Method for improving citrus canker resistance through CsMBL1 gene and application of CsMBL1 gene

Abstract

The invention discloses a method for improving citrus canker resistance through a CsMBL1 gene and application of the CsMBL1 gene, and relates to the field of agricultural biological genes. A method for improving canker resistance of citrus through the CsMBL1 gene comprises the following steps that 1, a citrus CsMBL1 coding sequence is cloned, and the CsMBL1 coding sequence is shown as SEQ ID No.1; (2) constructing a CsMBL1 overexpression vector; and (3) transforming citrus by using the CsMBL1 overexpression vector, and culturing to obtain a transgenic plant with improved canker resistance. The citrus spherical mannose specific binding lectin coding gene is integrated into the citrus through an expression vector, the canker resistance of the citrus is effectively improved, and the citrus spherical mannose specific binding lectin coding gene has great application value in canker-resistant breeding of the citrus.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological genes, and in particular to a method and application of a CsMBL1 gene to improve resistance to citrus canker. Background Art

[0002] Citrus is the largest fruit in southern my country and an important economic crop in the world. However, citrus canker has seriously hindered the healthy development of the citrus industry (Hu Junhua et al., 2015). Citrus canker is caused by Xanthomonas citrisubsp.citri (Xcc), which originated in India, Java and other places (Hu Junhua et al., 2015). The main citrus producing areas in Fujian, Hunan, Guangdong and other places in my country are seriously affected by citrus canker. The canker bacteria mainly infect citrus leaves, branches, fruits, etc., among which seedlings and young trees are more seriously affected (He Xiuling et al., 2007). Diseased trees will experience leaf fall, dead branches, weak tree vigor and fruit drop, which seriously affects the yield and quality of citrus. There are dozens of Rutaceae plants affected by citrus canker, most of which are economic cultivars. Studies have found that sweet orange is most susceptible to the disease, followed by sour orange and pomelo (Yuan et al., 1997; Li et al., 2013).

[0003] At present, comprehensive prevention and control strategies are usually adopted to control the damage of citrus canker, with chemical control as the main method and biological control as the auxiliary method. However, since chemical control measures are not environmentally friendly, they are very likely to cause environmental pollution, and require a lot of manpower and material resources, and biological control has poor effects and high costs, it is urgent to reduce the losses caused by canker by breeding new disease-resistant varieties (Chen Li et al., 2008; Zhu Xuemei et al., 2017). The long hybrid breeding cycle makes breeding efficiency low. With the rise of molecular biology, people began to study the pathogens themselves and the disease resistance of plants from the direction of disease-resistant genetic engineering. Genetic engineering methods have also been tried in the study of anti-ulcer disease (Duan Minjie et al., 2016; Jia Ruirui et al., 2017), and some transgenic materials resistant to canker disease have been obtained. For example, Chen Shanchun et al. obtained Jincheng, Xinhuicheng and Navelcheng orange lines that were resistant to citrus canker by carrying the antimicrobial peptide D gene of the silkworm (Chen Shanchun et al., 1996); the exogenous genes NLS, chit42, Xa21 and PthA were resistant to citrus canker after being transferred to Bingtangcheng, Ponkan and Sweet Orange (Mendes et al., 2010; Yang et al., 2011); CsBZIP40 is an important transcription factor that responds to citrus canker infection, and it is speculated that it affects the resistance of citrus varieties through the SA pathway (Li et al., 2017); the CsLOB1 gene, as a target protein of the canker pathogen gene PthA, makes citrus more sensitive to canker (Li et al., 2014); CRISPR / Cas9 targeted knockout of the promoter of the citrus canker susceptibility gene CsLOB1 can obtain plants with improved resistance to citrus canker (Penget al., 2017).

[0004] Mannose-binding lectin (MBL) is a class of proteins that can specifically bind to mannose. It belongs to the lectin family and is ubiquitous in many plant species (Peumans and Van Damme, 1995). It is essential for plant defense signals when pathogens invade by recognizing specific carbohydrates on the surface of pathogens (Barre A and Bourne Y, 2001). For example, CaMBL1 in pepper plays a key role in the regulation of plant cell death and defense responses by inducing downstream defense-related genes and SA accumulation. Overexpression of CaMBL1 in Arabidopsis thaliana enhances resistance to infection by Pseudomonas syringae and Neurospora brassicae (In Sun Hwang and Byung Kook Hwang, 2011). FaMBL1 in immature strawberries can reduce the susceptibility of strawberries to fungal pathogens (Guidarelli et al., 2014). At present, there is no research and application of using MBL to improve the resistance of citrus to citrus canker.

