Application of OsHTT6 protein in regulating high-temperature stress tolerance and yield of rice

Abstract

The invention discloses application of OsHTT6 protein in regulation and control of high temperature stress tolerance and yield of rice. Through construction of an OsHTT6 protein function deletion mutant rice line and an OsHTT6 protein overexpression transgenic rice line, it is found that by inhibiting expression of the OsHTT6 protein, the tolerance of rice to high temperature stress can be improved, the survival rate of rice seedlings subjected to high temperature stress is increased, in addition, the yield of a single plant of rice can be increased, and the yield of the rice seedlings is increased. And overexpression of the OsHTT6 protein can reduce the tolerance of the rice to high temperature stress and reduce the single-plant yield of the rice. The high-temperature stress tolerance and yield of the rice can be regulated and controlled by regulating and controlling the expression of the OsHTT6 protein, and a reagent capable of inhibiting the expression of the OsHTT6 protein can be used for improving the high-temperature stress tolerance and yield of the rice or constructing heat-resistant and high-yield rice plants. The method is beneficial to cultivation of heat-resistant and high-yield rice varieties.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and more specifically, relates to the application of OsHTT6 protein in regulating the tolerance and yield of rice to high temperature stress. Background Art

[0002] As global climate change intensifies, the frequency of extreme climate events has increased significantly, and high temperature stress has become one of the important factors that seriously affect agricultural production. It has been reported that every 1°C increase in average temperature will lead to a 3% reduction in rice production. In addition to causing a reduction in rice production, high temperature stress will also seriously reduce the quality of rice. Therefore, it is urgent to cultivate heat-resistant rice varieties to cope with extreme climate events, reduce the impact of high temperature stress on crop growth, and ensure food production and quality.

[0003] At present, the heat tolerance of rice is mainly improved through agronomic management measures and assisted selection breeding based on agronomic traits such as fruiting rate selection. Although genes related to heat stress tolerance in rice have been reported one after another, the molecular mechanism of rice response to heat stress is still poorly understood, and the genetic improvement of heat stress tolerance in rice in actual breeding has been slow. Therefore, it is still necessary to continuously explore genes related to heat stress tolerance in rice to facilitate the cultivation of heat stress-resistant rice varieties. Summary of the invention

[0004] In view of the deficiencies in the above-mentioned prior art, the present invention provides the use of OsHTT6 protein in regulating the tolerance and yield of rice to high temperature stress.

[0005] The first object of the present invention is to provide an application of OsHTT6 protein or a gene encoding OsHTT6 protein in regulating the tolerance of rice to high temperature stress.

[0006] The second object of the present invention is to provide an application of OsHTT6 protein or a gene encoding OsHTT6 protein in regulating rice yield.

[0007] The third object of the present invention is to provide a method for improving the tolerance and / or yield of rice to high temperature stress.

[0008] The fourth object of the present invention is to provide a use of an agent for inhibiting the expression of OsHTT6 protein in improving the tolerance of rice to high temperature stress or in preparing a product for improving the tolerance of rice to high temperature stress.

[0009] A fifth object of the present invention is to provide use of an agent for inhibiting the expression of OsHTT6 protein in cultivating rice plants with improved tolerance to high temperature stress.

[0010] The sixth object of the present invention is to provide use of an agent for inhibiting the expression of OsHTT6 protein in increasing rice yield or in preparing a product for increasing rice yield.

[0011] A seventh object of the present invention is to provide use of an agent for inhibiting the expression of OsHTT6 protein in cultivating rice plants with improved yield.

[0012] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0013] The present invention constructs OsHTT6 protein function-deficient mutant rice strains and OsHTT6 protein overexpression transgenic rice strains to find that inhibiting the expression of OsHTT6 protein can improve the tolerance of rice to high temperature stress and improve the survival rate of rice seedlings after suffering from high temperature stress. In addition, the number of primary stalks, the average number of effective tillers, the average fruit setting rate and the yield per plant of rice can also be increased, thereby improving the rice yield. Overexpression of OsHTT6 protein will reduce the tolerance of rice to high temperature stress, and reduce the number of primary stalks, the average number of effective tillers, the average fruit setting rate and the yield per plant of rice. This shows that the tolerance of rice to high temperature stress and its yield can be regulated by regulating the expression of OsHTT6 protein.

