Method for improving heat resistance of wheat by editing TaTT3.2 gene

Abstract

The invention discloses a method for improving heat resistance of wheat by editing a TaTT3.2 gene. According to the invention, the constructed expression vector pBUE411-TT32 with the function of knocking out the TaTT3.2 gene is transferred into the wheat, and the expression of the TaTT3.2 gene in the wheat is silenced, so that a wheat plant with higher heat resistance can be obtained. A wheat gene editing system is utilized, genome level TaTT3.2 gene silencing can be achieved through a gene transformation process, and the method is a powerful tool for silencing the TaTT3.2 gene through a gene engineering technology. Meanwhile, three copies of the TaTT3.2 gene are silenced, so that researchers can be helped to create new wheat germplasm with higher heat resistance by utilizing the mutant, and candidate genes and heat-resistant germplasm resources are provided for wheat breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for improving the heat resistance of wheat by knocking out the TaTT3.2 gene, and the development of a heat resistance molecular marker thereof. Background Art

[0002] Global warming seriously threatens food security worldwide by reducing crop productivity and quality. It is predicted that wheat yields will drop by about 6% for every 1°C above the optimum temperature, and heat stress has caused a 5.5% reduction in global wheat production over the past three decades. Common wheat is a typical cool-loving crop, and its growth and development are extremely susceptible to high temperature stress. Wheat heat tolerance is a quantitative trait controlled by multiple genes and is easily affected by environmental factors. It is difficult to breed high-temperature resistant varieties in a short period of time through traditional breeding methods. Therefore, we can analyze the molecular regulatory network of wheat heat response, find some key heat-resistant genes, and accelerate the breeding of new wheat varieties that are resistant to high temperatures, high yields, and high quality through transgenic and other technologies combined with traditional breeding to meet the severe challenges brought about by global warming and population growth.

[0003] In 2022, Lin Hongxuan's research team discovered that TT3.2 is an unknown transmembrane protein that contains a chloroplast transit peptide. Under heat stress conditions, the accumulation of TT3.2 in chloroplasts is harmful to the PSII complex and thylakoids, while the degradation of TT3.2 protects the thylakoids from heat stress damage. Knocking out the OsTT3.2 gene in rice enhances the heat tolerance of rice and reduces yield losses caused by heat stress, with a significantly higher yield than the wild type. Therefore, this gene can be used to breed heat-resistant varieties of cereal crops. However, the function of this gene in wheat has not been reported.

[0004] Wheat is an allohexaploid crop, consisting of three sets of genomes, A, B and D. The homologous genes of these three sets of genomes have high homology. Only when these homologous genes mutate at the same time can gene knockout mutants be obtained. Using the CRISPR / Cas9 (Clustered regularly interspaced short palindromicrepeats) / (CRISPR-associated 9) editing system, sgRNA is designed according to the conserved regions between homologous genes, and all homologous genes of wheat can be knocked out at the same time. Using this system to knock out the TaTT3.2 gene of wheat to create heat-resistant wheat germplasm resources will have important guiding significance for heat-resistant wheat breeding. Summary of the invention

[0005] The present invention uses a wheat gene editing system to provide a method for improving wheat heat tolerance by editing three homologous genes of TaTT3.2, and develops a molecular marker for detecting target site mutations. The present invention is to transfer the constructed expression vector pBUE411-TT32 with a knockout TaTT3.2 gene into wheat, silence the expression of the TaTT3.2 gene in wheat, and obtain heat-resistant wheat plants.

[0006] A method for improving heat tolerance in wheat by editing the TaTT3.2 gene, thereby reducing or silencing the expression of the wheat TaTT3.2 gene in wheat.

[0007] Furthermore, the wheat TaTT3.2 gene in the above method is located on 4A, 4B and 4D of chromosome 4 in wheat, named TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D, respectively. The nucleotide sequences of TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0008] Furthermore, the above method of simultaneously reducing or silencing the expression of TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D genes in wheat specifically comprises the following steps:

[0009] 1. Design and synthesize sgRNAs targeting TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D genes;

[0010] 2. Connect the synthetic sgRNA to the pBUE411 vector to construct the pBUE411-TT32 binary vector with the function of simultaneously knocking out wheat TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D genes;

[0011] 3. The binary vector obtained in step 2) is transformed into plants by Agrobacterium-mediated transformation to reduce or silence the expression of wheat TaTT3.2 gene, thereby obtaining wheat plants with high heat resistance.

[0012] Furthermore, the nucleotide sequences of the two sgRNAs of the TaTT3.2 gene described in step 1) of the above method are respectively shown in SEQ ID NO: 4.

[0013] Furthermore, the pBUE411-TT32 binary vector having the function of knocking out the wheat TaTT3.2 gene described in step 2) above comprises an expression cassette A and an expression cassette B;

[0014] The expression cassette A specifically includes the following elements from upstream to downstream: the TaU3 promoter A from wheat, the sgRNA of the TaTT3.2 gene and the terminator A;

[0015] The expression cassette B specifically includes the following elements from upstream to downstream: the promoter B, the corn Cas9 coding sequence, and the terminator B.

[0016] Furthermore, the corn Cas9 coding sequence is shown in SEQ ID NO: 5; the sequence of the promoter A is shown in SEQ ID NO: 6; the sequence of the promoter B is shown in SEQ ID NO: 7; the sequence of the terminator A is shown in SEQ ID NO: 8; and the sequence of the terminator B is shown in SEQ ID NO: 9.

[0017] Furthermore, the expression cassette A is located upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.

