density reached 70%; 1 μl MessengerMAX TM Reagent and 25 μl Opti-MEM TM The culture medium was gently mixed and allowed to stand at room temperature for 10 min before being mixed with 2 μg of JE / Usutu chimeric virus transcript RNA and 25 μl of Opti-MEM TM The culture medium was gently mixed and allowed to stand at room temperature for 5 min; the mixture was added to one well of a 24-well plate and supplemented with 150 μl of Opti-MEM TM The culture medium was placed at 37°C and 5% CO2 by volume for 6 hours. The supernatant was removed and 500 μl of DMEM medium containing 2% FBS by weight was added and placed in an incubator at 37°C and 5% CO2 by volume. After the cells showed pathological changes, the culture supernatant was collected by centrifugation. The supernatant was re-inoculated into BHK-21 cells and after the cells showed pathological changes (see Figure 2 ), centrifuge and collect the supernatant. Store at -80℃.

[0085] 3. Determination of the complete genome sequence of the chimeric virus

[0086] The steps for segmental amplification and sequence determination of the coding region of the chimeric virus genome are as follows:

[0087] Using the JE / Usutu chimeric virus genomic RNA as a template, the genome was reverse transcribed using the PrimeScript TM One Step RT-PCR Kit (purchased from TAKARA) was used and then divided into 6 sections for amplification. The relevant primer sequences are shown in Table 6 (and the primers are used for amplification and sequencing at the same time). The specific amplification system and procedures are shown in Tables 7 and 8. The PCR amplification results showed that all 6 pairs of primers could amplify the target fragments with the same size as expected, and the results of sequence determination (first generation sequencing by Sangon Biotech Co., Ltd.) also showed that the obtained fragments were specific sequences of the attenuated strain of Japanese encephalitis virus SA14-14-2 and the Bologna2009 strain of Usutu virus. The above sequencing results show that the full-length cDNA sequence of the Japanese encephalitis / Usutu chimeric virus is shown in SEQ ID NO: 2 in the sequence table.

[0088] Table 6

[0089] Primer name Sequence (5'-3') F3 agaagtttatctgtgtgaacttc(SEQ ID NO:8) R3 caatttgagctagctggtg(SEQ ID NO:9) F4 gagtatgctggctaacaagaagg (SEQ ID NO:10) R4 ttgcgaaggacttcctgggt(SEQ ID NO:11) F5 agagaggagagcactgacgagtgt(SEQ ID NO:12) R5 accagggtgcaaatctagca(SEQ ID NO:13) F6 aactagaggagcagccattgt(SEQ ID NO:14) R6 gccaggtagctacctcgcat(SEQ ID NO:15) F7 ctgttggcctcgtcttccttg(SEQ ID NO:16) R7 ctactggcactgctgagcaa(SEQ ID NO:17) F8 gaatggagaggagagagtga(SEQ ID NO:18) R8 agatcctgtgttcttcctcaccaccagctaca(SEQ ID NO:19)

[0090] Table 7

[0091] Reagents Dosage (μL) 1 2 Enzyme premix 25 Primer F 1 Primer R 1 RNA 1 water 20 Total volume 50

[0092] Table 8

[0093]

[0094] 4. Plaque characteristics of chimeric viruses

[0095] In order to observe the plaque morphology of the chimeric virus, the JE / Usutu chimeric virus seed solution obtained in step 2 was diluted 10-fold to 10 with DMEM containing 2 wt% FBS. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 and 10 -7, inoculated at 400 μl / well into a monolayer of BHK-21 cells (90% confluence) plated on a 12-well plate. After 1.5 hours of adsorption, the virus solution was discarded, and a 1% (1 g / 100 mL) agar cap containing DMEM culture medium (containing 2 wt% FBS) was added and cultured in an incubator at 37°C and 5% CO2 by volume. Three days later, the cells were fixed with 4 wt% formaldehyde at room temperature for 1 hour, the agar cap was discarded, and the cells were stained with crystal violet at room temperature for 10 minutes to observe the plaque morphology. The plaques of the attenuated strain of Japanese encephalitis virus SA14-14-2 were analyzed in the same way. The results of the plaque assay are shown in the figure. Figure 3 As shown, the JE / Usutu chimeric virus can form plaques of uniform size and clear edges, and the plaque morphology and size are similar to those of the attenuated strain of JE virus SA14-14-2.