[0014] Therefore, the present invention seeks to protect the use of OsHTT6 protein or a gene encoding OsHTT6 protein in regulating the tolerance of rice to high temperature stress.

[0015] The present invention also claims to protect the use of OsHTT6 protein or a gene encoding OsHTT6 protein in regulating rice yield.

[0016] Specifically, the amino acid sequence of the OsHTT6 protein is shown in SEQ ID NO.3.

[0017] In a specific embodiment of the present invention, the nucleotide sequence of the gene encoding the OsHTT6 protein is shown as SEQ ID NO.2.

[0018] The present invention also provides a method for improving the tolerance and / or yield of rice to high temperature stress, which comprises: inhibiting the expression of OsHTT6 protein in rice.

[0019] Specifically, the expression of the OsHTT6 protein in rice is inhibited by interfering with the expression of the gene encoding the OsHTT6 protein, or by mutating or knocking out the coding region or promoter of the gene encoding the OsHTT6 protein.

[0020] More specifically, the expression of the gene encoding the OsHTT6 protein is interfered with by RNA interference technology; or the coding region or promoter of the gene encoding the OsHTT6 protein is mutated by a gene editing system; or the gene sequence encoding the OsHTT6 protein is knocked out by homologous recombination to inhibit the expression of the OsHTT6 protein in rice.

[0021] Specifically, the mutation includes base insertion, deletion or base conversion.

[0022] In a specific embodiment of the present invention, the nucleotide sequence of the gene encoding the OsHTT6 protein is shown as SEQ ID NO.2; the promoter sequence of the gene is shown as SEQ ID NO.1.

[0023] Optionally, the gene editing system is a CRISPR / Cas9-based gene editing system.

[0024] In a specific embodiment of the present invention, the expression of OsHTT6 protein in rice is inhibited by mutating the gene encoding OsHTT6 protein.

[0025] Specifically, the method for inhibiting the expression of OsHTT6 protein in rice is as follows: designing a CRISPR / Cas9-based sgRNA sequence for the gene (or target sequence) encoding the OsHTT6 protein, connecting a DNA fragment containing the sgRNA sequence encoding the sgRNA sequence to a pCRISPR / Cas9 vector carrying a Cas9 expression cassette and transforming rice callus to achieve site-directed mutagenesis of the gene encoding the OsHTT6 protein, thereby rendering the OsHTT6 protein inoperable.

[0026] Specifically, the target sequence recognized by sgRNA conforms to the 5'-N X -NGG-3' or 5'-N X -NTT-3' sequence rule; where N represents any one of A, T, C, G, x is an integer between 17 and 20, N X express X consecutive deoxyribonucleotides.

[0027] As an optional embodiment, the nucleotide sequence of the target site recognized by the sgRNA is shown in SEQ ID NO.4.

[0028] Specifically, the present invention obtains a mutant strain with loss of function of OsHTT6 protein by mutating the gene encoding the OsHTT6 protein in rice, comprising the following steps:

[0029] S1. Design sgRNA target sequence and adapter primer;

[0030] S2. Constructing the sgRNA vector containing the target sequence fragment: synthesizing the adapter primer, denaturing the adapter primer and moving it to room temperature to cool and complete annealing; connecting the annealed primer pair to the sgRNA vector after enzyme digestion, and verifying the positive plasmid by PCR amplification and sequencing;

[0031] S3. Construction of pCRISPR / Cas9 vector containing target sequence fragment: Cut the gRNA expression cassette containing the target sequence fragment from the gRNA, and then connect it to the pCRISPR / Cas9 vector containing the Cas9 expression cassette;

[0032] S4. Transformation: The pCRISPR / Cas9 vector containing the target site is transformed into rice callus tissue, and positive transgenic plants are identified through screening, differentiation and rooting.