[0005] In view of this, the present application is proposed. The present application aims to obtain a transgenic citrus strain with significant resistance to ulcer disease by overexpressing CsMBL1 and increasing the expression level of CsMBL1. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a new option for improving the resistance of citrus to ulcer disease, as the existing citrus has poor resistance to ulcer disease. The purpose is to provide a method and application of the CsMBL1 gene to improve the resistance of citrus to ulcer disease. By integrating a citrus globular mannose-specific binding lectin encoding gene into citrus through an expression vector, the resistance of citrus to ulcer disease is effectively improved, which has great application value for breeding citrus ulcer disease resistance.

[0007] The present invention is achieved through the following technical solutions:

[0008] In a first aspect, the present invention provides an application of overexpressing a CsMBL1 gene in improving resistance to citrus canker. The nucleotide sequence of the CsMBL1 gene is shown in SEQ ID No.1.

[0009] As a possible design, the protein encoded by the above CsMBL1 gene is citrus globular mannoses-specific binding lectin.

[0010] In a second aspect, the present invention also provides a method for improving the resistance of citrus to ulcer disease by using the CsMBL1 gene, comprising the following steps:

[0011] (1) Clone the coding sequence of citrus CsMBL1, the coding sequence of CsMBL1 is shown in SEQ ID No. 1;

[0012] (2) Construction of CsMBL1 overexpression vector;

[0013] (3) The CsMBL1 overexpression vector was used to transform citrus, and after cultivation, transgenic plants with improved resistance to ulcer disease were obtained.

[0014] As a possible design, in the above step (1), the cloning method of the citrus CsMBL1 coding sequence is: extracting citrus total RNA, reverse transcribing it into cDNA as a template, using primers OE-CsMBL1-F and OE-CsMBL1-R to perform PCR amplification and recover the CsMBL1 coding sequence DNA fragment, wherein the primers OE-CsMBL1-F and OE-CsMBL1-R are the nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

[0015] As a possible design, in the above step (2), the method for constructing the CsMBL1 overexpression vector is as follows: the CsMBL1 coding sequence DNA fragment recovered by KpnⅠ and EcoRⅠ digestion is ligated to the pLGNe vector recovered by KpnⅠ and EcoRⅠ digestion to construct the overexpression vector pLGNe-CsMBL1.

[0016] As a possible design, in the above step (3), the method for transforming citrus with the CsMBL1 overexpression vector is as follows: the overexpression vector pLGNe-CsMBL1 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens.

[0017] As a possible design, the transformed citrus explant cells were further identified by GUS staining, PCR, and qRT-PCR analysis of CsMBL1 expression to obtain transgenic plants.

[0018] As a possible design, the above-mentioned PCR primers for identifying transgenic plants are: ID-CsMBL1-F and ID-CsMBL1-R, wherein the ID-CsMBL1-F is designed based on the front-end sequence of the CsMBL1 gene, and the ID-CsMBL1-R is a sequence taken from CaMV 35S on the pLGNe vector, and the ID-CsMBL1-F and ID-CsMBL1-R are the nucleotide sequences shown in SEQ ID No.4 and SEQ ID No.5, respectively.

[0019] As a possible design, the primers for the qRT-PCR analysis of CsMBL1 expression are: RT-CsMBL1-F and RT-CsMBL1-R, and the RT-CsMBL1-F and RT-CsMBL1-R are the nucleotide sequences shown in SEQ ID No. 6 and SEQ ID No. 7, respectively.

[0020] As a possible design, the above-mentioned transgenic plants were also evaluated for resistance, and it was determined that overexpression of CsMBL1 improved resistance to citrus canker.