[0096] 5. Specific protein expression of chimeric virus

[0097] The virus-specific proteins in BHK-21 cells infected with the JE / Usutu chimeric virus were detected by indirect immunofluorescence (IFA) using the Flavivirus Universal E protein Antibody 4G2 (prepared in the laboratory). The method is as follows: The JE / Usutu chimeric virus and JE SA14-14-2 were inoculated into a monolayer of BHK-21 cells (90% confluence) plated on a 24-well plate at a dose of MOI = 0.01. After adsorption for 1.5 hours, the virus solution was discarded, the cell plate was washed three times with PBS buffer, and then DMEM medium containing 2% by weight FBS was added and placed in an incubator at 37°C and 5% by volume CO2 for two days. The above 4G2 antibody was diluted 1:1500 with PBS buffer, incubated with BHK-21 cells at 37°C for 2h, and washed with PBS buffer (10mM K2HPO4, 2mM KH2PO4, 135mMNaCl, 2.7mM KCl, pH7.4) for 3 times with shaking, 10min each time. Then, Alexa Fluor 488-labeled goat anti-mouse IgG antibody (purchased from Zhongshan Jinqiao Biotechnology Co., Ltd.) diluted 1:500 with PBS buffer was added to the cells, and acted at 37°C for 1h, and then washed with PBS buffer for 3 times with shaking, 5min each time. DAPI (6-diamidino-2-phenylindole) was diluted to a final concentration of 100ng / ml, incubated with cells at room temperature for about 4min, then discarded, washed with PBS buffer for 5min, and observed under a fluorescence microscope. Cells incubated without the addition of virus were used as negative controls. The results showed that since SA14-14-2 could not detect a positive signal using the 4G2 antibody, the positive signal detected in the BHK-21 cells infected with the JE / Usutu chimeric virus was the Usutu virus envelope E protein successfully expressed in the chimeric virus. The IFA results were as follows Figure 4 shown.

[0098] Example 3

[0099] Evaluation of the in vitro replication and genetic stability of Japanese encephalitis / Usutu chimeric virus

[0100] 1. Evaluation of the in vitro replication capacity of JE / Usutu chimeric viruses

[0101] In order to observe the in vitro proliferation characteristics of chimeric viruses in mammalian and mosquito cell lines, the JE / Usutu chimeric virus and JE SA14-14-2 virus were inoculated at an MOI of 0.01 into BHK-21 (baby hamster kidney passage cells, purchased from ATCC), Vero (African green monkey kidney cells, purchased from ATCC) and C6 / 36 cells (mosquito cells, purchased from ATCC) with a confluence of 90% in 24-well plates, respectively, and placed in an incubator at 37°C (BHK-21 and Vero cells) or 30°C (C6 / 36 cells) and 5% CO2 by volume for adsorption for 1.5 h. The virus solution was discarded and supplemented with DMEM medium (BHK-21 cells and Vero cells) or 1640 medium (C6 / 36 cells) containing 2% FBS by weight, and cultured in an incubator at 37°C (BHK-21 and Vero cells) or 30°C (C6 / 36 cells) and 5% CO2 by volume. The cell supernatant was collected at 24, 48, 72 and 96 h after inoculation, and the virus titer was determined by plaque titration (see step 4 of Example 2 for details), and a one-step growth curve was drawn (eg Figure 5 The results of the one-step growth curve showed that the JE / Usutu chimeric virus could be expressed in BHK-21 cells ( Figure 5 A) The titer peaked at 6×10 about 48 hours after inoculation. 6 PFU / ml; in Vero cells, the highest titer of JE / Usutu chimeric virus reached 1.2×10 at 72 hours after infection 6 ( Figure 5 In the mosquito cell line (C6 / 36), the JE / Usutu chimeric virus reached a peak titer of 2.5×10 at approximately 96 h after infection. 7 PFU / ml Figure 5 The above indicates that the chimeric virus can replicate efficiently in different cell lines.