[0033] S5. Identification of mutation sites: Extract DNA from positive plants, design identification primers to amplify the extracted DNA, purify it, sequence it, and analyze the mutation.

[0034] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.4, the nucleotide sequences of the adapter primers are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0035] Specifically, the nucleotide sequences of the primer pair used to identify the mutation site are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0036] Specifically, the rice is indica rice.

[0037] More specifically, the rice is the indica rice variety Nan Guizhan.

[0038] Since inhibiting the expression of OsHTT6 protein in rice can improve the tolerance and yield of rice to high temperature stress, the present invention also claims the use of an agent for inhibiting the expression of OsHTT6 protein in improving the tolerance of rice to high temperature stress or in preparing a product for improving the tolerance of rice to high temperature stress.

[0039] The present invention also claims the use of an agent for inhibiting the expression of OsHTT6 protein in cultivating rice plants with improved tolerance to high temperature stress.

[0040] Specifically, the method of improving the tolerance of rice to high temperature stress is to improve the tolerance of rice to high temperature stress at the seedling stage.

[0041] The present invention also claims to protect the use of the agent for inhibiting the expression of OsHTT6 protein in increasing rice yield or in preparing a product for increasing rice yield.

[0042] The present invention also claims the use of an agent for inhibiting the expression of OsHTT6 protein in cultivating rice plants with improved yield.

[0043] Specifically, the agent increases rice yield by increasing the number of primary branches, the average number of effective tillers, the average fruit setting rate and / or the yield per plant of rice.

[0044] Specifically, the agent for inhibiting the expression of OsHTT6 protein includes an agent interfering with the expression of the gene encoding OsHTT6 protein or a vector for mutating or knocking out the gene encoding OsHTT6 protein.

[0045] The present invention has the following beneficial effects:

[0046] The present invention constructs OsHTT6 protein function-deficient mutant rice strains and OsHTT6 protein overexpression transgenic rice strains to find that inhibiting the expression of OsHTT6 protein can improve the tolerance of rice to high temperature stress, improve the survival rate of rice seedlings after being subjected to high temperature stress, and can also improve the number of primary stalks, average number of effective tillers, average fruit setting rate and single plant yield of rice, while overexpression of OsHTT6 protein will reduce the tolerance of rice to high temperature stress, reduce the number of primary stalks, average number of effective tillers, average fruit setting rate and single plant yield of rice. That is, the tolerance of rice to high temperature stress and its yield can be regulated by regulating the expression of OsHTT6 protein, and the reagent capable of inhibiting the expression of OsHTT6 protein can be used to improve the tolerance of rice to high temperature stress and its yield, or to construct heat-resistant and high-yield rice plants. The present invention is conducive to the cultivation of heat-resistant and high-yield rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The expression of OsHTT6 gene in OsHTT6 mutant strain, overexpression transgenic strain and wild type N. guizhanensis; ***p<0.001, all compared with the wild type.

[0048] Figure 2 The phenotypes of OsHTT6 mutant strains, overexpression transgenic strains and wild-type Nanguizhan before and after high temperature stress treatment.

[0049] Figure 3 This is the chlorophyll fluorescence imaging of OsHTT6 mutant strains, overexpression transgenic strains and wild-type Nanguizhan before and after high temperature stress treatment.

[0050] Figure 4 The results of Fv / Fm, survival rate, ion leakage rate and plant height detection of OsHTT6 mutant strains, overexpression transgenic strains and wild type Nanguizhan before and after high temperature stress treatment are shown in A to D in the figure, respectively; ***p<0.001 in the figure, all compared with the wild type.