[0021] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0022] The present invention is based on the overexpression of CsMBL1 to improve the resistance of citrus canker. By cloning the citrus CsMBL1 coding sequence, constructing an overexpression vector, and then transforming the citrus, the degree of ulcer disease in the obtained transgenic plants can be reduced to 81.3% of the existing citrus, which can reduce the degree of ulcer disease and reduce the area of ​​lesions. In summary, the present invention is a potential bioengineering technology for improving the resistance of citrus canker, and has great value for molecular breeding of citrus resistance to canker. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings:

[0024] Figure 1 The bioinformatics characteristics of CsMBL1 of the present invention are as follows: A is the chromosome location of the citrus CsMBL1 gene, bp represents base; B is the gene structure of citrus CsMBL1; C is the functional domain of citrus CsMBL1, aa represents amino acid;

[0025] Figure 2 The electrophoresis diagram of PCR amplification of the CsMBL1 gene clone of the present invention is shown in FIG. 1 : CDS indicates the CsMBL1 coding sequence; M indicates the DNA molecular weight standard, the same below.

[0026] Figure 3 The structure diagram of the CsMBL1 plant overexpression vector of the present invention is as follows: GUS represents the β-glucosidase gene; CaMV35S represents the plant constitutive promoter derived from cauliflower mosaic virus; and NOS represents the opine synthase gene terminator.

[0027] Figure 4 The figure is a flow chart of citrus genetic transformation according to the present invention.

[0028] Figure 5 This is a GUS staining image of the transgenic plants of the present invention: OE-CsMBL1-1, OE-CsMBL1-2, OE-CsMBL1-3 represent different transgenic plants, respectively, and WT represents the wild-type Wanjin Orange plant, the same below.

[0029] Figure 6 This is a PCR identification diagram of the transgenic plant of the present invention, and + represents plasmid pLGNe-CsMBL1.

[0030] Figure 7 This is an analysis diagram of the CsMBL1 expression level in the transgenic plants of the present invention: ** indicates extremely significant difference compared with WT (P<0.01), *** indicates extremely significant difference compared with WT (P<0.001), **** indicates extremely high significant difference compared with WT (P<0.0001), the same below.

[0031] Figure 8 This is a phenotype diagram of the transgenic plant of the present invention.

[0032] Fig. 9This is a symptom picture 10 days after the leaves of the transgenic plants of the present invention were inoculated with ulcer pathogens.

[0033] Fig.10 This is a statistical diagram of the size of lesions on the leaves of the transgenic plants of the present invention 10 days after being inoculated with canker bacteria.

[0034] Fig.11 This is a statistical graph of the disease index 10 days after the leaves of the transgenic plants of the present invention were inoculated with canker bacteria. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with examples and drawings. The illustrative embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention. If specific conditions are not specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0036] It should be noted that: the embodiment of the present invention uses Wanjin orange as the test object. In practical applications, the method can also be used to improve the resistance of other citrus varieties to ulcer disease.

[0037] Example 1

[0038] Bioinformatics Analysis of Citrus CsMBL1 Gene

[0039] The citrus CsMBL1 gene is located between 38944252bp and 38945981bp on chromosome 5 of citrus. The full length of the chromosome is 50202760bp, the CDS sequence is 1308bp, and it can encode 435 amino acids. The protein sequence analysis showed the presence of a mannose-specific lectin structural functional domain, an S-site glycoprotein domain, and a domain that mediates protein-protein or protein-carbohydrate interactions (refer to Figure 1 ).

[0040] The nucleotide sequence of the CsMBL1 gene is shown in SEQ ID No. 1 (CsMBL1 CDS sequence, ATG to stop codon) as follows:

[0041] ATGAAGATGTCATCTTCCTCAGCAATATCATTCTCCTTCTTCCTCCTCTCATCATTCCT

[0042] TTTCTTCGTAGCTAATGCTAAAGTTCCTCCTTCTGAAACATTTAAGTTTGTGAATGAAGG

[0043] AGAGTTCGGGCCATACGTTAATGAATACGACGCAAATTACAGAATGTTAAGCATCTTCAA

[0044] CTCTCCATTCCAGCTTGCGTTTTACAACACAACCCCAAATGCTTACACCCTTGCTCTCCG

[0045] CTTGGGTCTTCAACGAAACGAGCCGCTTTTCCTTTGGGTTTGGGAAGCCAACCGGGGCA

[0046] AACCGGTTCGCGAAAACGCCACCTTCTCTTTGGGAACCGACGGGAATCTTGTCTTGGCC

[0047] GAAGCCGACGGCACCGTTGTCTGGCAAACCAACACTGCCAACAAAGGTGTTGTAGGGT

[0048] TTAAGTTGCTCTCAAATGGCAACATGGTGCTTTATGACTCAAAGGGTAAATTTATTTGGC

[0049] AGAGTTTTGATTATCCAACTGATACTCTCTTGGCGGGCCAATCCCTTCGTGTCGGTGGGG

[0050] TCACCAAGCTTGTCAGCCGACTCTCCGCTGAAGAAAACGTCGACGGCCCTTACAGCTTC

[0051] GTGATGGAGCCCAAAAGAGCAGCAATGTACTACAAAAGCAGCAACTCTCCCCGGCCCG

[0052] TTCTCTACTTCACTTCATATGACTGGTTTAACGCCCGAGATGTCTCTTTACAGAATGTAAC

[0053] ATTCAACTCCCGCCCGGAAACTGATGAAGCGGTTGCTTTTGTACAAACCCTGGATTCTTC

[0054] AGCCAATGGTAACATTTTGGCTAGACCAAAATACGACAGCACAATATCGTTTCTGCGGCT

[0055] TGGAATTGATGGAAATCTCAAGATCTACACTTATTACGACAAGGTTGATTGGGGGCCCAC

[0056] GGAAGTAACGTTCACTCTCTTCGACAGAGATTCAAGTTGGGAGAATGAGTGTCAGCTGC

[0057] CTGAGAGATGCGGCAAATTTGGACTCTGTGATGAAAATCAATGCGTTGCTTGCCCTACG

[0058] GAGAAGGGTTTGCTTGGGTGGAGCAAGGATTGTGAGCCGAAGAAAGTGACTTCCTGTA

[0059] GGCCAAATGATTTTCATTATCACAAGGTTGAAGGGGTCGATCATTATATGAGTAAGTATAC

[0060] AAGTGGAGCAGCCGTTAAAGTTGAAGATTGTGGCGGGAAATGTACTTCCGATTGCAAGT

[0061] GCTTGGGATATTTTTACCACCAAGAGACATCGAGATGTTGGATTGCTTATGACTTGAAGA

[0062] CTCTTACTAAATTCCCAAACTCTACGCATGTTGGATTCATAAAGGCTCCCAACAAGTAA

[0063] Example 2

[0064] Cloning of the coding sequence of Citrus CsMBL1

[0065] 1. RNA Extraction and cDNA Synthesis

[0066] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0067] 2. PCR Amplification of CsMBL1 Coding Sequence

[0068] The CsMBL1 coding sequence DNA fragment was amplified from citrus cDNA using primers OE-CsMBL1-F (SEQ ID No. 2), OE-CsMBL1-R (SEQ ID No. 3) and high-fidelity enzyme PrimeSTARMaxDNAPolymerase (TaKaRa, CAT: R045Q). The length of the fragment was 1308 bp (refer to Figure 2 ), the amplified DNA fragment was sequenced and confirmed to be the coding sequence of the citrus CsMBL1 gene (SEQ ID No. 1). Under ultraviolet light, a clean blade was used to cut out the agarose gel block containing the target fragment, and a kit (BioFlux, CAT: BSC02M1) was used to recover the DNA fragment.

[0069] PCR amplification program: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; extension at 72°C for 10 min.

[0070] The nucleotide sequence of the primer OE-CsMBL1-F gene is SEQ ID No. 2 (pre-CDS cloning primer OE-CsMBL1-F, containing restriction enzyme cutting site) as shown below:

[0071] GGTACCATGAAGATGTCATCTTCCTCAGC

[0072] The nucleotide sequence of the primer OE-CsMBL1-R gene is SEQ ID No. 3 (primer OE-CsMBL1-R after CDS cloning, containing restriction sites and 3×flag tag sequence) as shown below:

[0073] GAATTCTTACTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCCTT ATCATCATCATCCTTGTAATCCTTGTTGGGAGCCTTTATGA

[0074] Example 3

[0075] Construction of CsMBL1 overexpression vector and transformation of Agrobacterium

[0076] 1. Construction of overexpression vector

[0077] The CsMBL1 coding sequence DNA fragment and the overexpression vector pLGNe were double digested with restriction endonucleases EcoRⅠ and KpnⅠ (ThermoFisher), recovered from the gel and ligated overnight at 16°C using T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsMBL1 overexpression vector pLGNe-CsMBL1 (refer to Figure 3 ).