[0018] Furthermore, the pBUE411-TT32 binary vector also contains a resistance marker gene, such as a bar gene; the nucleotide sequence of the pBUE411-TT32 binary vector is as follows:

[0019] >Vector

[0020] Gtaaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatcc

[0021] aagctcaagctgctctagcattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctgg

[0022] cgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagct

[0023] tcatgaatccaaaccacacggagttcaaattcccacagattaaggctcgtccgtcgcacaaggtaatgtgtgaatattatatctgtcgtgc

[0024] aaaattgcctggcctgcacaattgctgttatagttggcggcagggagagttttaacattgactagcgtgctgataatttgtgagaaataat

[0025] aattgacaagtagatactgacatttgagaagagcttctgaactgttattagtaacaaaaatggaaagctgatgcacggaaaaaggaaagaa

[0026] aaagccatacttttttttaggtaggaaaagaaaaagccatacgagactgatgtctctcagatgggccgggatctgtctatctagcaggcag

[0027] cagcccaccaacctcacgggccagcaattacgagtccttctaaaagctcccgccgaggggcgctggcgctgctgtgcagcagcacgtctaa

[0028] cattagtcccacctcgccagtttacagggagcagaaccagcttataagcggaggcgcggcaccaagaagcggcgagatcctcgagcggcga

[0029] gcacttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttttcg

[0030] ttttgcattgagttttctccgtcgcatgtttgcagttttattttccgttttgcattgaaatttctccgtctcatgtttgcagcgtgttcaa

[0031] aaagtacgcagctgtatttcacttatttacggcgccacattttcatgccgtttgtgccaactatcccgagctagtgaatacagcttggctt

[0032] cacacaacactggtgacccgctgacctgctcgtacctcgtaccgtcgtacggcacagcatttggaattaaagggtgtgatcgatactgctt

[0033] gctgctaagcttgcatgcctgcagtgcagcgtgacccggtcgtgcccctctctgagataatgagcattgcatgtctaagttataaaaaat

[0034] taccacatattttttttgtcacacttgtttgaagtgcagtttatctatctttatacatatatttaaactttactctacgaataatataatc

[0035] tatagtactacaataatatcagtgttttagagaatcatataaatgaacagttagacatggtctaaaggacaattgagtattttgacaacag

[0036] gactctacagttttatctttttagtgtgcatgtgttctcctttttttttgcaaatagcttcacctatataatacttcatccattttattag

[0037] tacatccatttagggtttagggttaatggtttttatagactaatttttttagtacatctattttattctattttagcctctaaattaagaa

[0038] aactaaaactctattttagtttttttatttaatttagatataaaaatagaataaaataaagtgactaaaaattaaacaaatacccttta

[0039] agaaattaaaaaaactaaggaaacatttttcttgtttcgagtagataatgccagcctgttaaacgccgtcgacgagtctaacggacaccaa

[0040] ccagcgaaccagcagcgtcgcgtcgggccaagcgaagcagacggcacggcatctctgtcgctgcctctggacccctctcgagagttccgct

[0041] ccaccgttggacttgctccgctgtcggcatccagaaattgcgtggcggagcggcagacgtgagccggcacggcaggcggcctcctcctcct

[0042] ctcacggcacggcagctacgggggattcctttcccaccgctccttcgctttcccttcctcgcccgccgtaataaatagacaccccctccac

[0043] accctctttccccaacctcgtgttgttcggagcgcacacacacacaaccagatctcccccaaatccacccgtcggcacctccgcttcaagg

[0044] tacgccgctcgtcctccccccccccccctctctaccttctctagatcggcgttccggtccatggttagggcccggtagttctacttctgtt

[0045] catgtttgtgttagatccgtgtttgtgttagatccgtgctgctagcgttcgtacacggatgcgacctgtacgtcagacacgttctgattgc

[0046] taacttgccagtgtttctctttggggaatcctgggatggctctagccgttccgcagacgggatcgatttcatgattttttttgtttcgttg

[0047] catagggtttggtttgcccttttcctttatttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgcttttttttgtcttggt

[0048] tgtgatgatgtggtctggttgggcggtcgttctagatcggagtagaattctgtttcaaactacctggtggatttattaattttggatctgt

[0049] atgtgtgtgccatacatattcatagttacgaattgaagatgatggatggaaatatcgatctaggataggtatacatgttgatgcgggtttt

[0050] actgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttctagatcggagtag

[0051] aatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtcatacatcttcatagttacgagtttaagatggatg

[0052] gaaatatcgatctaggataggtatacatgttgatgtgggttttactgatgcatatacatgatggcatatgcagcatctattcatatgctct

[0053] aaccttgagtacctatctattataataaacaagtatgttttataattattttgatcttgatatacttggatgatggcatatgcagcagcta

[0054] tatgtggatttttttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgttac

[0055] ttctgcagccctaggcctactagatggattacaaggaccacgacggggattacaaggaccacgacattgattacaaggatgatgatgacaa

[0056] gatggctccgaagaagaagagaagggttggcatccacggggtgccagctgctgacaagaagtctcgatcggcctcgatattgggactac

[0057] tctgttggctgggccgtgatcaccgacgagtacaaggtgccctcaaagaagttcaaggtcctgggcaacaccgatcggcattccatcaaga

[0058] agaatctcattggcgctctcctgttcgacagcggcgagacggctgaggctacgcggctcaagcgcaccgcccgcaggcggtacacgcgcag

[0059] gaagaatcgcatctgctacctgcaggagagattttctccaacgagatggcgaaggttgacgattctttcttccacaggctggaggagtcattc

