Nucleic acid molecule and application thereof

Abstract

The invention relates to the field of biological medicine, in particular to a nucleic acid molecule and application thereof. According to the nucleic acid molecule disclosed by the invention, the degradation stability of the circular RNA relative to ribonuclease DIS3 can be adjusted by constructing the nucleic acid molecule in the circular RNA or removing the nucleic acid molecule. According to another nucleic acid molecule provided by the invention, the nucleic acid molecule is constructed or removed in the circular RNA, so that the condition of nucleus removal or nucleus retention of the circular RNA can be regulated and controlled.

Description

Technical Field

[0001] The present application relates to the field of biomedicine, and in particular, to a nucleic acid molecule and its application. Background Art

[0002] Circular RNA (circRNA) is a covalently closed non-coding RNA that is generated by back-splicing of pre-mRNA. Due to its special structure, circular RNA has stronger stability than linear RNA of the same gene. The degradation of RNA molecules mainly depends on the hydrolysis of phosphodiester bonds in RNA molecules by ribonucleases in the body. Ribonucleases can be divided into endoribonucleases and exoribonucleases. Exoribonucleases can be divided into 5'-3' exoribonucleases that remove 5'-end ribonucleotides and 3'-5' exoribonucleases that remove 3'-end ribonucleases. Most linear RNAs have exposed 5' and 3' ends, so they can be degraded by 5'-3' exoribonucleases and 3'-5' exoribonucleases as well as endoribonucleases. However, for circular RNA, there is no exposed 5' and 3' structure. Therefore, it is necessary to develop a scheme to effectively degrade circular RNA.

[0003] In addition, due to its special circular structure and lack of 5'-end 7-methylguanylate "cap" structure and 3'-end polyadenylate "tail", circular RNA has many unique physiological properties. For example, in addition to good stability, circular RNA can also be translated in low amounts through the internal ribosome entry site (IRES). These characteristics make circular RNA have good clinical medicinal prospects. Compared with traditional mRNA and protein drugs, the use of circular RNA may be more gentle and long-lasting. In order to apply circular RNA for clinical treatment more efficiently and safely, it is particularly important to achieve artificial regulation of the in vivo localization of circular RNA. Summary of the invention

[0004] Based on this, one or more embodiments of the present application provide a nucleic acid molecule, by constructing the nucleic acid molecule in the circular RNA or removing the nucleic acid molecule, the degradation stability of the circular RNA relative to the ribonuclease DIS3 can be adjusted. Another or more embodiments of the present application provide another nucleic acid molecule, by constructing or removing the nucleic acid molecule in the circular RNA, the situation of the circular RNA exiting the nucleus or being retained in the nucleus can be regulated.

[0005] One embodiment of the present application provides the use of ribonuclease DIS3 or its mutant in the preparation of a degradation agent for circular RNA, or the use of ribonuclease DIS3 or its mutant as a degradation agent in degrading circular RNA;

[0006] The mutant has both endonuclease activity and exonuclease activity.

[0007] In some embodiments of the present application, the circular RNA comprises a uracil-rich motif.

[0008] In some embodiments of the present application, the length of the motif is 4 bp to 10 bp.

[0009] In some embodiments of the present application, the proportion of uracil in the motif is 28% to 70%.

[0010] In some embodiments of the present application, the motif includes one or more of the P1 motif, the P2 motif and the P3 motif:

[0011] The nucleotide sequence of the P1 motif is UU[C / U]GCU;

[0012] The nucleotide sequence of the P2 motif is GCUCUGC;

[0013] The nucleotide sequence of the P3 motif is GUUGCCU.

[0014] In some embodiments of the present application, the motif includes a C1 motif; the nucleotide sequence of the C1 motif is UUUGCUG.

[0015] In some embodiments of the present application, the number of the C1 motifs is 15 to 25; or / and, a plurality of the C1 motifs are continuously distributed in the circular RNA.

[0016] In some embodiments of the present application, the mutant has one of the following mutations: D146N and D487N.

[0017] Another embodiment of the present application provides a method for preparing circular RNA, which comprises the following steps:

[0018] Constructing the motif defined in the above embodiment in the target circular RNA to prepare the easily degradable circular RNA; or,

[0019] The motifs defined in the above embodiments present in the target circular RNA are removed to prepare circular RNA that is not easily degraded.

[0020] In some embodiments of the present application, the method for removing the motif comprises mutating uracil to other bases.

[0021] Another embodiment of the present application provides a nucleic acid molecule, whose nucleotide sequence is UU[C / U]GCU, GCUCUGC, GUUGCCU or UUUGCUG.

[0022] Another embodiment of the present application provides the use of an expression regulating reagent of polyadenylic acid binding protein PABPC1 and / or nucleoporin TPR in the preparation of a reagent for regulating the export of circular RNA from the nucleus.