[0051] Figure 5 These are the test results of yield traits of OsHTT6 mutant strains, overexpression transgenic strains and wild-type Nanguizhan; A to D in the figure are the test results of single plant yield, number of primary branches, average number of effective tillers and average fruit setting rate, respectively; *p<0.05; ***p<0.001 in the figure, all compared with the wild type. DETAILED DESCRIPTION

[0052] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0053] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0054] The nucleotide sequence of the promoter of the OsHTT6 gene described in the embodiment of the present invention is shown in SEQ ID NO.1; the nucleotide sequence of the OsHTT6 gene (gDNA) is shown in SEQ ID NO.2, and the amino acid sequence of the OsHTT6 protein encoded thereby is shown in SEQ ID NO.3.

[0055] Example 1 Obtaining OsHTT6 protein function-deficient mutant rice lines

[0056] The present invention utilizes CRISPR / Cas9 technology to mutate the OsHTT6 gene, and obtains OsHTT6 gene mutant strains, namely, OsHTT6 protein function-deficient mutant strains htt6-1 and htt6-2.

[0057] The process of obtaining the mutant strain is as follows:

[0058] 1. Design of sgRNA target sequence and adapter primer

[0059] The target sequence was designed based on the OsHTT6 gene (the nucleotide sequence of the gene is shown in SEQ ID NO. 2) using the targetDesign applet (http: / / skl.scau.edu.cn / targetdesign / ) (method reference: DOI: http: / / dx.doi.org / 10.1016 / j.molp.2017.06.004).

[0060] The sgRNA target sequence (5'→3') designed in this example is as follows:

[0061] Target-HTT6-U6: CTGGTGGTTAACATACCAGG (shown in SEQ ID NO.4)

[0062] Based on the sgRNA target sequence, the designed adapter primers with sticky ends (5'→3') are as follows:

[0063] Target-HTT6-U6F: ggcaCTGGTGGTTAACATACCAGG (shown in SEQ ID NO.5)

[0064] Target-HTT6-U6R: aaacCCTGGTATGTTAACCACCAG (shown in SEQ ID NO.6)

[0065] 2. Construction of pU6-gRNA vector containing Target-HTT6 fragment

[0066] Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the above-mentioned adapter primer Target-HTT6-U6F / R with sticky ends; the synthesized adapter primer was heated at 90°C for 30s to denature and then moved to room temperature for cooling to complete annealing, and the annealed primer was connected to the pU6-gRNA vector after enzyme digestion. After PCR amplification and sequencing verification, the pU6-gRNA vector containing the Target-HTT6-U6 fragment was obtained.

[0067] The PCR primers used for PCR verification were Target-HTT6-U6F / Target-HTT6-U6R.

[0068] 3. Construction of pCRISPR / Cas9 vector containing Target-HTT6-U6 fragment

[0069] The expression cassette of the Target-HTT6-U6 fragment was cut out from the pU6-gRNA vector containing the Target-HTT6-U6 fragment constructed above, and connected to the pCRISPR / Cas9 vector containing the Cas9 expression cassette. After PCR amplification and sequencing verification, the pCRISPR / Cas9 vector containing the Target-HTT6-U6 fragment was obtained.

[0070] 4. Screening of mutant strains

[0071] The constructed pCRISPR / Cas9 vector containing the Target-HTT6-U6 fragment was transformed into the callus tissue of the rice indica variety Nanguizhan through Agrobacterium tumefaciens-mediated genetic transformation; after secondary screening, differentiation and rooting into seedlings, the obtained plants were planted in a net room, and the positive mutant strains were screened for sequencing identification.

[0072] 5. Sequencing and identification of mutation sites in mutant strains

[0073] The genomic DNA (gDNA) of the positive mutant strain was extracted and used as a template for PCR amplification using primers (5'→3') HTT6TF (TCGTGTTTTGTTGCGACCTG, shown in SEQ ID NO.7) and HTT6TR (CCTGGTATGTTAACCACCAG, shown in SEQ ID NO.8). The amplified product was purified and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target sequence of the wild-type Nanguizhan plant before mutation to analyze the mutation.