[0060] ctcgtggaggagataagaagcacgagcggcatccaatcttcggcaacattgtcgacgaggttgcctaccacgagaagtaccctacgatct

[0061] accatctgcggaagaagctcgtggactccacagataaggcggacctccgcctgatctacctcgctctgggcccacatgattaagttcagggg

[0062] ccatttcctgatcgaggggatctcaacccggacaatagcgatgttgacaagctgttcatccagctcgtgcagacgtacaaccagctcttc

[0063] gaggaaccccattaatgcgtcaggcgtcgacgcgaaggctatcctgtccgctaggctctcgaagtctcggcgctcgagaacctgatcg

[0064] cccagctgccgggcgagaagaagaacggcctgttcgggaatctcattgcgctcagcctggggctcacgcccaacttcaagtcgaatttcga

[0065] tctcgctgaggacgccaagctgcagctctccaaggacacatacgacgatgacctggataacctcctggcccagatcggcgatcagtacgcg

[0066] gacctgttcctcgctgccaagaatctgtcggacgccatcctcctgtctgatattctcagggtgaacaccgagattacgaaggctccgctct

[0067] cagcctccatgatcaagcgctacgacgagcaccatcaggatctgaccctcctgaaggcgctggtcaggcagcagctccccgagaagtacaa

[0068] ggagatcttcttcgatcagtcgaagaacggctacgctgggtacattgacggcggggcctctcaggaggagttctacaagttcatcaagccg

[0069] attctggagaagatggacggcacggaggagctgctggtgaagctcaatcgcgaggacctcctgaggaagcagcggacattcgataacggca

[0070] gcatcccacaccagattcatctcggggagctgcacgctatcctgaggaggcaggaggacttctaccctttcctcaaggataaccgcgagaa

[0071] gatcgagaagattctgactttcaggatcccgtactacgtcggcccactcgctaggggcaactcccgcttcgcttggatgacccgcaagtca

[0072] gaggagacgatcacgccgtggaacttcgaggaggtggtcgacaagggcgctagcgctcagtcgttcatcgagaggatgacgaatttcgaca

[0073] agaacctgccaaatgagaaggtgctccctaagcactcgctcctgtacgagtacttcacagtctacaacgagctgactaaggtgaagtatgt

[0074] gaccgagggcatgaggaagccggctttcctgtctggggagcagaagaaggccatcgtggacctcctgttcaagaccaaaccggaaggtcacg

[0075] gttaagcagctcaaggagactacttcaagaagaattgagtgcttcgattcggtcgagatctctggcgttgaggaccgcttcaacgcctccc

[0076] tggggacctaccacgatctcctgaagaatcattaaggataggacttcctggacaacgagagaatgagatatcctcgaggacattgtgct

[0077] gacactcactctgttcgaggaccgggagatgatcgaggagcgcctgaagacttacgcccatctcttcgatgacaaggtcatgaagcagctc

[0078] aagaggaggaggtacaccggctgggggaggctgagcaggaagctcatcaacggcattcgggacaagcagtccgggaagacgatcctcgact

[0079] tcctgaagagcgatggcttcgcgaaccgcaatttcatgcagctgattcacgatgacagcctcacattcaaggaggatatccagaaggctca

[0080] ggtgagcggccagggggactcgctgcacgagcatatcgcgaacctcgctggctcgccagctatcaagaaggggattctgcagaccgtgaag

[0081] gttgtggacgagctggtgaaggtcatgggcaggcacaagcctgagaacatcgtcattgagatggcccgggagaatcagaccacgcagaagg

[0082] gccagaagaactcacgcgagaggatgaagaggatcgaggagggcattaaggagctggggtcccagatcctcaaggagcacccggtggagaa

[0083] cacgcagctgcagaatgagaagctctacctgtactacctccagaatggccgcgatatgtatgtggaccaggagctggatattaacaggctc

[0084] agcgattacgacgtcgatcatatcgttccacagtcattcctgaaggatgactccattgacaacaaggtcctcaccaggtcggacaagaacc

[0085] ggggcaagtctgataatgttccttcagaggaggtcgttaagaagatgaagaactactggcgccagctcctgaatgccaagctgatcacgca

[0086] gcggaagttcgataacctcacaaaggctgagaggggcgggctctctgagctggacaaggcgggcttcatcaagaggcagctggtcgagaca

[0087] cggcagatcactaagcacgttgcgcagattctcgactcacggatgaacactaagtacgatgagaatgacaagctgatccgcgaggtgaagg

[0088] tcatcaccctgaagtcaaagctcgtctccgacttcaggagatttccagttctacaaggttcgggagatcaacaattaccaccatgccca

[0089] tgacgcgtacctgaacgcggtggtcggcacagctctgatcaagaagtcccaaagctcgagagcgagttcgtgtacggggactacaaggtt

[0090] tacgatgtgaggaagatgatcgccaagtcggagcaggagattggcaaggctaccgccaagtacttcttctactctaacattatgaatttct

[0091] tcaagacagagatcactctggccaatggcgagatccggaagcgccccctcatcgagacgaacggcgagacggggagagatcgtgtgggacaa

[0092] gggcagggatttcgcgaccgtcaggaaggttctctccatgccacaagtgaatatcgtcaagaagacagaggtccagactggcgggttctct

[0093] aaggtcaattctgcctaagcggaacagcgacaagctcatcgcccgcaagaaggactgggatccgaagaagtcggggttcgacagcc

[0094] ccactgtggcctactcggtcctggttgtggcgaaggttgagaagggcaagtccaagaagctcaagagcgtgaaggagctgctggggatcac