[0023] In some embodiments of the present application, the circular RNA comprises an adenine-rich motif.

[0024] In some embodiments of the present application, the length of the motif is 6 bp to 10 bp.

[0025] In some embodiments of the present application, the proportion of adenine in the motif is 50% to 100%.

[0026] In some embodiments of the present application, the motif includes one or more of a P4 motif, a P5 motif, a P6 motif, a P7 motif and a P8 motif:

[0027] The nucleotide sequence of the P4 motif is AAATATGT;

[0028] The nucleotide sequence of the P5 motif is AAATAAAA;

[0029] The nucleotide sequence of the P6 motif is AAGAAATG;

[0030] The nucleotide sequence of the P7 motif is AAAGAGAA;

[0031] The nucleotide sequence of the P8 motif is AAAAAAAA.

[0032] Another embodiment of the present application provides a method for preparing circular RNA, which comprises the following steps:

[0033] Constructing the motif defined in the above embodiment in the target circular RNA to prepare circular RNA that is easy to be exported from the cell nucleus; or,

[0034] The motifs defined in the above examples present in the target circular RNA are removed to prepare circular RNA that is easily retained in the cell nucleus.

[0035] In some embodiments of the present application, the method of removing the motif includes deleting the motif.

[0036] Another embodiment of the present application provides a method for regulating the export of circular RNA from the nucleus of a target cell, which comprises the step of regulating the export of circular RNA from the nucleus by regulating the expression of polyadenylic acid binding protein PABPC1 and / or nuclear pore protein TPR in the target cell.

[0037] Another embodiment of the present application provides a nucleic acid molecule, whose nucleotide sequence is AAATATGT, AAATAAAA, AAGAAATG, AAAGAGAA or AAAAAAAA.

[0038] Compared with the traditional technology, the beneficial effects of this application include:

[0039] The present application found that DIS3 can degrade circular RNA, especially effectively degrade circular RNA with U-rich (uracil-rich) characteristics, providing a new and effective method for degrading circular RNA. In addition, after studying the sequence preference of DIS3 protein for degrading circular RNA, the present application provides a short nucleotide motif, which provides a new idea for changing the stability of circular RNA.

[0040] At the same time, this application studied the regulatory effect of PABPC1 and TPR on the nuclear export of circular RNA, and found that the two functions regulate the nuclear export of circular RNA rich in short adenosine motifs, providing a new method for changing the localization of circular RNA in cells and providing good technical support for the precise use of circular RNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0042] Figure 1A This is a protein immunoblot validation diagram in Example 1; the results show that protein immunoblot validation of DIS3 protein knockdown in 293T cells;

[0043] Figure 1BThe results of the real-time fluorescence quantitative amplification detection experiment in Example 1 show that the real-time fluorescence quantitative amplification detection experiment compares the difference in circular RNA levels between the cell lines with low DIS3 protein expression levels and the cell lines with normal DIS3 protein expression levels;

[0044] Figure 1C The results of the real-time fluorescence quantitative amplification detection experiment in Example 1 show that the real-time fluorescence quantitative amplification detection experiment compares the difference in circular RNA levels between the cell lines with low DIS3 protein expression levels and the cell lines with normal DIS3 protein expression levels;

[0045] Figure 2A The in vitro purified DIS3 protein and its mutant structure and purity test results in Example 2;

[0046] Figure 2B The results of the digestion of the fluorescence quenching substrate by the DIS3 protein and its mutants in Example 2 are shown; the results show that for the digestion of the fluorescence quenching substrate, DIS3-WT exhibits the best digestion activity, DIS3-D146N and D487N have partial nuclease activity, and DMU completely loses its nuclease ability;

[0047] Figure 2C The results of using RNaseR to verify the synthesized circular RNA and linear RNA in Example 2;

[0048] Figure 2D This is the result of using the DIS3 protein purified from Escherichia coli to degrade the circular RNA synthesized in vitro in Example 2;

[0049] Figure 3A The circular RNA in Example 3 will be enriched into its separate components by DIS3 protein in the sucrose density gradient centrifugation experiment;

[0050] Figure 4A The sequence preference result of circular RNA degradation by DIS3 protein in Example 4 shows that most circular RNAs affected by DIS3 protein have three short nucleotide elements, namely P1: UU[C / U]GCU; P2: GCUCUGC; P3: GUUGCCU; and can be further summarized and optimized into a short nucleotide element C1: UUUGCUG with uracil-rich characteristics;

[0051] Figure 4B The degradation conditions of circular RNA circUBAC2 (2-4) with multiple motifs and circular RNA circSRSF4 (8) without motifs in Example 4;

[0052] Figure 4CThe degradation results of the modified circular RNA in Example 4 are shown. The results show that compared with circular RNA circUBAC2(2-4), the circular RNA circUBAC2(2-4)-Δmotif with the motif sequence removed was significantly degraded by DIS3-WT at a lower rate. Compared with circSRSF4(8), the circSRSF4(8)-20C1 with 20 consecutive C1 motifs added was significantly degraded by DIS3-WT at a higher rate.