[0078] 2. Transformation of Agrobacterium with Overexpression Vector

[0079] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: pre-thaw frozen Agrobacterium competent cells EHA105 (50 μL) on ice; add 2 μL of the plasmid of the overexpression vector to the competent cells, blow and mix, and place on ice for 5 minutes; transfer the mixed solution to the bottom of the pre-dried electric shock cup, put the electric shock cup into the card slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL of LB liquid culture medium to the electric shock cup, blow and mix with a pipette, transfer to a sterile centrifuge tube, and shake and culture at 260 r / min and 28°C for 60 minutes; centrifuge the bacterial solution at 10000 r / min for 1 minute, discard the supernatant (about 100 μL of resuspended bacteria remains), resuspend and spread, and invert and dark culture at 28°C for 2 days; after the growth of plaques, use primers OE-CsMBL1-F (SEQ ID No.2) and OE-CsMBL1-R (SEQ ID No.3) PCR verification was performed on single colonies.

[0080] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0081] Example 4

[0082] Genetic transformation of citrus with CsMBL1 overexpression vector

[0083] according to Figure 4 The process shown in the figure is used for citrus genetic transformation. The specific operations are as follows:

[0084] 1. Obtaining epicotyls of citrus seedlings

[0085] Fresh citrus fruits were washed and surface disinfected with 70% alcohol. The seeds were taken out under sterile conditions, the seed coats were peeled off, and the seeds were germinated on seed germination medium. The seeds were cultured in the dark at 28°C for 2 weeks, and then cultured under 16 h light / 8 h dark conditions for 1 week. The epicotyls of the germinated seedlings were taken under sterile conditions and cut into 1 cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0086] 2. Preparation of Agrobacterium tumefaciens

[0087] Before transfection, streak the Agrobacterium (containing the pLGNe-CsMBL1 vector) for transfection on LB solid medium containing 50 mg / L kanamycin; pick a single colony and inoculate it into 25 mL LB liquid medium containing the same antibiotics, and culture it with shaking at 28°C overnight; dilute the bacterial solution to OD=0.1 and continue to culture it to OD=0.5, centrifuge it at 5000r / min for 10 min, discard the supernatant, and resuspend it in MS liquid medium at pH5.4 for transfection.

[0088] 3. Transformation of Citrus Epicotyls

[0089] Soak the citrus epicotyl stem segments in Agrobacterium solution for 13 minutes and then wipe them dry. Transfer the stem segments to co-cultivation medium and culture them in the dark at 26°C for 2 days. After the co-cultivation is completed, transfer the epicotyls to the screening medium and culture them in the dark at 28°C for 7 days. Culture the epicotyls at 28°C, 16h light / 8h dark conditions, subculture every two weeks, and then identify them by GUS staining.

[0090] 4. Seedling Culture of Transformants

[0091] When the seedlings grow to more than 1 cm, they are cut and grafted onto late orange seedlings in sterile test tubes and cultured in seedling medium; when the seedlings grow to about 5 cm, they are grafted onto citrus aurantium seedlings and cultured in a 28°C greenhouse.

[0092] The culture medium used in this embodiment is as follows:

[0093] Seed germination medium: MS + 30g / L sucrose + 2.5g / L Gelrite, PH 5.8.

[0094] Co-culture medium: MS+2mg / L BA+0.5mg / L IAA+1mg / L 2,4–D+100μmolAS+30g / L sucrose+2.5g / L Gelrite, PH 5.8.

[0095] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0096] Seedling medium: MS + 30g / L sucrose, PH 5.8.

[0097] Example 5

[0098] Verification of CsMBL1 overexpressing transgenic plants

[0099] 1. GUS staining identification of transgenic plants

[0100] The leaves of the transgenic plants obtained in the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The edges of the leaf discs of the positive plants showed blue color, while the leaf discs of the WT plants did not show color (refer to Figure 5 ).

