A method for improving the resistance of citrus to citrus yellow vein disease by using the ClLHCP gene

Abstract

The present invention relates to the field of agricultural biological gene technology, and discloses a method for improving the resistance of citrus to citrus yellow vein clearing disease by using the ClLHCP gene, comprising the following steps: (1) cloning the VIGS fragment of the citrus ClLHCP gene; (2) constructing two VIGS expression vectors, namely TRV and CLBV; (3) transforming the citrus with the VIGS expression vector to obtain VIGS plants with the citrus ClLHCP gene silenced. By constructing the VIGS vector of the citrus ClLHCP gene and then transforming the citrus, the obtained citrus plants can show obvious resistance to citrus yellow vein clearing disease, the titer of citrus yellow vein clearing virus can be reduced by 47%, the incidence of citrus yellow vein clearing disease is significantly reduced, and the TRV silencing of the citrus ClLHCP gene does not affect the phenotype of the citrus plants. It can be used as a candidate gene to cooperate with multiple citrus yellow vein clearing disease resistant and susceptible genes by using techniques such as VIGS silencing, RNA interference and gene editing for citrus yellow vein clearing disease resistance breeding, which has great application value for citrus yellow vein clearing virus resistant breeding of citrus.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural biological genes, and in particular, to a method for improving the resistance of citrus to yellow vein disease by using the ClLHCP gene. Background Art

[0002] Citrus yellow vein clearing disease (CYVCD) is a newly emerging disease that seriously harms citrus. Citrus yellow vein clearing virus (CYVCV) is its pathogen, which can infect most citrus varieties, causing symptoms such as vein clearing of leaf veins, yellowing and mottling of leaves, resulting in weakened tree vigor and decreased yield, seriously threatening the citrus industry such as lemon. After being infected by the disease, the citrus tree vigor will be weakened, leading to a significant decrease in yield. Therefore, strengthening the research on the prevention and control of citrus yellow vein clearing virus is an urgent need for the development of the citrus industry. At present, the prevention and control of citrus yellow vein disease is relatively difficult, lacking effective control agents, mainly relying on preventive measures such as strict quarantine and strengthened management.

[0003] In recent years, the research on CYVCV has mainly focused on transmission routes and detection techniques, etc., and the pathogenic mechanism and the mechanism of host plant response to infection are still unclear. Some studies have shown that in the leaf tissues of lemon infected with CYVCV, chloroplasts show swelling and malformation, the arrangement of grana tissues is disordered, the chloroplast membrane dissolves, and in severe cases, the chloroplasts disintegrate. Chloroplasts and their related proteins play a crucial role in the process of defending against virus infection. There is an interaction between the proteins encoded by plant viruses and chloroplast-related proteins, and chloroplasts and their related components are used to assist in the proliferation and movement of viruses. At the same time, chloroplast proteins can also synthesize certain defense signal molecules to resist virus invasion. Some studies have shown that viruses can interfere with the photochemical reactions of host plants by interfering with the abundance of important proteins in the electron transport chain. In this process, three important targets of the virus are light-harvesting chlorophyll a / b binding proteins (LHC), the core subunits of photosystem I (PS I) and photosystem II (PS II), and the external proteins of oxygen evolution and NADP ＋Reductase. Among them, the LHC family proteins are crucial in the initial steps of photosynthesis. By forming complex structures in the photosynthetic membrane, they effectively capture photons, absorb light energy, and rapidly transfer the energy to the photosynthetic reaction center to initiate the photochemical reaction. Previously, researchers used RNA-seq technology to detect changes in gene transcripts of Eureka lemon and Simmons sweet orange infected with CYVCV, and found that the expression of most photosystem I and photosystem II proteins in the CYVCV-sensitive variety Eureka lemon was significantly downregulated, photosynthesis was blocked, and thylakoids were damaged. In the CYVCV-tolerant variety Simmons sweet orange, the light-harvesting complex chlorophyll a / b-binding proteins (LHCB3, LHCB2, LHB1B1) were all upregulated, suggesting that they play a positive role in the defense response of plant-virus interaction.