[0102] 2. Evaluation of the genetic stability of the JE / Usutu chimeric virus

[0103] The JE / Wusutu chimeric virus was continuously passaged in Vero cells, and the specific steps were as follows: the JE / Wusutu chimeric virus was inoculated into a monolayer of Vero cells (with a confluence of 90%) at an MOI of 0.01, and the cell supernatant was collected three days later, and the virus titer was determined by a plaque assay. Then, the virus was inoculated into a monolayer of Vero cells (with a confluence of 90%) at an MOI of 0.01. After 8 consecutive passages, the viruses of each generation were frozen at -80°C. The RNA of the JE / Wusutu chimeric virus of the first generation (seed liquid), the fourth generation, and the eighth generation were respectively extracted, and the genomic cDNA was obtained by reverse transcription with primer R8, and the prM protein and E protein coding segments of the JE / Wusutu chimeric virus were amplified and sequenced with primers F3, R3 and F4, R4, respectively. The 4th and 8th generation virus sequences were compared with the original virus. The results showed that the prM protein and E protein coding segment sequences of the Japanese encephalitis / Wusutu chimeric virus obtained after cell passage had only one amino acid site mutation in the 8th generation, specifically, the base 1893 site mutated from G to A, causing the E protein site 306 site to mutate from glutamic acid to lysine. At the same time, the plaque characteristics of the 1st, 4th, and 8th generation Japanese encephalitis / Wusutu chimeric viruses were identified. For specific operation methods, please refer to the relevant content of step 4 of Example 2. The results showed that compared with the P1 generation virus, the plaque morphology of the Japanese encephalitis / Wusutu chimeric virus did not change significantly (see Figure 6 ). Based on the above results, it can be seen that the JE / Usutu chimeric virus has genetic and plaque morphological stability.

[0104] Example 4

[0105] Neurotoxicity and neuroinvasiveness of Japanese encephalitis / Usutu chimeric virus

[0106] 1. Neurovirulence characteristics of Japanese encephalitis / Usuturo chimeric virus

[0107] First, the neurovirulence characteristics of the JE / Wusutu chimeric virus were observed. The JE / Wusutu chimeric virus and the JE virus SA14-14-2 attenuated strain were intracranially inoculated into 10 5-day-old Kunming suckling mice (purchased from Vital River Company) at a dose of 100, 10 and 1 PFU, respectively. Death within 24 hours after inoculation was considered non-specific death. The incidence and mortality of mice were observed within 15 days, and the median lethal dose (LD50, calculated using the internationally accepted Reed and Muench method) of the virus was calculated. The results are as follows Figure 7 The LD50 value of the JE / Wusutu chimeric virus was 4.39 PFU, and the LD50 value of the attenuated strain of JE virus SA14-14-2 was 8.31 PFU. The two had similar neurotoxicity in suckling mice, which proved that the JE / Wusutu chimeric virus had similar attenuation characteristics as SA14-14-2.

[0108] 2. Neuroinvasive characteristics of JE / Usutu chimeric virus

[0109] In order to observe the neuroinvasive characteristics of chimeric viruses, the JE / Usutu chimeric virus and the JE virus SA14-14-2 attenuated strain were respectively injected into the 10 5 The dose of PFU was intraperitoneally and subcutaneously inoculated into 4-week-old BALB / c female mice. Death within 24 hours after inoculation was considered nonspecific death. The incidence and mortality of mice were observed within 15 days, and the brain and serum of mice were collected on the 1st, 3rd, and 6th day after infection to detect the viral load by reverse transcription quantitative PCR (upstream and downstream primers and probe sequences are shown in Table 9). The results are shown in Figure 8 As shown, all infected animals remained alive and none of the mice showed any neurological symptoms. The RNA load in the serum and brain of mice infected with the JE / Wusutu chimeric virus remained near or below the detection line, indicating that the JE / Wusutu chimeric virus has a similar attenuated neuroinvasiveness to SA14-14-2 and is safe.

[0110] Table 9

[0111] Primer name Sequence (5'-3') F9 taccagctctgacactcacg(SEQ ID NO:20) R9 gtatgcctcggtgttcaacc(SEQ ID NO:21) P FAM-accgcccagcctgtgatgctcc(SEQ ID NO:22)-BHQ1

[0112] Example 5

[0113] Immunogenicity of Japanese encephalitis / Usutu chimeric virus and its protection in suckling mice model

[0114] The Japanese encephalitis / Usutu chimeric virus (10 5 and 10 4 Four-week-old BALB / c mice were immunized intraperitoneally with 1000 PFU / mouse. Mice injected with the same volume of DMEM were used as negative controls. Blood was collected from the inner canthus of the eye of each group of mice on the 14th and 28th days after immunization. The serum was collected by centrifugation after standing at 37°C for 0.5h, inactivated at 56°C for 30min, and stored at -20°C for later use.