[0101] 2. PCR Identification of Transgenic Plants

[0102] 100 mg of leaves from transgenic plants were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsMBL1 coding sequence in the citrus genome. The detection primers were ID-CsMBL1-F (SEQ ID No. 4) and ID-CsMBL1-R (SEQ ID No. 5). A 1369 bp amplified fragment was obtained from positive plants, while no amplification was obtained from WT plants (refer to Figure 6 ).

[0103] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0104] 3. qRT-PCR Analysis of Transgenic Plants

[0105] Total RNA (Aidelai, CAT No: RN09) was extracted from the leaves of transgenic plants, and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsMBL1-F (SEQ ID No. 6) and RT-CsMBL1-R (SEQ ID No. 7). -△△Ct The relative expression of CsMBL1 gene in transgenic plants was calculated by the following method: the water-treated sample was defined as the reference factor, i.e., its CsMBL1 expression level was 1, and then the multiple of the gene expression in transgenic citrus relative to the reference factor was calculated. -△△Ct , which is the relative expression level. The results showed that the CsMBL1 gene was expressed at a higher level in transgenic plants than in wild-type plants (up to 150 times that of the control) (refer to Figure 7 ).

[0106] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0107] 4. Phenotypic observation of transgenic plants

[0108] The phenotypes of the three transgenic plants were observed and analyzed, and no obvious abnormalities were found in their appearance and growth (refer to Figure 8 ). This indicates that overexpression of the CsMBL1 gene did not have a significant effect on the phenotype and development of the plant.

[0109] The nucleotide sequence of primer ID-CsMBL1-F, SEQ ID No. 4 (pre-PCR identification primer ID-CsMBL1-F for transgenic plants, designed within CDS) is as follows:

[0110] ATGAAGATGTCATCTTCCTCAGC

[0111] The nucleotide sequence of primer ID-CsMBL1-R, SEQ ID No. 5 (primer ID-CsMBL1-R after PCR identification of transgenic plants, designed within CaMV 35S) is as follows:

[0112] TCATAGGCGTCTCGCATATCTCATT

[0113] The nucleotide sequence of primer RT-CsMBL1-F, SEQ ID No. 6 (pre-RT-PCR identification primer RT-CsMBL1-F for transgenic plants, designed within CDS) is as follows:

[0114] GAGAGTTCGGGCCATACGTT

[0115] The nucleotide sequence of primer RT-CsMBL1-R, SEQ ID No. 7 (primer RT-CsMBL1-R after RT-PCR identification of transgenic plants, designed within CDS) is as follows:

[0116] AACGCAAGCTGGAATGGAGA

[0117] Example 6

[0118] Evaluation of resistance of CsMBL1 overexpressing transgenic plants

[0119] The mature leaves of the transgenic plants were washed, disinfected with 75% alcohol, rinsed with sterile water, and placed on a clean bench. The veins were punctured with needles, and the ulcer pathogen liquid was applied with a pipette. 1 μL (1× 10 5CFU / mL); cultured in a 28°C constant temperature and light incubator (16 h light / 8 h dark); photos were taken 10 days after the leaves were spotted with bacteria, and the lesion area was counted using Image J V1.47 software.

[0120] The disease is divided into grades 0-7 according to the area of ​​the lesions, with the letter R representing the lesion area, grade 0 (R ≤ 0.25 mm 2 ), Level 1 (0.25mm 2 <R≤0.5mm 2 ), Level 2 (0.5mm 2 <R≤0.75mm 2 ), Level 3 (0.75mm 2 <R≤1mm 2 ), 4 levels (1.0mm 2 <R≤1.25mm 2 ), 5 levels (1.25mm 2 <R≤1.5mm 2 ), 6 levels (1.5mm 2 <R≤1.75mm 2 ), 7th level (R>1.75mm 2 ); calculate the disease index according to the formula: DI = 100XΣ [number of lesions at each level X corresponding level value] / (total number of lesions X maximum level).