[0004] LHC is divided into LHCI related to PS I and LHCII related to PS II. In higher plants, LHCI contains four proteins, LHCA1-4, and LHCII contains six proteins, LHCB1-6. Among them, the light-harvesting chlorophyll A / B-binding protein 151 (LHCP) is the LHCB2 protein in PSII. Some studies have shown that when LHCB1 and LHCB2 are absent, the light absorption of plant leaves decreases, photosynthesis declines, growth and development are affected, and seed yield decreases. When Nicotiana benthamiana is infected with potato virus X (PVX), the Kunitz-type protease inhibitor-like protein (KPILP), as a regulator of the chloroplast retrograde signaling system, can downregulate the expression of LHCB1 and LHCB2 genes and participate in the antiviral immune response. However, at present, there is little research on the LHC family proteins in citrus, and there is no report on the role of LHCP in disease infection. There is no research and application on improving the resistance of citrus to citrus yellow vein clearing virus by silencing ClLHCP mediated by tobacco rattle virus (TRV).

[0005] In view of this, the present application is specifically proposed. Summary of the Invention

[0006] The present invention provides a method for improving the resistance of citrus to yellow vein clearing disease by using the ClLHCP gene. By transferring the VIGS vector of the citrus ClLHCP gene into citrus, reducing the transcriptional level of citrus ClLHCP can significantly improve the resistance of citrus to citrus yellow vein clearing disease, reduce the incidence of citrus yellow vein clearing disease, and has great application value in citrus breeding. It can be used as a candidate gene for resistance breeding with multiple citrus yellow vein clearing virus-resistant and -susceptible genes.

[0007] The present invention is achieved through the following technical solutions:

[0008] A method for improving the resistance of citrus to citrus yellow vein disease by using the ClLHCP gene, which improves the resistance of citrus plants to citrus yellow vein disease by regulating the expression level of the ClLHCP gene in citrus plants, and the nucleotide sequence of the ClLHCP gene is shown as SEQ ID NO: 1.

[0009] In a specific embodiment, the specific method for regulating the expression level of the ClLHCP gene is: down-regulating the expression level of the ClLHCP gene in citrus plants.

[0010] In a specific embodiment, the specific way to down-regulate the expression level of the ClLHCP gene in citrus plants is: using the VIGS silencing technique to reduce the expression level of the ClLHCP gene.

[0011] In a specific embodiment, it specifically includes the following steps:

[0012] (1) Clone the VIGS fragment of the citrus ClLHCP gene;

[0013] (2) Construct a VIGS expression vector;

[0014] (3) Transform the citrus with the VIGS expression vector to obtain VIGS plants in which the citrus ClLHCP gene is silenced.

[0015] In a specific embodiment, in step (1), the cloning method of the VIGS fragment of the citrus ClLHCP gene is: extract the total RNA of citrus, reverse transcribe it into cDNA, and use the high-fidelity enzyme PCR amplification with the cDNA as a template to obtain the VIGS fragment of the citrus ClLHCP gene.

[0016] In a specific embodiment, the nucleotide sequence of the VIGS fragment of the citrus ClLHCP gene is shown as SEQ ID NO: 2.

[0017] In a specific embodiment, in step (1), the primers used for PCR amplification are ClLHCP-VIGS-F and ClLHCP-VIGS-R, and their nucleotide sequences are SEQ ID NO: 3 and SEQ ID NO: 4 respectively.

[0018] In a specific embodiment, in step (2), the construction method of the VIGS expression vector is: digest the VIGS fragment of the citrus ClLHCP gene obtained in step (1) with Xba I and Sca I enzymes, recover it, connect it with the TRV2 vector digested with the same enzymes, and transform the competent cells of Escherichia coli, extract the plasmid to obtain the VIGS expression vector of the ClLHCP gene.

[0019] In a specific embodiment, in step (3), the method for transforming the citrus with the VIGS expression vector is as follows: transforming the VIGS expression vector obtained in step (2) into Agrobacterium tumefaciens to prepare an Agrobacterium tumefaciens solution containing the VIGS expression vector, and infecting the aseptic seedlings of citrus to obtain VIGS plants with the ClLHCP gene of citrus silenced.