[0095] gattatggagcgctccagcttcgaagaagaacccgatcgatttcctggaggcgaagggctacaaggaggtgaagaagcctgattcattaag

[0096] ctccccaagtactcactcttcgagctggagaacggcaggaagcggatgctggcttccgctggcgagctgcagaaggggaacgagctggctc

[0097] tgccgtccaagtatgtgaacttcctctacctggcctcccactacgagaagctcaagggcagccccgaggacaacgagcagaagcagctgtt

[0098] cgtcgagcagcacaagcattacctcgacgagatcattgagcagatttccgagttctccaagcgcgtgatcctggccgacgcgaatctggat

[0099] aaggtcctctccgcgtacaacaagcaccgcgacaagccaatcagggagcaggctgagaatatcattcatctcttcaccctgacgaacctcg

[0100] gcgcccctgctgctttcaagtacttcgacacaactatcgatcgcaagaggtacacaagcactaaggaggtcctggacgcgaccctcatcca

[0101] ccagtcgattaccggcctctacgagacgcgcatcgacctgtctcagctcgggggcgacaagcggccagcggcgacgaagaaggcggggcag

[0102] gcgaagaagaagaagtgagctcagagctttcgttcgtatcatcggtttcgacaacgttcgtcaagttcaatgcatcagtttcattgcgcac

[0103] acaccagaatcctactgagtttgagtattatggcattgggaaaactgtttttcttgtaccatttgttgtgcttgtaatttactgtgttttt

[0104] tattcggttttcgctatcgaactgtgaaatggaaatggatggagaagagttaatgaatgatatggtccttttgttcattctcaaattaata

[0105] ttatttgttttttctcttatttgttgtgtgttgaatttgaaattataagagatatgcaaacattttgttttgagtaaaaatgtgtcaaatc

[0106] gtggcctctaatgaccgaagttaatatgaggagtaaaacacttgtagttgtaccattatgcttattcactaggcaacaaatatattttcag

[0107] acctagaaaagctgcaaatgttactgaatacaagtatgtcctcttgtgttttagacatttatgaactttcctttatgtaattttccagaat

[0108] ccttgtcagattctaatcattgctttataattatagttatactcatggatttgtagttgagtatgaaaatattttttaatgcattttatga

[0109] cttgccaattgattgacaacgaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatac

[0110] gagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtc

[0111] gggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattggctagagcagcttgccaacatgg

[0112] tggagcacgacactctcgtctactccaagaatatcaaagatacagtctcagaagaccaaagggctattgagacttttcaacaaagggtaat

[0113] atcgggaaacctcctcggattccattgcccagctatctgtcacttcatcaaaaggacagtagaaaaggaaggtggcacctacaaatgccat

[0114] cattgcgataaaggaaaggctatcgttcaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaa

[0115] aagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgataacatggtggagcacgacactctcgtctactccaagaatatcaa

[0116] agatacagtctcagaagaccaaagggctattgagacttttcaacaaagggtaatatcgggaaacctcctcggattccattgcccagctatc

[0117] tgtcacttcatcaaaaggacagtagaaaaggaaggtggcacctacaaatgccatcattgcgataaaggaaaggctatcgttcaagatgcct

[0118] ctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtgga

[0119] ttgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagaccttcctctatataaggaagttcatttcatt

[0120] tggagaggacacgctgaaatcaccagtctctctctacaaatctatctctctcgagtctaccatgagcccagaacgacgcccggccgacatc

[0121] cgccgtgccaccgaggcggacatgccggcggtctgcaccatcgtcaaccactacatcgagacaagcacggtcaacttccgtaccgagccgc

[0122] aggaaccgcaggagtggacggacgacctcgtccgtctgcgggagcgctatccctggctcgtcgccgaggtggacggcgaggtcgccggcat

[0123] cgcctacgcgggcccctggaaggcacgcaacgcctacgactggacggccgagtcgaccgtgtacgtctccccccgccaccagcggacggga

[0124] ctgggctccacgctctacacccacctgctgaagtccctggaggcacagggcttcaagagcgtggtcgctgtcatcgggctgcccaacgacc

[0125] cgagcgtgcgcatgcacgaggcgctcggatatgccccccgcggcatgctgcgggcggccggcttcaagcacgggaactggcatgacgtggg

[0126] tttctggcagctggacttcagcctgccggtaccgccccgtccggtcctgcccgtcaccgagatttgactcgagtttctccataataatgtg

[0127] tgagtagttcccagataagggaattagggttcctatagggtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtattt

[0128] gtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtactaaaatccagatcccccgaattaattcggcgttaattc

[0129] agtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaaca

[0130] gctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccgggacggcgtcagcgggagagccgttgtaagg

[0131] cggcagactttgctcatgttaccgatgctattcggaagaacggcaactaagctgccgggtttgaaacacggatgatctcgcggagggtagc

[0132] atgttgattgtaacgatgacagagcgttgctgcctgtgatcaccgcggtttcaaaatcggctccgtcgatactatgttatacgccaacttt

[0133] gaaaacaactttgaaaaagctgttttctggtatttaaggttttagaatgcaaggaacagtgaattggagttcgtcttgttataattagctt

[0134] cttggggtatctttaaatactgtagaaaagaggaaggaaataataaatggctaaaatgagaatatcaccggaattgaaaaaactgatcgaa

[0135] aaataccgctgcgtaaaagatacggaaggaatgtctcctgctaaggtatataagctggtgggagaaaatgaaaacctatatttaaaaatga