[0074] The reaction system used for PCR amplification was: 1 μL of template gDNA, 1 μL of primers HTT6TF / R, 10 μL of 2×Taq Mix, and 20 μL of ddH2O; the reaction conditions used for PCR amplification were: 94°C for 2 min; 94°C for 20 sec, 58°C for 20 sec, 72°C for 30 sec, 30 cycles; 72°C for 5 min.

[0075] After sequencing and identification, the mutation conditions of the OsHTT6 gene mutant strains htt6-1 and htt6-2 obtained in this example are as follows:

[0076] WT: AGAAGGATCTGTTCCACCTGGTATGTTAACCACCAG

[0077] htt6-1: AGAAGGATCTGTTCCACCTG-TATGTTAACCACCAG

[0078] htt6-2: AGAAGGATCTGTTCCACCT------TTAACCACCAG

[0079] Among them, WT represents the wild type; htt6-1 and htt6-2 represent different mutant strains; "-" in the sequence represents a base deletion. By comparison, it can be seen that the mutant strain obtained in this embodiment has one or more base deletions in the target sequence compared with the wild type, indicating that the present invention successfully mutated the OsHTT6 gene and obtained the corresponding mutant strain.

[0080] Example 2 Obtaining OsHTT6 protein overexpressing transgenic rice lines

[0081] 1. Obtaining overexpression transgenic rice lines

[0082] In this example, the overexpression recombinant vector of the OsHTT6 gene was transferred into the callus tissue of the wild-type indica rice variety Nanguizhan by using the genetic transformation method mediated by Agrobacterium tumefaciens EHA105, thereby constructing an overexpression transgenic rice strain. The specific method was carried out with reference to the method described in the literature (Zhou Lingyan, Jiang Dagang, Wu Hao, et al. Establishment of a rice transformation system based on TAC vector [J]. Journal of Genetics, 2005, 32(005): 514-518.).

[0083] After screening, pre-differentiation and differentiation, T0 generation transformed plants were obtained and subjected to PCR and fluorescence quantitative PCR detection to determine whether they were positive transformed plants; the obtained positive transformed plants were self-pollinated to obtain transgenic 1 (T1) generation strains, and 10 plants that were positive by PCR detection were selected from each strain for self-pollination to obtain T2 generation strains; the T2 generation strains were further subjected to PCR detection to obtain two T2 generation homozygous strains derived from different T0 generation plants, which were named OEHTT6-1 and OEHTT6-2 respectively.

[0084] 2. Detection of OsHTT6 expression

[0085] Total RNA was extracted from flag leaves of wild-type N. guizhanensis, OsHTT6 mutant lines htt6-1 and htt6-2, and overexpression transgenic lines OEHTT6-1 and OEHTT6-2 at the flowering stage and reverse transcribed into cDNA. qPCR reaction was performed using the obtained cDNA as a template to detect the expression changes of the target gene OsHTT6, with Actin as the internal reference.

[0086] The primers used in the qPCR reaction are as follows:

[0087] qPCR Primer F: TCAACGAGCTCTCGCTCTG

[0088] qPCR primer R: ATGTACGGCACCACCACATC

[0089] Internal reference primer F: CACATTCCAGCAGATGTGGA

[0090] Internal reference primer R: GCGATAACAGCTCCTCTTGG

[0091] The reaction system used for qPCR reaction was: 2 μL template cDNA, 0.5 μL primer F / primer R each, 10 μL 2×SYBR GREEN Master Mix, and DEPC water to 20 μL; the reaction conditions used for qPCR reaction were: 95°C for 3 min; 95°C for 5 sec, 58°C for 10 sec, and 72°C for 15 sec.

[0092] The expression of OsHTT6 gene in OsHTT6 mutant strains, overexpression transgenic strains and wild-type Nanguizhan is shown in Figure 2. Figure 1 As shown. Figure 1 It can be seen that the OsHTT6 gene is highly expressed in the overexpression transgenic lines OEHTT6-1 and OEHTT6-2, and is lowly expressed in the mutant lines htt6-1 and htt6-2 (significantly lower than the wild type, which is only because the expression level of the OsHTT6 gene in the overexpression transgenic lines is too high. Figure 1 It is not obvious), indicating that the present invention successfully constructed the OsHTT6 mutant strain and the OsHTT6 overexpression transgenic strain.