[0020] In a specific embodiment, it further includes verifying the VIGS plants by PCR. The primers used are TRV2-ClLHCP detection-F and TRV2-ClLHCP detection-R, and their nucleotide sequences are SEQ ID NO: 7 and SEQ ID NO: 8 respectively.

[0021] In a specific embodiment, after obtaining the VIGS plants in step (3), the VIGS plants are evaluated for resistance to citrus yellow vein clearing virus, and it is determined that silencing of the ClLHCP gene of citrus can enhance the resistance to citrus yellow vein clearing virus.

[0022] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0023] 1. A method for improving the resistance of citrus to yellow vein disease by using the ClLHCP gene provided in the embodiment of the present invention. By constructing a VIGS vector of the ClLHCP gene of citrus and then transforming citrus to reduce the transcriptional level of ClLHCP, the obtained citrus plants can show obvious resistance to citrus yellow vein disease. The titer of citrus yellow vein clearing virus can be reduced by 47%, significantly reducing the incidence of citrus yellow vein disease.

[0024] 2. A method for improving the resistance of citrus to yellow vein disease by using the ClLHCP gene provided in the embodiment of the present invention. By silencing the ClLHCP gene of citrus by VIGS, the incidence of citrus yellow vein disease can be significantly reduced, and the resistance of citrus to yellow vein disease can be improved. Moreover, TRV silencing of the ClLHCP gene of citrus does not affect the phenotype of citrus plants.

[0025] 3. A method for improving the resistance of citrus to yellow vein disease by using the ClLHCP gene provided in the embodiment of the present invention. By silencing the ClLHCP gene, the resistance of citrus plants to yellow vein disease can be greatly improved, which has great application value for citrus breeding resistant to citrus yellow vein disease. It can be used as a candidate gene to cooperate with multiple citrus yellow vein disease resistant and susceptible genes to carry out citrus yellow vein disease resistance breeding by technologies such as VIGS silencing, RNA interference and gene editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings required for the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts.

[0027] Figure 1 This is the conserved domain of citrus ClLHCP provided by the embodiments of the present invention;

[0028] Figure 2 This is the subcellular localization prediction of citrus ClLHCP provided by the embodiments of the present invention;

[0029] Figure 3 This is the transmembrane region prediction of citrus ClLHCP provided by the embodiments of the present invention;

[0030] Figure 4 This is the prediction of the secondary protein structure of citrus ClLHCP provided by the embodiments of the present invention;

[0031] Figure 5 This is the PCR amplification electrophoresis map of the VIGS fragment of the citrus ClLHCP coding gene provided by the embodiments of the present invention: VIGS represents the RNAi fragment of the ClLHCP coding gene inserted into the viral vector; M represents the DNA molecular weight standard, the same below;

[0032] Figure 6 This is the VIGS vector structure diagram of citrus ClLHCP provided by the embodiments of the present invention: GFP, green fluorescent protein; RdRp, RNA-dependent RNA polymerase; CP, coat protein; 35S, a plant constitutive promoter derived from cauliflower mosaic virus; NOS, nopaline synthase gene terminator; LB, left homology arm; RB, right homology arm;

[0033] Figure 7 This is the PCR identification map of VIGS plants provided by the embodiments of the present invention: M, molecular weight standard; detection results of the two vectors TRV2-GFP and TRV2-ClLHCP; the detection primer is the universal primer for TRV1 detection, and the band size is 700bp to detect the successful infiltration of the TRV vector into the plants;

[0034] Figure 8 This is the qRT-PCR detection map of the expression of ClLHCP in VIGS plants provided by the embodiments of the present invention: TRV2-GFP, negative control plants (the same below); TRV2-ClLHCP, plants transfected with the VIGS vector of ClLHCP (the same below); **, *** respectively indicate significant differences P<0.01, P<0.001 (the same below);

[0035] Figure 9 The phenotypic map of the VIGS plant provided by the embodiment of the present invention;

[0036] Figure 10 The disease incidence of the VIGS plant leaf after inoculating with citrus yellow vein clearing virus for 9 days provided by the embodiment of the present invention;

[0037] Figure 11 The virus titer determination of the VIGS plant leaf after inoculating with citrus yellow vein clearing virus for 20 days provided by the embodiment of the present invention. Detailed implementation manners

[0038] To make the objectives, technical solutions and advantages of the present invention more clear, the present invention will be further described in detail below with reference to the embodiments and the accompanying drawings. The illustrative embodiments and descriptions thereof of the present invention are only used to explain the present invention and shall not be construed as limiting the present invention.