[0136] cggacagccggtataaagggaccacctatgatgtggaacgggaaaaggacatgatgctatggctggaaggaaagctgcctgttccaaaggt

[0137] cctgcactttgaacggcatgatggctggagcaatctgctcatgagtgaggccgatggcgtcctttgctcggaagagtatgaagatgaacaa

[0138] agccctgaaaagattatcgagctgtatgcggagtgcatcaggctctttcactccatcgacatatcggattgtccctatacgaatagcttag

[0139] acagccgcttagccgaattggattacttactgaataacgatctggccgatgtggattgcgaaaactgggaagaagacactccatttaaaga

[0140] tccgcgcgagctgtatgattttttaaagacggaaaagcccgaagaggaacttgtcttttcccacggcgacctgggagacagcaacatcttt

[0141] gtgaaagatggcaaagtaagtggctttattgatcttgggagaagcggcagggcggacaagtggtatgacattgccttctgcgtccggtcga

[0142] tcagggaggatatcggggaagaacagtatgtcgagctattttttgacttactggggatcaagcctgattgggagaaaataaaatattatat

[0143] tttactggatgaattgttttagtacctagaatgcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaa

[0144] aagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtt

[0145] tgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgta

[0146] gttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataag

[0147] tcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagct

[0148] tggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggta

[0149] tccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgc

[0150] cacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcc

[0151] tggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctga

[0152] taccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcat

[0153] ctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgct

[0154] acgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacaga

[0155] caagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagggtgccttgatgtgggcgc

[0156] cggcggtcgagtggcgacggcgcggcttgtccgcgccctggtagattgcctggccgtaggccagccatttttgagcggccagcggccgcga

[0157] taggccgacgcgaagcggcggggcgtagggagcgcagcgaccgaagggtaggcgctttttgcagctcttcggctgtgcgctggccagacag

[0158] ttatgcacaggccaggcgggttttaagagttttaataagttttaaagagttttaggcggaaaaatcgccttttttctcttttatatcagtc

[0159] acttacatgtgtgaccggttcccaatgtacggctttgggttcccaatgtacgggttccggttcccaatgtacggctttgggttcccaatgt

[0160] acgtgctatccacaggaaacagaccttttcgacctttttcccctgctagggcaatttgccctagcatctgctccgtacattaggaaccggc

[0161] ggatgcttcgccctcgatcaggttgcggtagcgcatgactaggatcgggccagcctgccccgcctcctccttcaaatcgtactccggcagg

[0162] tcatttgacccgatcagcttgcgcacggtgaaacagaacttcttgaactctccggcgctgccactgcgttcgtagatcgtcttgaacaacc

[0163] atctggcttctgccttgcctgcggcgcggcgtgccaggcggtagagaaaacggccgatgccgggatcgatcaaaaagtaatcggggtgaac

[0164] cgtcagcacgtccgggttcttgccttctgtgatctcgcggtacatccaatcagctagctcgatctcgatgtactccggccgcccggtttcg

[0165] ctctttacgatcttgtagcggctaatcaaggcttcaccctcggataccgtcaccaggcggccgttcttggccttcttcgtacgctgcatgg

[0166] caacgtgcgtggtgtttaaccgaatgcaggtttctaccaggtcgtctttctgctttccgccatcggctcgccggcagaacttgagtacgtc

[0167] cgcaacgtgtggacggaacacgcggccgggcttgtctcccttcccttcccggtatcggttcatggattcggttagatgggaaaccgccatc

[0168] agtaccaggtcgtaatcccacacactggccatgccggccggccctgcggaaacctctacgtgcccgtctggaagctcgtagcggatcacct

[0169] cgccagctcgtcggtcacgcttcgacagacggaaaacggccacgtccatgatgctgcgactatcgcgggtgcccacgtcatagagcatcgg

[0170] aacgaaaaaatctggttgctcgtcgcccttgggcggcttcctaatcgacggcgcaccggctgccggcggttgccgggattctttgcggatt

[0171] cgatcagcggccgcttgccacgattcaccggggcgtgcttctgcctcgatgcgttgccgctgggcggcctgcgcggccttcaacttctcca

[0172] ccaggtcatcacccagcgccgcgccgatttgtaccgggccggatggtttgcgaccgctcacgccgattcctcgggcttgggggttccagtg

[0173] ccattgcagggccggcagacaacccagccgcttacgcctggccaaccgcccgttcctccacacatggggcattccacggcgtcggtgcctg

[0174] gttgttcttgattttccatgccgcctcctttagccgctaaaattcatctactcatttattcatttgctcatttactctggtagctgcgcga

[0175] tgtattcagatagcagctcggtaatggtcttgccttggcgtaccgcgtacatcttcagcttggtgtgatcctccgccggcaactgaaagtt

[0176] gacccgcttcatggctggcgtgtctgccaggctggccaacgttgcagccttgctgctgcgtgcgctcggacggccggcacttagcgtgttt

[0177] gtgcttttgctcattttctctttacctcattaactcaaatgagttttgatttaatttcagcggccagcgcctggacctcgcgggcagcgtc

[0178] gccctcgggttctgattcaagaacggttgtgccggcggcggcagtgcctgggtagctcacgcgctgcgtgatacgggactcaagaatgggc

[0179] agctcgtacccggccagcgcctcggcaacctcaccgccgatgcgcgtgcctttgatcgcccgcgacacgacaaaggccgcttgtagccttc

[0180] catccgtgacctcaatgcgctgcttaaccagctccaccaggtcggcggtggcccatatgtcgtaagggcttggctgcaccggaatcagcac