[0093] Example 3 Detection of tolerance of mutant strains and overexpression transgenic strains to high temperature stress

[0094] In this example, the wild type Nanguizhan, the mutant strains htt6-1 and htt6-2 identified in Example 1 and Example 2, and the overexpression transgenic strains OEHTT6-1 and OEHTT6-2 were subjected to high temperature stress treatment. The effects of the mutation or overexpression of the OsHTT6 gene on the high temperature stress tolerance of rice were observed by comparing the phenotypic changes of the plants before high temperature treatment, 3 days after high temperature treatment, and 7 days after recovery to normal temperature, as well as detecting the Fv / Fm, survival rate, ion leakage and plant height (plant height) of the plants after high temperature stress treatment.

[0095] The high temperature stress treatment process is as follows:

[0096] Several plump seeds of the wild type Nanguizhan (WT), mutant strains htt6-1 and htt6-2, and overexpression transgenic strains OEHTT6-1 and OEHTT6-2 were selected and water-soaked. After the seeds germinated, they were clamped on a 96-well plate for hydroponics. After growing for 14 days, seedlings with consistent growth were selected for high temperature stress treatment. The high temperature stress treatment conditions were: 45℃, 12h light / 12h dark, and the high temperature stress treatment time was 7 days. After high temperature stress treatment, the seeds were placed at 28℃ for recovery, and the recovery time was 7 days.

[0097] Determination of ion leakage rate (R1 / R2): add 10 mL of sterilized ddH2O to a 15 mL sterilized centrifuge tube, cut 0.05 g of rice seedling leaves of equivalent size into small pieces, put them into the above 15 mL centrifuge tube, completely immerse the leaves therein, and shake at 100 rpm at room temperature overnight; after overnight, turn the 15 mL centrifuge tube upside down to mix well, and then measure it with a conductivity meter to obtain the value R1; after obtaining the value R1, put the 15 mL centrifuge tube into boiling water and boil it for 15 minutes, cool it naturally to room temperature, and measure it for the second time with a conductivity meter to obtain the value R2; the ratio of R1 to R2 is the ion leakage rate.

[0098] The phenotypes of OsHTT6 mutant strains, overexpression transgenic strains and wild-type Nanguizhan before and after high temperature stress treatment are as follows Figure 2 As shown. Figure 2 It can be seen that after 3 days of high temperature treatment and 7 days of recovery to normal temperature, the leaves of htt6-1 and htt6-2 mutant strains did not shrink or die after high temperature stress treatment, while the wild-type control and overexpression transgenic strains showed high temperature intolerance.

[0099] Chlorophyll fluorescence imaging of OsHTT6 mutant strains, overexpression transgenic strains and wild-type Nanguizhan before and after high temperature stress treatment Figure 3 The results of Fv / Fm, survival rate, ion leakage rate and plant height of OsHTT6 mutant strains, overexpression transgenic strains and wild-type Nanguizhan before and after high temperature stress treatment are shown in the figure below. Figure 4 As shown in A to D. Combined Figure 3 and Figure 4 As shown in A, compared with the wild-type control, the Fv / Fm of the OsHTT6 overexpressing transgenic line after high temperature stress treatment was significantly reduced, indicating that it is not heat-resistant. Figure 4 It can be seen that compared with the wild-type control, the survival rate of htt6-1 and htt6-2 mutant strains after high temperature stress treatment was significantly improved (p<0.001), by 13.5% and 10.4%, respectively, and the ion leakage rate was reduced by 3.5% and 2.5%, respectively. However, their Fv / Fm, ion leakage rate and plant height were not significantly different from those of the wild-type control. The OsHTT6 overexpressing transgenic strain not only had a significantly reduced Fv / Fm (p<0.001), but also a significantly reduced survival rate (p<0.001), and a significantly increased ion leakage rate (p<0.001).