[0039] Example 1

[0040] Bioinformatics analysis of citrus ClLHCP

[0041] As Figures 1-4 shown, InterPro (https: / / www.ebi.ac.uk / interpro / ) was used to predict the conserved domain of ClLHCP; WoLFPSORT (https: / / wolfpsort.hgc.jp / ) was used to predict the subcellular localization of ClLHCP; TMHMM (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ) was used to predict the transmembrane region of ClLHCP; and predictProtein (https: / / open.predictprotein.org / ) was used to predict the protein secondary domain of ClLHCP.

[0042] The nucleotide sequence of the ClLHCP gene SEQ ID NO: 1:

[0043] ATGGCAACCTCTGCTATCCAACAATCAGCATTTGCTGGCCAGACCGCCTTGAGGCAATCCAATGAGTTTGTCCGCAAGGTTGGAGTTGCTGACGGTGGCCGTATCACCATGAGGAGGACTGTCAAATCCGCTCCCCAGAGCATCTGGTACGGCCCAGACCGCCCAAAGTACTTGGGACCATTCTCTGAGCAAACACCATCATACTTGACTGGTGAGTTCCCTGGTGACTATGGCTGGGATACCGCTGGTTTATCAGCAGACCCCGAGACATTTGCTAAGAACCGTGAGCTAGAGGTGATCCACAGCAGATGGGCAATGCTTGGAGCTCTTGGCTGCGTCTTCCCTGAAATCCTCTCCAAGAATGGAGTGAAGTTCGGCGAAGCAGTTTGGTTCAAGGCTGGCGCTCAAATATTCTCTGAAGGTGGCCTTGACTATCTTGGCAACCCCAACCTCATTCATGCTCAGAGCATTTTGGCTATCTGGGCCTGCCAGGTTGTGCTTATGGGTTTTGTTGAAGGATACAGAATTGGTGGCGGTCCTCTTGGTGAAGGACTTGACCCACTTTACCCTGGTGGTGCTTTTGACCCACTTGGTTTGGCTGATGACCCCGATCAATTTGCTGAGTTGAAGGTCAAGGAGCTCAAGAATGGCCGTCTGGCTATGTTCTCCATGTTTGGATTCTTTGTTCAGGCTATTGTCACTGGGAAGGGTCCAATTGAGAACCTCTACGACCACATTGCTGATCCTGTGGCCAACAATGCCTGGGCTTATGCCACTAACTTTGTTCCCGGAAAGTGA

[0044] Example 2

[0045] This example provides a method for improving the resistance of citrus to citrus yellow vein disease by using the ClLHCP gene. By adopting the VIGS silencing technology, the expression level of the ClLHCP gene in citrus plants is reduced, and the resistance of citrus plants to citrus yellow vein disease is improved. The specific steps are as follows:

[0046] (1) Clone the VIGS fragment of the citrus ClLHCP gene, specifically as follows:

[0047] 1. RNA Extraction and cDNA Synthesis

[0048] Total RNA of citrus (Eureka lemon) leaves was extracted using the CTAB method, and its concentration was measured with a concentration meter. cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A), and the cDNA was stored at -20°C for later use.

[0049] 2. Amplification of VIGS Fragment

[0050] The VIGS fragment of the ClLHCP coding gene was cloned from citrus cDNA using the primers ClLHCP-VIGS-F (SEQ ID NO: 3) and ClLHCP-VIGS-R (SEQ ID NO: 4), and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). This fragment was determined using the SGN-VIGS website and was 300 bp in length (SEQ ID NO: 2) (as Figure 5 shown). Under ultraviolet light, the agarose gel block containing the target fragment was cut with a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1).