[0181] gaagtcggctgccttgatcgcggacacagccaagtccgccgcctggggcgctccgtcgatcactacgaagtcgcgccggccgatggccttc

[0182] acgtcgcggtcaatcgtcgggcggtcgatgccgacaacggttagcggttgatcttcccgcacggccgcccaatcgcgggcactgccctggg

[0183] gatcggaatcgactaacagaacatcggccccggcgagttgcagggcgcgggctagatgggttgcgatggtcgtcttgcctgacccgccttt

[0184] ctggttaagtacagcgataaccttcatgcgttccccttgcgtatttgtttatttactcatcgcatcatatacgcagcgaccgcatgacgca

[0185] agctgttttactcaaatacacatcacctttttagacggcggcgctcggtttcttcagcggccaagctggccggccaggccgccagcttggc

[0186] atcagacaaaccggccaggatttcatgcagccgcacggttgagacgtgcgcgggcggctcgaacacgtacccggccgcgatcatctccgcc

[0187] tcgatctcttcggtaatgaaaaacggttcgtcctggccgtcctggtgcggtttcatgcttgttcctcttggcgttcattctcggcggccgc

[0188] cagggcgtcggcctcggtcaatgcgtcctcacggaaggcaccgcgccgcctggcctcggtgggcgtcacttcctcgctgcgctcaagtgcg

[0189] cggtacagggtcgagcgatgcacgccaagcagtgcagccgcctctttcacggtgcggccttcctggtcgatcagctcgcgggcgtgcgcga

[0190] tctgtgccggggtgagggtagggcgggggccaaacttcacgcctcgggccttggcggcctcgcgcccgctccgggtgcggtcgatgattag

[0191] ggaacgctcgaactcggcaatgccggcgaacacggtcaacaccatgcggccggccggcgtggtggtgtcggcccacggctctgccaggcta

[0192] cgcaggcccgcgccggcctcctggatgcgctcggcaatgtccagtaggtcgcgggtgctgcgggccaggcggtctagcctggtcactgtca

[0193] caacgtcgccagggcgtaggtggtcaagcatcctggccagctccgggcggtcgcgcctggtgccggtgatcttctcggaaaacagcttggt

[0194] gcagccggccgcgtgcagttcggcccgttggttggtcaagtcctggtcgtcggtgctgacgcgggcatagcccagcaggccagcggcggcg

[0195] ctcttgttcatggcgtaatgtctccggttctagtcgcaagtattctactttatgcgactaaaacacgcgacaagaaaacgccaggaaaagg

[0196] gcagggcggcagcctgtcgcgtaacttaggacttgtgcgacatgtcgttttcagaagacggctgcactgaacgtcagaagccgactgcact

[0197] atagcagcggaggggttggatcaaagtactttgatcccgaggggaaccctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgttattctaa。

[0198] The present invention constructs an expression vector that can realize the in vivo editing of three partially homologous genes TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D by designing a specific single-stranded sgRNA, and can knock out three copies of the wheat TaTT3.2 gene at the same time. The TaTT3.2 gene is located on 4A, 4B and 4D of chromosome 4 in wheat, and is named TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D respectively. The full length of its genome sequence on 4A, 4B and 4D is 2574, 2382 and 2563 bases respectively, and these three partially homologous genes are composed of 8 exons and 7 introns. TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D contain open reading frames of 1323, 1311 and 1323 bases, respectively, encoding a polypeptide chain containing 441, 437 and 441 amino acid residues, respectively. The coding regions of the three partially homologous genes TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D are very similar, which provides a theoretical basis for using gene editing technology to simultaneously silence the above three genomic sites.

[0199] Beneficial effects:

[0200] In practical applications, the silencing of the TaTT3.2 gene at the genome level can be achieved through a gene transformation process, which is a powerful tool for silencing the TaTT3.2 gene using genetic engineering technology. Silencing the three partial homologous genes of TaTT3.2 at the same time can improve the heat tolerance of wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0201] Figure 1 .The deduced amino acid sequence of the wild-type wheat TaTT3.2 gene.

[0202] Figure 2 .The deduced amino acid sequence of the mutant wheat tt3.2 gene.

[0203] Figure 3 .Target site mutation type of mutant tt3.2 gene. The numbers in the third column are the reads of hitom sequencing.

[0204] Figure 4 .Heat treatment phenotype of tt3.2 mutant at seedling stage.

[0205] Figure 5 .The phenotype of the tt3.2 mutant after dry hot wind.

[0206] Figure 6 .Yield phenotype of tt3.2 mutant after dry hot wind. DETAILED DESCRIPTION

[0207] In order to enable those skilled in the art to better understand the technical solutions in the present application, the present invention is further described below in conjunction with embodiments. The described embodiments are only a part of the embodiments of the present application, not all of them, and the present invention is not limited to the following embodiments.

[0208] The following examples are convenient for better understanding of the present invention, but they are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged. The high-fidelity enzyme required for PCR amplification, the T4 ligase required for DNA fragment ligation, the gel recovery kit required for enzyme fragment recovery, and the plasmid extraction kit were all purchased from Dalian Bao Biotechnology Company. The plasmid extraction kit was purchased from Tiangen Biology, the inorganic salts required for culture medium preparation were purchased from Sinopharm Group, and vitamins, antibiotics, and hormones were purchased from Sigma. The plant CRISPR / Cas9 gene editing vector is pBUE411, which contains the wheat U3 promoter TaU3 to initiate sgRNA. Cas9p simulates the characteristics of the 5'-end GC content of the grass plant gene, and is a designed and synthesized plant optimized codon gene. The Escherichia coli strain used in this laboratory is E.coli DH5α.