[0100] The above results indicate that suppressing the expression of OsHTT6 gene by mutation can significantly improve the tolerance of rice to high temperature stress.

[0101] Example 4 Yield trait detection of mutant strains and overexpression transgenic strains

[0102] Several full seeds of the wild type Nanguizhan (WT), mutant lines htt6-1 and htt6-2, and overexpression transgenic lines OEHTT6-1 and OEHTT6-2 were selected and grown to maturity according to conventional planting and management methods, and yield traits were analyzed (single plant yield, number of primary branches, average number of effective tillers and average fruit setting rate were measured respectively).

[0103] The yield trait test results of OsHTT6 mutant strains, overexpression transgenic strains and wild-type Nanguizhan are shown in Figure 5 As shown; Figure 5A to D in the figure are the test results of single plant yield, number of primary branches, average number of effective tillers and average fruiting rate. Figure 5 It can be seen that the average fruit setting rate of the OsHTT6 mutant strain was significantly different from that of the wild-type control (p<0.05), the single plant yield, the number of primary branches and the average number of effective tillers of the OsHTT6 mutant strain were significantly different from those of the wild-type control (p<0.001), and the single plant yield of the htt6-1 and htt6-2 mutant strains increased by 12.0g and 12.6g respectively compared with the wild-type.

[0104] The above results indicate that suppressing the expression of the OsHTT6 gene by mutation can significantly increase the number of primary branches, average number of effective tillers, average fruit setting rate and yield per plant of rice, thereby increasing rice yield.

[0105] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Application of OsHTT6 protein or a gene encoding OsHTT6 protein in regulating the tolerance of rice to high temperature stress, characterized in that: The amino acid sequence of the OsHTT6 protein is shown in SEQ ID NO.

3.

2. Application of OsHTT6 protein or a gene encoding OsHTT6 protein in regulating rice yield, characterized in that: The amino acid sequence of the OsHTT6 protein is shown in SEQ ID NO.

3.

3. The use according to claim 1 or 2, characterized in that: The nucleotide sequence of the gene encoding the OsHTT6 protein is shown in SEQ ID NO.

2.

4. A method for improving the tolerance and / or yield of rice to high temperature stress, characterized in that: The expression of OsHTT6 protein in rice is inhibited, and the amino acid sequence of the OsHTT6 protein is shown in SEQ ID NO.

3.

5. The method according to claim 4, characterized in that: The expression of the OsHTT6 protein in rice is inhibited by interfering with the expression of the gene encoding the OsHTT6 protein, or by mutating or knocking out the coding region or promoter of the gene encoding the OsHTT6 protein.

6. The method according to claim 5, characterized in that: The expression of the gene encoding the OsHTT6 protein is interfered with by RNA interference technology; or the coding region or promoter of the gene encoding the OsHTT6 protein is mutated by a gene editing system; or the gene sequence encoding the OsHTT6 protein is knocked out by homologous recombination to inhibit the expression of the OsHTT6 protein in rice.

7. Use of an agent for inhibiting the expression of OsHTT6 protein in improving the tolerance of rice to high temperature stress or in preparing a product for improving the tolerance of rice to high temperature stress, characterized in that: The amino acid sequence of the OsHTT6 protein is shown in SEQ ID NO.

3.

8. Use of an agent for inhibiting the expression of OsHTT6 protein in cultivating rice plants with improved tolerance to high temperature stress, characterized in that: The amino acid sequence of the OsHTT6 protein is shown in SEQ ID NO.

2.

9. Use of an agent for inhibiting the expression of OsHTT6 protein in increasing rice yield or in preparing a product for increasing rice yield, characterized in that: The amino acid sequence of the OsHTT6 protein is shown in SEQ ID NO.

3.

10. Use of an agent for inhibiting the expression of OsHTT6 protein in cultivating rice plants with increased yield, characterized in that: The amino acid sequence of the OsHTT6 protein is shown in SEQ ID NO.3.

Images