[0051] PCR amplification program: 98°C, 3 min; 98°C, 10 s, 55°C, 30 s, 72°C, 15 s, 35 cycles; 72°C extension for 10 min.

[0052] Nucleotide sequence of the VIGS fragment of the citrus ClLHCP gene SEQ ID NO: 2:

[0053] ATGGCAACCTCTGCTATCCAACAATCAGCATTTGCTGGCCAGACCGCCTTGAGGCAATCCAATGAGTTTGTCCGCAAGGTTGGAGTTGCTGACGGTGGCCGTATCACCATGAGGAGGACTGTCAAATCCGCTCCCCAGAGCATCTGGTACGGCCCAGACCGCCCAAAGTACTTGGGACCATTCTCTGAGCAAACACCATCATACTTGACTGGTGAGTTCCCTGGTGACTATGGCTGGGATACCGCTGGTTTATCAGCAGACCCCGAGACATTTGCTAAGAACCGTGAGCTAGAGGTGATC

[0054] The nucleotide sequence of primer ClLHCP-VIGS-F, SEQ ID NO: 3:

[0055] AAGGTTACCGAATTCTCTAGAATGGCAACCTCTGCTATCCAAC

[0056] The nucleotide sequence of primer ClLHCP-VIGS-R, SEQ ID NO: 4:

[0057] GGCCTCGAGACGCGTGAGCTCGATCACCTCTAGCTCACGGTTCTT

[0058] (2) Construction of the VIGS expression vector is as follows:

[0059] Digest the VIGS vector TRV2 with Xba I and Sca I, recover the gel, then ligate the two fragments by homologous recombination and transform competent E. coli cells, extract the plasmid to obtain the VIGS expression vector TRV2-ClLHCP (as Figure 6 shown). Among them, GFP: green fluorescent protein; RdRp: RNA-dependent RNA polymerase; CP: coat protein; 35S: plant constitutive promoter derived from cauliflower mosaic virus; NOS: terminator of the nopaline synthase gene; LB: left homologous arm; RB: right homologous arm. Transform the vector TRV2-ClLHCP into Agrobacterium by electroporation to prepare an Agrobacterium suspension containing the VIGS expression vector of the ClLHCP gene.

[0060] (3) Transformation of citrus with the VIGS expression vector to obtain VIGS plants with the ClLHCP gene of citrus silenced is as follows:

[0061] 1. Activation of Agrobacterium tumefaciens

[0062] Take 500 μL of TRV1, 500 μL of TRV2-GFP (negative control), and 500 μL of the Agrobacterium suspension of TRV2-ClLHCP and add them to 50 mL of liquid LB medium (containing 50 mg / L of kanamycin and 20 mg / L of rifampicin antibiotic), culture at 28 °C and 200 r / min until OD 600 = 1; resuspend with MMA (10 mM MgCl2, 10 nM MES, 100 μM acetosyringone) liquid and adjust OD 600 = 1.0; mix TRV1 with the TRV2-GFP and TRV2-ClLHCP vectors at a volume ratio of 1:1 and incubate at room temperature in the dark for 1 h.

[0063] 2. Agrobacterium infection

[0064] Immerse the sterile seedlings with a radicle length of 3 cm in the Agrobacterium solution and vacuum for 1 min using a vacuum pump; rinse 3 - 5 times with sterile water, insert into the seed medium, and culture in the dark at room temperature for 2 - 3 d. Observe that if green fluorescence appears, it is a positive seedling, transfer it to the soil for cultivation, and culture it under a 16 h / 8 h light / dark cycle at 25°C, watering regularly to obtain VIGS plants with the citrus ClLHCP gene silenced.

[0065] Example 3

[0066] Identification and phenotypic observation of VIGS plants

[0067] 1. PCR identification

[0068] One month later, collect tissues to extract total RNA, and use two pairs of primers, TRV2 - GFP detection - F (SEQ ID NO: 5) / TRV2 - GFP detection - R (SEQ ID NO: 6), TRV2 - ClLHCP detection - F (SEQ ID NO: 7) / TRV2 - ClLHCP detection - R (SEQ ID NO: 8), respectively, for PCR verification: Primer pairs TRV2 - GFP detection - F / R and TRV2 - ClLHCP detection - F / R can amplify bands of about 700 bp in TRV2 - GFP and TRV2 - ClLHCP positive plants respectively (as Figure 7 shown). Among them, 8 plants of the TRV1 and TRV2 - GFP negative control successfully infiltrated the TRV vector, 6 plants with CYVCV successfully infiltrated and showed CYVCV symptoms; 5 plants of TRV1 and TRV2 - ClLHCP successfully infiltrated, and 7 plants with the CYVCV bacterial solution successfully infiltrated the TRV vector. M: DNA Marker.