[0121] The results showed that 10 days after inoculation with the ulcer pathogen, the overexpression plants and the WT plants grafted at the same time developed disease to varying degrees, and there were certain differences in the size of the lesions (refer to Fig. 9 ). According to statistics and analysis, the lesion area of ​​transgenic plants was significantly smaller than that of wild-type controls, accounting for 84.5%-89.4% of the controls (refer to Fig.10 The disease index of transgenic plants was significantly lower than that of wild-type controls, ranging from 81.1% to 88.4% of the controls (refer to Fig.11 ). It can be seen that overexpression of CsMBL1 can significantly reduce the lesion area of ​​citrus bacterial canker and alleviate the severity of citrus bacterial canker.

[0122] It can be seen that overexpression of CsMBL1 can greatly reduce the lesion area of ​​ulcer disease and alleviate the severity of ulcer disease. This gene can be used independently for disease resistance molecular breeding, or it can be used together with other disease resistance or disease susceptibility genes for molecular breeding of citrus ulcer disease resistance.

[0123] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of overexpression of CsMBL1 gene in improving resistance to citrus canker, characterized in that: The nucleotide sequence of the CsMBL1 gene is shown in SEQ ID No.

1.

2. The use of the overexpressed CsMBL1 gene in improving resistance to citrus canker according to claim 1, characterized in that: The protein encoded by the CsMBL1 gene is citrus globular mannose-specific binding lectin.

3. A method for improving citrus resistance to ulcer disease by using CsMBL1 gene, characterized in that: The steps include: (1) Clone the coding sequence of citrus CsMBL1, wherein the coding sequence of CsMBL1 is shown in SEQ ID No. 1; (2) Construction of CsMBL1 overexpression vector; (3) The CsMBL1 overexpression vector was used to transform citrus, and after cultivation, transgenic plants with improved resistance to ulcer disease were obtained.

4. The method for improving citrus resistance to ulcer disease by using CsMBL1 gene according to claim 3, characterized in that: In step (1), the cloning method of the citrus CsMBL1 coding sequence is: extracting citrus total RNA, reverse transcribing it into cDNA as a template, using primers OE-CsMBL1-F and OE-CsMBL1-R to perform PCR amplification and recover the CsMBL1 coding sequence DNA fragment, wherein the primers OE-CsMBL1-F and OE-CsMBL1-R are the nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

5. The method for improving citrus resistance to ulcer disease by using CsMBL1 gene according to claim 3, characterized in that: In step (2), the method for constructing the CsMBL1 overexpression vector is as follows: the CsMBL1 coding sequence DNA fragment recovered by KpnⅠ and EcoRⅠ digestion is ligated to the pLGNe vector recovered by KpnⅠ and EcoRⅠ digestion to construct the overexpression vector pLGNe-CsMBL1.

6. The method for improving citrus resistance to ulcer disease by using CsMBL1 gene according to claim 3, characterized in that: In step (3), the method for transforming citrus with the CsMBL1 overexpression vector is as follows: the overexpression vector pLGNe-CsMBL1 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens.

7. The method for improving citrus resistance to ulcer disease by using CsMBL1 gene according to claim 6, characterized in that: The transformed citrus explant cells were further subjected to GUS staining identification, PCR identification and qRT-PCR analysis of the CsMBL1 expression level to obtain transgenic plants.

8. The method for improving citrus resistance to ulcer disease by using CsMBL1 gene according to claim 7, characterized in that: The primers for PCR identification of transgenic plants are: ID-CsMBL1-F and ID-CsMBL1-R, wherein ID-CsMBL1-F is designed based on the front end sequence of the CsMBL1 gene, and ID-CsMBL1-R is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsMBL1-F and ID-CsMBL1-R are the nucleotide sequences shown in SEQ ID No.4 and SEQ ID No.5, respectively.

9. The method for improving citrus resistance to ulcer disease by using CsMBL1 gene according to claim 7, characterized in that: The primers for qRT-PCR analysis of CsMBL1 expression are: RT-CsMBL1-F and RT-CsMBL1-R, and the RT-CsMBL1-F and RT-CsMBL1-R are the nucleotide sequences shown in SEQ ID No.6 and SEQ ID No.7, respectively.

10. The method for improving citrus resistance to ulcer disease by using CsMBL1 gene according to claim 3 or 7, characterized in that: The transgenic plants were also evaluated for resistance, and it was determined that overexpression of CsMBL1 improved resistance to citrus canker.

Images