[0209] T4 ligase, DNA Marker DL2000 and other reagents were purchased from Takara; FastPfu, 2*Taq Mix, DH5α and others were purchased from Beijing Quanshijin Company; restriction endonuclease BsaI-HF was purchased from NEB Company; the primers used were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd., and the sequences are as follows:

[0210] Table 1 Primers used in this study

[0211]

[0212] The wheat variety JW1 is a new germplasm with good tissue culture ability bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences. It is available to the public from the Crop Research Institute of Shandong Academy of Agricultural Sciences.

[0213] Plasmid pBUE411 (17430 bp) was provided by Sun Qixin's research group at China Agricultural University; it is available to the public from China Agricultural University.

[0214] Experimental Example 1 Construction of expression vector

[0215] 1. Design of sgRNA targeting TaTT3.2 gene

[0216] A suitable targeting site was found in the coding region of the TaTT3.2 gene using the website CRISPRdirect (http: / / crispr.dbcls.jp / ). A 20 bp sequence fragment was found before the PAM structure and set as the target sequence. The sgRNA sequence of TaTT3.2 was selected as CCG GTGCTCGCCGCTCGAGGAT.

[0217] 2. Linearization of pBUE411 vector

[0218] The pBUE411 vector was digested with BsaI endonuclease, and the pBUE411 vector was connected to the sgRNA. The connection reaction system was: 5×ligation Buffer 2μL, annealed oligo duplex 4μL, pBUE411 / BsaI 2ul (100ng), T4 ligase 1μL, ddH2O supplemented to 10μL, and the connection reaction was carried out at 25℃ for 30min.

[0219] 3. Conversion Verification

[0220] The ligation product was transformed into E. coli, and the recombinant plasmid was transformed into DH5α competent cells. After that, the cells were cultured on LB (kan) plates until clones grew out. Single clones were selected for bacterial liquid PCR identification and sequencing. The primers used were pBUE411-F and pBUE411-R (Table 1). TaU3 promoter sequence and sgRNA sequence were detected upstream of the target sequence, indicating that the sgRNA expression cassette was successfully constructed and successfully assembled into the pBUE411 binary expression vector, proving that the CRISPR / Cas9 gene editing vector of pBUE411-TT32 was successfully constructed.

[0221] Experimental Example 2 Transformation of Gene Editing Vector into Common Wheat

[0222] 1. Culture medium preparation: see Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol. 1223 DOI 10.007 / 978-1-4939-1695-5_15, Spring Science + Business Media New York 2015

[0223] 2. Agrobacterium transformation: Take wheat ears that have been pollinated for about 15 days, and remove the embryos from the grains. Shake the Agrobacterium suspension the day before the experiment, and culture it at 160r and 28 degrees for 24 hours. After the ears are ready, start preparing the Agrobacterium suspension. Take 1ml of the bacterial solution in a 1.5ml centrifuge tube, add 1.4ul of acetosyringone (0.1M) and mix well. Add the prepared bacterial solution and infect for 5 minutes, then place it on the co-cultivation medium and culture it in the dark at 23 degrees for 3 days. After co-cultivation, place it on the resting medium and culture it in the dark at 25 degrees for 5 days. Transfer the callus to the screening medium 1. Seal the culture dish with a sealing film and culture it in the dark in a 25.5-degree incubator for 2 weeks. Cut the callus and transfer it to the screening medium 2.

[0224] Seal the culture dish with a sealing film and culture it in a dark incubator at 25.5 degrees for 2 weeks. After 2 weeks of callus cutting and screening, calli showing resistance are transferred to the regeneration medium. Resistant calli generally have green buds or green spots, or beautiful beige spherical structures.

[0225] Mushy and brown callus should not be transferred. Callus with proliferation can be cut into smaller callus. Small pieces from the same callus should be placed on the same line again. Pay attention to the direction of the callus, for example, green buds and green spots facing up.

[0226] Seal the culture dish and place it in a 25-degree incubator for 2 weeks under light (16 hours). After 2 weeks of regeneration, transfer the healthy seedlings to a new resistance regeneration box. When the seedlings grow to a certain size, samples can be taken for testing.

[0227] 3. Mutant Detection in Transgenic Seedlings

[0228] Specific amplification of target sites and identification of mutants in T0 transgenic plants

[0229] Whether the target gene editing is successful requires sequencing to identify. This experiment uses the Hi-TOM gene editing site detection kit produced by Xi'an Qingxue Biotechnology Co., Ltd. The kit automatically completes the high-throughput library construction process through the PCR method, and uses the Hi-TOM online software to directly analyze the variation information of multiple samples and multiple sites. TaTT3.2 is amplified using specific primers on both sides of the target sequence (TT32-Primer-F and TT32-Primer-R in Table 1), and the amplified product is sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing after library construction. The wild-type nucleotide sequence of the target gene TaTT3.2 is shown in SEQ ID NO.1-3, and its deduced amino acid sequence is shown in Figure 1 As shown, the nucleotide sequence of the target gene can also be obtained after sequencing the mutant, and its deduced amino acid sequence is as follows Figure 2 The mutation types of sgRNA target sites are shown in Figure 3The figure shows the insertion or deletion of bases. After comparison, the tt3.2 mutant inserted a base A after the +167 position of the CDS sequence of TaTT3.2-4A, causing the CDS region to stop translation after the 165th position, that is, the amino acid length of the gene mutant is only 55, which is 385 amino acids shorter than the wild type; the tt3.2 mutant inserted a base A after the +155 position of the CDS sequence of TaTT3.2-4B, causing the CDS region to stop translation after the 153th position, that is, the amino acid length of the gene mutant is only 51, which is 385 amino acids shorter than the wild type; the tt3.2 mutant inserted a base A after the +167 position of the CDS sequence of TaTT3.2-4A, causing the CDS region to stop translation after the 165th position, that is, the amino acid length of the gene mutant is only 55, which is 385 amino acids shorter than the wild type.