[0069] PCR reaction conditions: 98°C, 3 min; 98°C, 10 s, 55°C, 30 s, 72°C, 15 s, 35 cycles; 72°C extension for 10 min.

[0070] The nucleotide sequence of primer TRV2 - GFP detection - F SEQ ID NO: 5:

[0071] TGGTCAAGGTACGTAGTAGAGTCCCA

[0072] The nucleotide sequence of primer TRV2 - GFP detection - R SEQ ID NO: 6:

[0073] CTCGTCAGTGTACTGATATAAG

[0074] The nucleotide sequence of primer TRV2 - ClLHCP detection - F SEQ ID NO: 7:

[0075] CAATGCACGAATTACTTAGGAAGTG

[0076] Nucleotide sequence of primer TRV2-ClLHCP detection-R, SEQ ID NO: 8:

[0077] CGTCTGTACTTATATCAGTACACTG

[0078] 2. qRT-PCR analysis

[0079] qRT-PCR was performed using primers ClLHCP-RT-F (SEQ ID NO: 9) and ClLHCP-RT-R (SEQ ID NO: 10) to verify whether ClLHCP was successfully silenced. The gene expression levels of TRV1 and TRV2-GFP vector plants were set to 1. If the ClLHCP gene expression level of the plants containing the target fragment vector was less than 1, gene silencing occurred. Three parallel samples were set for each of the TRV2-GFP and TRV2-ClLHCP vector plants in this application. After identification, in the TRV2-GFP vector plants, the ClLHCP gene expression levels were 0.982275826, 0.944953697, and 0.976551247 respectively; in the TRV2-ClLHCP vector plants, the ClLHCP gene expression levels were 0.428040660, 0.540331993, and 0.370893771 respectively. The ClLHCP transcription level in the TRV2-ClLHCP vector plants decreased by 44% (as Figure 8 shown).

[0080] qRT-PCR reaction conditions: 95°C for 3 min, 95°C for 15 s; 60°C for 15 s, 72°C for 15 s, 40 cycles.

[0081] Nucleotide sequence of primer ClLHCP-RT-F, SEQ ID NO: 9:

[0082] CAGTTTGGTTCAAGGCTGGC

[0083] Nucleotide sequence of primer ClLHCP-RT-R, SEQ ID NO: 10:

[0084] GGACCGCCACCAATTCTGTA

[0085] 3. Phenotypic observation

[0086] Observing the phenotypes of the VIGS plants of the ClLHCP gene, no obvious abnormalities were found in appearance and growth vigor (as Figure 9As shown). It shows that the silencing of ClLHCP did not have an obvious impact on the phenotype and development of the plants.

[0087] Example 4

[0088] Resistance evaluation of VIGS plants

[0089] Thirty days after silencing the ClLHCP gene, three plants were selected for inoculation with citrus yellow vein clearing virus by injection, and three were inoculated with the empty vector control, that is, three parallel samples were set for each of the TRV2-GFP and TRV2-ClLHCP vector plants.

[0090] 1. Phenotype observation

[0091] Since the onset time of CYVCV after inoculation in the seedling stage is generally 7 - 10 days, in this application, symptoms were observed 9 days after inoculation. Three parallel samples were set for each of the TRV2-GFP and TRV2-ClLHCP vector plants. It was found that the symptoms of leaf yellowing (referring to local mesophyll cell yellowing, not the whole leaf turning yellow) and vein clearing in the plants with the ClLHCP gene silenced and inoculated with CYVCV were alleviated compared with the control group (as Figure 10 shown).

