Method for efficiently obtaining pepper transgenic hairy roots by using agrobacterium rhizogenes

Abstract

The invention discloses a method for efficiently obtaining pepper transgenic hairy roots by using agrobacterium rhizogenes. Belongs to the technical field of plant genetic engineering. The method takes zanthoxylum bungeanum stem nodes as receptors, obtains hairy roots by agrobacterium rhizogenes mediation, and comprises the following steps: constructing an expression vector; performing agrobacterium tumefaciens transformation; preparing a transgenic receptor; carrying out explant infection; inducing hairy roots; transplanting the transgenic hairy root plant; and identifying the transgenic hairy roots. The method has the advantages of stable system, high conversion rate, simplicity in operation, workload saving and the like.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and more particularly to a method for efficiently obtaining transgenic hairy roots of Zanthoxylum bungeanum using Agrobacterium rhizogenes. Background Art

[0002] As an important economic tree species in my country, Sichuan pepper has a wide planting area across the country. It is not only a condiment on people's tables, but also has excellent biological activity and medical value. However, the current breeding cycle of Sichuan pepper is long and it is difficult to select good varieties. Therefore, it is imperative to accelerate the breeding of Sichuan pepper and shorten the breeding cycle.

[0003] At present, the breeding method of pepper is mainly based on traditional breeding, and the main propagation methods are seedlings, grafting, and cuttings. Fei Xitong proved that the reproduction method of the genus Zanthoxylum is apomixis, which indirectly proved that new varieties of pepper cannot be obtained through hybridization. However, haploid and polyploid varieties of pepper with excellent traits have not yet been identified. Agrobacterium tumefaciens-mediated gene breeding, which is based on tissue culture, takes too long and the experimental process is cumbersome.

[0004] In summary, how to speed up Zanthoxylum bungeanum breeding and shorten the breeding cycle is an urgent problem that technicians in this field need to solve. Summary of the invention

[0005] In view of this, the present invention provides a method for efficiently obtaining transgenic hairy roots of Zanthoxylum bungeanum using Agrobacterium rhizogenes.

[0006] The present invention provides a method using the stem nodes of Zanthoxylum bungeanum potted seedlings as transgenic explant materials and Agrobacterium rhizogenes as transgenic media, which does not require tissue culture conditions, greatly reduces the workload, can quickly obtain transgenic hairy roots of Zanthoxylum bungeanum, and provides a reference basis for accelerating Zanthoxylum bungeanum breeding.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A method for efficiently obtaining transgenic hairy roots of Zanthoxylum bungeanum using Agrobacterium rhizogenes comprises the following steps:

[0009] (1) Construction of expression vector;

[0010] (2) Agrobacterium transformation;

[0011] (3) Preparation of transgenic recipients - Zanthoxylum bungeanum stem nodes;

[0012] (4) explant infection;

[0013] (5) Hairy root induction;

[0014] (6) Transplantation of transgenic hairy root plants;

[0015] (7) Identification of transgenic hairy roots.

[0016] Furthermore, the step (1) is to construct an expression vector containing the target gene;

[0017] The expression vector is pBI121-EGFP vector.

[0018] Furthermore, the Agrobacterium in step (2) is Agrobacterium rhizogenes MSU440, Agrobacterium rhizogenes K599, Agrobacterium rhizogenes 8196, Agrobacterium rhizogenes R1601 or Agrobacterium rhizogenes C58C1.

[0019] Furthermore, the specific operation of step (2) is: transforming the expression vector into Agrobacterium, centrifuging after liquid expansion culture, retaining bacterial sludge, and then placing the bacterial sludge in a MES-KOH suspension to obtain an infection suspension;

[0020] The MES-KOH suspension comprises the following components: 8-15 mM MES monohydrate, 8-15 mM MgCl2, 0.02-0.05 mM acetosyringone, pH=5.8-6.0.

[0021] Furthermore, the Zanthoxylum bungeanum stem nodes in step (3) are stem nodes with buds from branches of 3-5 month old potted Zanthoxylum bungeanum seedlings.