[0115] 1. ELISA method to detect the total IgG titer of immune serum against Usutu virus

[0116] Specific method: Coat 96-well plates with heat-inactivated JE / Usutu chimeric virus at 4°C overnight. Shake dry the plates, wash once with 300μl / well PBST; add 5 wt% skim milk powder for blocking, 200μl / well, incubate at 37°C for 2h; dilute immune serum 2-fold (1:100-1:3200), add diluted immune serum or PBS to 96-well ELISA plates, 100μl / well, use PBS as negative control, incubate at 37°C for 2h; wash 5 times with 300μl / well PBST. Finally, add HRP-labeled goat anti-mouse IgG antibody (purchased from Beijing Zhongshan Jinqiao Biological Co., Ltd., 1:10000 dilution), 100μl / well, incubate at 37℃ for 30min; repeat the plate washing 5 times with 300μl / well PBST; add TMB colorimetric solution (purchased from Beijing Kangwei Century Co., Ltd.) 100μl / well, incubate at 37℃ in the dark for 15min, add stop solution, 100μl / well, and measure OD450 value within 5min. The results of IgG antibody in the serum of mice on the 14th and 28th days after immunization are shown in Fig. 9 The above results showed that immunization of mice with different doses of JE / Wusutu chimeric virus could effectively stimulate the mice to produce high levels of Wusutu virus-specific IgG antibodies, and the chimeric virus had good immunogenicity.

[0117] 2. Plaque reduction neutralization test (PRNT) to determine the neutralizing antibody titer in mouse serum (PRNT50)

[0118] Specific method: The mouse sera of each immune group on the 14th and 28th day after immunization were prepared into dilutions of 1:10, 1:20, 1:40, 1:80, 1:160 and 1:320 with 2 wt% FBS in DMEM, mixed with an equal volume of Japanese encephalitis / Usutu chimeric virus suspension containing about 100 PFU, and incubated at 37°C for 1.5h. Then, each mixed solution was inoculated into BHK-21 cells with a confluence of 90% in a 12-well plate at 400μl / well, and cultured at 37°C and 5% CO2 by volume for 1-2h; the culture supernatant was discarded, and an agar cap (i.e., DMEM culture medium containing 2 wt% FBS and 1 wt% methylcellulose) was added to each well, and cultured at 37°C and 5% CO2 by volume for three days. The virus particles in the serum-virus mixture were counted by plaque assay, and the neutralizing antibody titer in the serum was calculated (using the internationally accepted calculation method Reed and Muench method). The results are shown in Fig.10 The results showed that each dose group could induce mice to produce neutralizing antibodies with a titer greater than or equal to 1:10, and the Japanese encephalitis / Usutu chimeric virus could effectively induce mice to produce protective neutralizing antibodies.

[0119] 3. ELISpot assay to detect the activation of cellular immunity in mice by JE / Usutu chimeric virus

[0120] Specific method: Antigen-specific T cell response was measured by ELISpot on the 28th day after JE / Usutu chimeric virus immunization. 100 μl / well of splenocyte suspension (300,000 cells / well) and 100 μl / well of 4 μg / ml USUV E protein peptide pool (ordered from GenScript) dilution were added to 96-well ELISpot plates (purchased from MabTech) (interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), interleukin-2 (IL-2) and interleukin-4 (IL-4)) from mice immunized with JE / Usutu chimeric virus for 28 days, 3 μg / ml concanavalin A 100 μl / well was used as the positive control of the experiment, and RPMI 1640 medium was used as the negative control of the experiment. After incubation for 36 hours at 37°C and 5% CO2 by volume, the plate was washed with PBS and the respective anti-mouse antibodies (IFN-γ, TNF-α, IL-2 and IL-4) were added to each well at room temperature, diluted 1:1000, 100 μl / well, and incubated for 2 hours. Streptavidin ALP was then diluted 1:1000, 100 μl / well, added to each well and incubated for 1 hour. Finally, the spots were counted using an automatic ELISpot reader. The number of spots formed (SFCs) per 1,000,000 cells was calculated. The results are shown in Figure 2. Fig.11 The results showed that compared with the control group, the secretion of IFN-γ, IL-2 and TNF-α in spleen cells of the JE / Wusutu chimeric virus immunization group increased significantly on the 28th day after immunization, while there was no significant difference in IL-4 secretion. The JE / Wusutu chimeric virus induced a Th1-biased antigen-specific cellular immune response.