[0092] 2. Virus titer detection

[0093] Twenty days after re-inoculating citrus yellow vein clearing virus into the leaves of VIGS plants in this application, qRT-PCR was performed using the primers CYVCV CP-RT-F (SEQ ID NO: 11) and CYVCV CP-RT-R (SEQ ID NO: 12) to verify the titer content of citrus yellow vein clearing virus. Since the leaves were too small 9 days after inoculation to reach the sampling amount, and TRV silencing may lose its effect around 45 days, so in this application, the virus content was detected when the leaf amount reached 20 days and within the TRV silencing time. Three parallel samples were set for each of the TRV2-GFP and TRV2-ClLHCP vector plants in this application. After identification, in the TRV2-GFP vector plants, the accumulation amounts of CYVCV were 0.889062476, 1.105953210, and 1.004984314 respectively. In the TRV2-ClLHCP vector plants, the accumulation amounts of CYVCV were 0.446031281, 0.431400014, and 0.548797722 respectively. Therefore, the accumulation amount of CYVCV in the plants with ClLHCP silenced was significantly lower than that of the plants infiltrated with TRV2-GFP, and the virus content decreased by 47% (as Figure 11 shown).

[0094] The nucleotide sequence of primer CYVCV CP-RT-F SEQ ID NO: 11:

[0095] TCCAACTCACAAACCCAGCG

[0096] The nucleotide sequence of primer CYVCV CP-RT-R, SEQ ID NO: 12:

[0097] ATGGGCTCTTGGTTTTCCTT

[0098] It can be seen that the interference of ClLHCP can greatly reduce the accumulation of citrus yellow vein clearing virus and alleviate the incidence of citrus yellow vein disease. This gene can be independently used for disease-resistant molecular breeding of citrus, or can be used together with other disease-resistant or disease-susceptible genes for molecular breeding of citrus against citrus yellow vein disease.

[0099] The specific embodiments described above further elaborate on the purpose, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for improving resistance to citrus yellow vein disease using the ClLHCP gene, characterized in that: The expression level of the ClLHCP gene in citrus plants is reduced by adopting VIGS silencing technology, thereby improving the resistance of citrus plants to citrus yellow vein disease. The nucleotide sequence of the ClLHCP gene is shown in SEQ ID NO:

1.

2. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 1, characterized in that: The specific steps include: (1) Cloning the VIGS fragment of the citrus ClLHCP gene; the nucleotide sequence of the VIGS fragment of the citrus ClLHCP gene is shown in SEQ ID NO: 2 (2) Construction of VIGS expression vector; (3) The VIGS expression vector was used to transform citrus to obtain VIGS plants in which the ClLHCP gene of citrus was silenced.

3. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 2, characterized in that: In step (1), the cloning method of the VIGS fragment of the citrus ClLHCP gene is: extracting total RNA from citrus, reverse transcribing it into cDNA, and using the cDNA as a template to amplify the VIGS fragment of the citrus ClLHCP gene using high-fidelity enzyme PCR.

4. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 3, characterized in that: In step (1), the primers used for PCR amplification are ClLHCP-VIGS-F and ClLHCP-VIGS-R, whose nucleotide sequences are SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

5. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 3, characterized in that: In step (2), the method for constructing the VIGS expression vector is as follows: the VIGS fragment of the citrus ClLHCP gene obtained in step (1) is digested with XbaI and ScaI, recovered, connected with the TRV2 vector digested with the same enzymes, and transformed into Escherichia coli competent cells, and the plasmid is extracted to obtain the VIGS expression vector of the ClLHCP gene.

6. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 3, characterized in that: In step (3), the method for transforming citrus with the VIGS expression vector is as follows: the VIGS expression vector obtained in step (2) is transformed into Agrobacterium, an Agrobacterium liquid containing the VIGS expression vector is prepared, and the Agrobacterium liquid is infected with sterile citrus seedlings to obtain VIGS plants in which the ClLHCP gene of citrus is silenced.

7. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 6, characterized in that: The method also includes verifying the VIGS plants by PCR, using primers TRV2-ClLHCP Detection-F and TRV2-ClLHCP Detection-R, whose nucleotide sequences are SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

Images