[0022] Furthermore, the infection in step (4) is performed by immersion or vacuum penetration.

[0023] Furthermore, the specific operation of vacuum infiltration is: placing the pepper stem section in the infection suspension, and vacuum treating it at a pressure of 0.02 to 0.05 MPa for 10 to 30 minutes.

[0024] Furthermore, the specific operation of step (5) is: placing the infected pepper stem sections in a seedling box, wherein vermiculite with a humidity of 40-60% and a size of 3-5 mm is placed in the seedling box.

[0025] Furthermore, the specific operation of step (6) is: transferring the rooting material grown in the seedling box for 30 to 50 days to the substrate for further cultivation.

[0026] Furthermore, the identification in step (7) includes fluorescent labeling identification, gel electrophoresis identification and fluorescence quantitative identification.

[0027] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:

[0028] The invention induces hairy roots by outdoor culture and vacuum infiltration. Compared with the hairy root results of Zanthoxylum bungeanum tissue culture seedlings in the prior art (Chen Xinling, Wang Yuan, Sun Jikang, et al. Induction of Zanthoxylum bungeanum hairy roots and construction of its culture technology system), the conversion rate is increased by 27.8%, and there is no need to go through the tissue culture induction stage, which greatly saves the workload. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0030] Figure 1 This is the vector map of pBI121-ZbRAP2.4-EGFP in Example 1 of the present invention;

[0031] Figure 2 The phenotype of the infected Zanthoxylum bungeanum stem node 0d in Example 1 of the present invention;

[0032] Figure 3 The phenotype of the pepper stem node infected for 40 days in Example 1 of the present invention;

[0033] Figure 4 The fluorescence identification results in Example 1 of the present invention, wherein WT represents wild-type plants; ZbRAP2.4 represents transgenic hairy root plants;

[0034] Figure 5 The RT-qPCR identification results of different transgenic strains in Example 1 of the present invention, wherein WT represents wild-type plants; RAP2.4-1, RAP2.4-2, RAP2.4-3, and RAP2.4-4 represent transgenic hairy root plants of different strains;

[0035] Figure 6 The PCR identification results of different transgenic strains in Example 1 of the present invention, wherein H2O represents water; WT represents wild-type plants; and ZBRAP2.4_1-4 represents transgenic hairy root plants of different strains. DETAILED DESCRIPTION

[0036] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] The drugs required for the present invention are conventional experimental drugs, which are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0038] The Zanthoxylum bungeanum variety used in the following examples is Dahongpao Zanthoxylum bungeanum.

[0039] Example 1

[0040] 1) Expression vector construction

[0041] pBI121-EGFP was used as a plant expression vector. The pBI121-EGFP vector was double-digested with XbaⅠ and XmaⅠ endonucleases, and primers containing homology arms + ZbRAP2.4 sequences were designed (F: gagaacacggggg actctaga ATGGCAGATACAAAAGGGATTTCTACAG, SEQ ID No. 1; R: gctcacca tggtacccccggg AGATAAAATCGAATCCCAGTCGAT, SEQID No. 2), use KOD enzyme (KMM-101) and sequence primers to clone the ZbRAP2.4 target fragment (refer to the KOD instruction manual for the system flow), and recover the ZbRAP2.4 target fragment by gel recovery.

[0042] The homologous arm + ZbRAP2.4 fragment and the pBI121-EGFP linear vector were homologously recombined using a seamless cloning kit (C112) (refer to the instructions for the specific process) to obtain the recombinant plasmid pBI121-ZbRAP2.4-EGFP (vector map as shown in Figure 1 The recombinant plasmid pBI121-ZbRAP2.4-EGFP was transferred into Escherichia coli DH5α (Qingke TSC-C01) for sequencing and propagation (refer to the instruction manual for the specific process).