[0121] 4. In vitro neutralization test to detect the protective effect of JE / Usutu chimeric virus on suckling mice

[0122] Take the Japanese encephalitis / Usutu chimeric virus (10 5 The serum of mice immunized with 100 PFU / mouse) for 28 days was mixed with an equal volume of JE / Usutu chimeric virus suspension containing about 30 PFU (about 4LD50) and incubated at 37°C for 1.5 hours. At the same time, the serum of mice immunized with DMEM was neutralized with the above virus as a negative control. The mixture was then inoculated intracranially into 5-day-old Kunming suckling mice (purchased from Vital River). The incidence and mortality of mice were recorded every day, and the intracranial viral RNA load of mice was detected 1, 3, and 6 days after infection. The results are shown in the figure. Fig.12The results showed that more than 80% of the mice were protected by the immune serum, while all mice inoculated with DMEM group serum to neutralize the virus showed growth retardation, paralysis or other neurological symptoms and died within 8 days. In addition, a large amount of viral replication was observed in the brain of mice in the control group. In contrast, a significant reduction in viral RNA was detected in mice treated with immune group serum. The results showed that the Japanese encephalitis / Usutu chimeric virus immune serum has a protective effect against the lethal chimeric Usutu virus challenge in suckling mice.

[0123] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

[0124] SEQ ID NO: 1 is:

[0125]

[0126] SEQ ID NO:2 is:

[0127]

[0128] SEQ ID NO:3+SEQ ID NO:23 (positions 1-13103 are SEQ ID NO:3, positions 13104-16388 are SEQ ID NO:23) are:

[0129]

Claims

1. A DNA molecule encoding a chimeric virus, characterized in that The DNA molecule contains a 5' non-coding region sequence, a capsid protein C coding sequence, a prM-E protein coding sequence, a non-structural protein NS coding sequence and a 3' non-coding region sequence connected in series; The coding sequence of the prM-E protein is derived from Usutu virus, and the 5' non-coding region sequence, the capsid protein C coding sequence, the non-structural protein NS coding sequence and the 3' non-coding region sequence are derived from Japanese encephalitis virus.

2. The DNA molecule according to claim 1, wherein The coding sequence of the prM-E protein is positions 477-2477 of SEQ ID NO: 2 or a sequence having more than 90% identity with positions 477-2477 of SEQ ID NO: 2; and / or, the 5' non-coding region sequence is positions 1 to 95 of SEQ ID NO: 2 or a sequence having more than 90% identity with positions 1 to 95 of SEQ ID NO: 2; and / or, the coding sequence of the capsid protein C is positions 96-476 shown in SEQ ID NO: 2 or a sequence having 90% or more identity with positions 96-476 shown in SEQ ID NO: 2; and / or, the coding sequence of the nonstructural protein NS is positions 2478 to 10394 shown in SEQ ID NO: 2 or a sequence having more than 90% identity with positions 2478 to 10394 shown in SEQ ID NO: 2; And / or, the 3' non-coding region sequence is positions 10395-10977 shown in SEQ ID NO:2 or a sequence having more than 90% identity with positions 10395-10977 shown in SEQ ID NO:

2.

3. The DNA molecule according to claim 1 or 2, wherein The DNA molecule sequence is the sequence of positions 1 to 13312 shown in SEQ ID NO: 2 or a sequence with more than 90% identity with positions 1 to 13312 shown in SEQ ID NO:

2.

4. A method for preparing a DNA molecule according to any one of claims 1 to 3, characterized in that: The method comprises: replacing the coding sequence of the prM-E protein in the cDNA corresponding to the Japanese encephalitis virus genome RNA with the coding sequence of the prM-E protein of the Usutu virus.

5. An expression cassette, recombinant vector, transgenic cell line, recombinant bacterium or recombinant virus containing the DNA molecule according to any one of claims 1 to 3.

6. A chimeric virus, characterized in that The cDNA sequence corresponding to the genomic RNA of the chimeric virus is identical to the sequence of the DNA molecule described in any one of claims 1-3.

7. A method for preparing the chimeric virus according to claim 6, characterized in that: The method comprises: replacing the coding sequence of the prM-E protein in the genome of the Japanese encephalitis virus with the coding sequence of the prM-E protein of the Usutu virus.

8. A vaccine, characterized in that The active ingredient of the vaccine is the chimeric virus described in claim 6.

9. Use of the DNA molecule according to any one of claims 1 to 3 or the chimeric virus according to claim 6 in the preparation of a vaccine for preventing Usutu virus infection.

10. Use of the DNA molecule according to any one of claims 1 to 3 or the chimeric virus according to claim 6 in promoting the secretion of Th1 cytokines by animal cells; Preferably, the Th1 cytokine includes at least one of interferon-γ, interleukin-2 and tumor necrosis factor-α; Preferably, the cells are spleen cells; Preferably, the animal is a mammal.

Images