[0230] The first round of PCR reaction system: 1 μL of DNA from wheat plant leaves of the tt3.2 mutant was used as a template, 10 μL of 2×Taq Master Mix in the kit, 0.5 μL of Primer-F and Primer-R (Table 1) (10 μM) each, and Nuclease-free water was added to make up the volume to 20 μL. The PCR reaction conditions were: denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 20 s, for a total of 33 cycles; and finally extension at 72°C for 5 min. After the PCR was completed, 5 μL of agarose gel electrophoresis was taken to detect the PCR product to ensure the presence of the target product and good specificity.

[0231] Then, the second round of PCR reaction was performed, with 12 μL of Hi-TOM Mix in the kit, 1 μL of the first round PCR product as template, and the volume was supplemented to 20 μL with Nuclease-free Water. PCR reaction program: 94℃ denaturation for 2 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 25 s, a total of 33 cycles; and finally 72℃ extension for 5 min.

[0232] 4. Heat resistance treatment of tt3.2 mutant

[0233] The seeds of the tt3.2 mutant plant and the wild-type were sterilized with sodium hypochlorite for 15 minutes and washed with sterile water 5-6 times. After the seeds were sterilized, they were placed on moist filter paper for germination. After germination, they were planted in a plug tray filled with vermiculite, watered with Hoagland nutrient solution every day, planted in an incubator, 16 / 8 hours (light / dark), 20℃ for one week, and the temperature was adjusted to 42℃. The phenotype was observed for 7-10 days. The wild-type plants turned yellow and wilted, while the tt3.2 mutant plants were still relatively green. Figure 4 (a) Wild-type and tt3.2 mutant plants before heat treatment; Figure 4(b) Phenotypes of wild type and tt3.2 mutant plants after heat treatment. Figure 5 This is the plant phenotype of the tt32 mutant under natural dry wind. After the dry hot wind, the wild-type plants turned yellow and withered, while the tt32 mutant became greener. Figure 6 This is the grain phenotype of the tt3.2 mutant under natural dry wind. After dry hot wind, the thousand-grain weight of the tt3.2 mutant was 38.28 g, which was significantly higher than the thousand-grain weight of the wild type of 35.38 g (P-value=0.001); the single-plant yield of the wild type and tt3.2 mutant was 16.57 g and 21.55 g, respectively, with a significant difference between the two; the total number of grains per plant of the wild type and tt3.2 mutant was 35.38 and 38.37, respectively, which was slightly higher in the mutant than in the wild type, but not statistically significant (P-value=0.091).

Claims

1. A method for improving heat tolerance of wheat by editing the TaTT3.2 gene, characterized in that: Reducing or silencing the expression of the wheat TaTT3.2 gene in wheat.

2. The method according to claim 1, characterized in that The wheat TaTT3.2 gene is located on 4A, 4B and 4D of chromosome 4 in wheat, named TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D respectively. The nucleotide sequences of TaTT3.2-4A, TaTT3.2-4B and TaTT3.2-4D are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

3. The method according to claim 1, characterized in that The method of reducing or silencing the expression of wheat TaTT3.2 gene in wheat specifically comprises the following steps: 1) Design and synthesize sgRNA targeting TaTT3.2 gene; 2) Connecting the sgRNA obtained in step 1) to the pBUE411 vector to construct a pBUE411-TT32 binary vector with the function of knocking out the wheat TaTT3.2 gene; 3) The binary vector obtained in step 2) is transformed into plants by Agrobacterium-mediated transformation to reduce or silence the expression of the wheat TaTT3.2 gene, thereby obtaining wheat plants with high heat resistance.

4. The method according to claim 3, characterized in that The nucleotide sequence of the sgRNA of the TaTT3.2 gene described in step 1) is shown in SEQ ID NO:

4.

5. The method according to claim 3, characterized in that The pBUE411-TT32 binary vector having the function of knocking out the wheat TaTT3.2 gene described in step 3) comprises an expression cassette A and an expression cassette B; The expression cassette A specifically includes the following elements from upstream to downstream: the TaU3 promoter A from wheat, the sgRNA of the TaTT3.2 gene and the terminator A; The expression cassette B specifically includes the following elements from upstream to downstream: the promoter B, the corn Cas9 coding sequence, and the terminator B.

6. The method according to claim 5, characterized in that The corn Cas9 coding sequence is shown in SEQ ID NO: 5; the sequence of the promoter A is shown in SEQ ID NO: 6; the sequence of the promoter B is shown in SEQ ID NO: 7; the sequence of the terminator A is shown in SEQ ID NO: 8; and the sequence of the terminator B is shown in SEQ ID NO:

9.

7. The method according to claim 5, characterized in that The expression cassette A is located upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.

8. The method according to claim 3, characterized in that The pBUE411-TT32 binary vector also contains a resistance marker gene.

9. The method according to claim 3, characterized in that The sequence tables of the mutation detection primers pBUE411-F, pBUE411-R, TT32-Primer-F, and TT32-Primer-R of the target site of the sgRNA described in step 2) are shown as SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13, respectively.

Images