[0043] ZbRAP2.4 sequence:

[0044]

[0045] 2) Agrobacterium transformation

[0046] The recombinant plasmid pBI121-ZbRAP2.4-EGFP identified as correct by sequencing was transformed into Agrobacterium rhizogenes MSU440.

[0047] After the Agrobacterium rhizogenes is expanded and cultured in LB liquid medium, the bacteria are collected by centrifugation and mixed into a MES-KOH suspension for infection to obtain an infection suspension.

[0048] The MES-KOH suspension comprises the following components: 8-15 mM MES monohydrate, 8-15 mM MgCl2, 0.02-0.05 mM acetosyringone, pH=5.8-6.0.

[0049] 3) Preparation of transgenic receptors - Zanthoxylum bungeanum stem sections

[0050] Take the above-ground branches of 3-5 month old potted seedlings of Zanthoxylum bungeanum and use pruning shears to remove the stem nodes with latent buds as transgenic receptors.

[0051] 4) Explant infection

[0052] The steps of infection by vacuum infiltration are as follows: placing the pepper stem section in the infection suspension (OD600=0.6-0.8) obtained in step 2), and vacuum treating it at a pressure of 0.02-0.05 MPa for 10-30 minutes.

[0053] 5) Hairy root induction

[0054] Place the infected pepper stems in a seedling box with 40-60% humidity, 3-5 mm vermiculite, 25 ± 1°C, and 16 / 8 h of light. Figure 2 As shown, the phenotype after 40 days of growth is as follows Figure 3 shown.

[0055] 6) Transplantation of transgenic hairy root plants

[0056] The rooting material grown in the seedling box for 30 to 50 days was transferred to the seedling medium, which was peat soil and vermiculite with a volume ratio of 3:1.

[0057] 7) Identification of transgenic hairy roots

[0058] The Zanthoxylum bungeanum materials grown in the seedling medium for about 3 months were taken out and fluorescently identified using LUYOR-3415. The root phenotypes and fluorescent phenotypes of the wild-type plants and transgenic hairy root plants were compared, and photographs were taken to record the results.

[0059] An appropriate amount of roots of wild-type plants and transgenic hairy root plants were taken for DNA extraction. The DNA extraction was carried out using the Tiangen DP360 DNA extraction kit (refer to the instruction manual for the specific process), and PCR amplification was performed using GeneStar Taq enzyme (A012) (refer to the instruction manual for the process system). The PCR amplification primers were: 35S universal primer as the forward primer, and ZbRAP2.4 fragment as the reverse primer (F: GACGCACAATCCCACTATC C, SEQ ID No. 4; R: AGATAAAATCGAATCCCAGTCGAT, SEQ ID No. 5). The amplified fragment was then detected on a gel cutting instrument.

[0060] An appropriate amount of wild-type and transgenic hairy root root systems were taken for RNA extraction. The RNA extraction kit was Tiangen DP441 (refer to the instruction manual for the specific process). The extracted RNA was reverse transcribed using the GeneStar reverse transcription kit A230 (refer to the instruction manual for the specific process). The wild-type and transgenic hairy root root systems were subjected to fluorescence quantitative detection using the GeneStar fluorescence quantification kit A304 (refer to the instruction manual for the specific process, the internal reference genes were UBQ (F: TCGAAGATGGCCGTACATTG, SEQ ID No.6; R: TCCTCTAAGCCTCAGCACCA, SEQ ID No.7), and ZbRAP2.4 (F: AGCCATTTGCGAAAGCTTGG, SEQ ID No.8; R: TCTGACAAAGGCG AAGACCC, SEQ ID No.9).

[0061] Fluorescence identification results Figure 4 As shown, the ZbRAP2.4 transgenic hairy roots have significant green fluorescence, proving that ZbRAP2.4 was successfully transferred into the Zanthoxylum hairy roots from the perspective of fluorescence identification.

[0062] RT-qPCR identification results Figure 5 As shown, the expression levels of the four ZbRAP2.4 transgenic lines were all higher than that of the wild type, proving that ZbRAP2.4 was successfully transferred into the hairy roots of Zanthoxylum bungeanum at the transcript level.

[0063] PCR identification results Figure 6 As shown, the target bands were amplified from the four ZbRAP2.4 transgenic lines, proving that ZbRAP2.4 was successfully transferred into the hairy roots of Zanthoxylum bungeanum at the DNA level.

[0064] Example 2

[0065] Steps 1) to 4) are the same as in Example 1;

[0066] The infected pepper segments were dried on sterile filter paper in a clean bench, and then placed in pepper rooting medium (WPM + 1.5 mg / L IBA + 0.01 mg / L NAA) with the morphological upper end of the pepper segments facing upward.

[0067] The transgenic hairy root identification procedure is the same as step 7 of Example 1).

[0068] Experiment 1

[0069] The rooting conditions of the two materials in Example 1 and Example 2 were regularly observed and counted. The transformation conditions were identified using a handheld fluorescence instrument. The results are shown in Table 1.

[0070] The rooting rate was calculated 30 days after infection, and the formula is as follows:

[0071] Rooting rate = number of rooting nodes / total number of infections*100%.

[0072] Conversion rate = number of successfully identified materials / total number of infected materials*100%.

[0073] Table 1 Comparison of rooting induction between tissue culture seedlings and potted seedlings

[0074]

[0075] The results showed that the rooting rate after 30 days of infection, the average root length after 30 days of infection, the average plant height after 30 days of infection and the conversion rate in Example 1 were significantly higher than those in Example 2, which proved that the effect of Example 1 was better.

[0076] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0077] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for efficiently obtaining transgenic hairy roots of Zanthoxylum bungeanum using Agrobacterium rhizogenes, characterized in that: The steps include: (1) Construction of expression vector; (2) Agrobacterium transformation; (3) Preparation of transgenic recipients - Zanthoxylum bungeanum stem nodes; (4) explant infection; (5) Hairy root induction; (6) Transplantation of transgenic hairy root plants; (7) Identification of transgenic hairy roots.

2. The method according to claim 1, characterized in that The step (1) is to construct an expression vector containing the target gene; The expression vector is pBI121-EGFP vector.

3. The method according to claim 1, characterized in that The Agrobacterium in step (2) is Agrobacterium rhizogenes MSU440, Agrobacterium rhizogenes K599, Agrobacterium rhizogenes 8196, Agrobacterium rhizogenes R1601 or Agrobacterium rhizogenes C58C1.

4. The method according to claim 1, characterized in that The specific operation of step (2) is: transforming the expression vector into Agrobacterium, centrifuging after liquid expansion culture, retaining bacterial sludge, and then placing the bacterial sludge in MES-KOH suspension to obtain an infection suspension; The MES-KOH suspension comprises the following components: 8-15 mM MES monohydrate, 8-15 mM MgCl2, 0.02-0.05 mM acetosyringone, pH=5.8-6.

0.

5. The method according to claim 1, characterized in that The Zanthoxylum bungeanum stem nodes described in step (3) are stem nodes with buds from branches of 3-5 month old potted Zanthoxylum bungeanum seedlings.

6. The method according to claim 1, characterized in that The infection in step (4) is performed by immersion or vacuum penetration.

7. The method according to claim 6, characterized in that The specific operation of vacuum infiltration is: place the pepper stem section in the infection suspension and vacuum treat it at a pressure of 0.02 to 0.05 MPa for 10 to 30 minutes.

8. The method according to claim 1, characterized in that The specific operation of step (5) is: placing the infected pepper stem sections in a seedling box, wherein vermiculite with a humidity of 40-60% and a size of 3-5 mm is placed in the seedling box.

9. The method according to claim 1, characterized in that The specific operation of step (6) is: transferring the rooting material grown in the seedling box for 30 to 50 days to the substrate for further cultivation.

10. The method according to claim 1, characterized in that The identification in step (7) includes fluorescent labeling identification, gel electrophoresis identification and fluorescence quantitative identification.

Images