[0053] Figure 5A The results of the test on the degradation rate of the modified DIS3-preferred fragment on the circular RNA in Example 5 show that the DIS3-preferred motif P1, 2, and 3 on the circular RNA circUBAC2(2-4) was removed by mutating uracil to adenylic acid to obtain the circular RNA circUBAC2(2-4)-mut without the DIS3-preferred motif; 20 consecutive DIS3-preferred C1 motifs were added to the circular RNA circSRSF4(8) without the DIS3-preferred motif to obtain the circular RNA circSRSF4(8)-20C1, and on the other hand, the uracil on the C1 motif was replaced with adenylic acid to obtain the N1 motif without the DIS3-preferred property, which was added to the circular RNA circSRSF4(8) to obtain the circular RNA circSRSF4(8)-20N1 without the DIS3-preferred motif;

[0054] Figure 5B The results of the test on the degradation rate of the modified DIS3-preferred fragment on the circular RNA in Example 5 show that compared with the circular RNA circUBAC2(2-4), the circular RNA circUBAC2(2-4)-mut with the mutated motif sequence has a significantly lower degradation rate in the cell; compared with the circSRSF4(8)-20N1 without the DIS3-preferred motif, the circSRSF4(8)-20C1 with 20 consecutive DIS3-preferred C1 motifs has a significantly higher degradation rate in the cell;

[0055] Figure 6 The distribution of circRNA, mRNA and lncRNA in the cytoplasm and nucleus of H9 cells in Example 6;

[0056] Figure 7 This is the base preference analysis of the circular RNA localized in the cytoplasm and nucleus of H9 cells in Example 6;

[0057] Figure 8The results of screening for homologous circular RNAs co-existing in the cytoplasm and nucleus in H9 cells and analysis of their adenylate content in Example 6;

[0058] Fig. 9 The localization analysis of the good circular RNA produced by the RTN4 transcript in Example 6;

[0059] Fig.10 The cytoplasmic and nuclear localization and base preference analysis of circular RNA in mouse R1 cells in Example 6;

[0060] Fig.11 This is a schematic diagram of H9 cell differentiation into FB cells in Example 6;

[0061] Fig.12 This is the analysis of the cytoplasmic and nuclear distribution of peripheral red circular RNA in H9 cells and FB cells in Example 6;

[0062] Fig.13 is the ratio of circRNA, mRNA and lncRNA exported from the nucleus during the differentiation of H9 to FB in Example 6;

[0063] Fig.14 This is the base preference analysis of circular RNA exported from the nucleus during the differentiation of H9 cells into FB cells in Example 6;

[0064] Fig.15 This is the analysis of the short nucleotide elements of the nuclear-exporting circular RNA in Example 6;

[0065] Fig.16 This is an analysis of the nuclear export of circular RNA containing short nucleotide motifs regulated by PABPC1 in Example 6;

[0066] Fig.17 This is the experimental analysis of the binding of PABPC1 to short nucleotide element repeat sequences and circular RNA in Example 6;

[0067] Fig.18 The interaction between PABPC1 and the 5' end of nucleoporin TPR in Example 6;

[0068] Fig.19 The localization and positional relationship analysis of PABPC1, TPR and nuclear pore complex in Example 6;

[0069] Fig. 20 This is an analysis of the effect of TPR knockdown on the nuclear export of circular RNA and homologous linear RNA in Example 6;

[0070] Fig.21 This is a schematic diagram of analyzing the subcellular localization of circular RNA after adding or deleting short nucleotide elements in Example 7;

[0071] Fig. 22 Analysis of nuclear export of circular RNA circADCY2 (2, 3), circRTN4 (4, 5), and circLDLRAD3 (5) localized in the cytoplasm of H9 in Example 7 after adding short nucleotide elements;

[0072] Fig.23 This is an analysis of the distribution of short nucleotide elements of the circular RNA circMAN1A2(2-5) located in the H9 nucleus in Example 7 and the nuclear export after deleting the sequence containing the 22-135nt short nucleotide elements. DETAILED DESCRIPTION

[0073] The present application will be further described in detail below in conjunction with the accompanying drawings, embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present application and are not used to limit the scope of the present application. The purpose of providing these embodiments and examples is to make the understanding of the disclosure of the present application more thorough and comprehensive. It should also be understood that the present application can be implemented in many different forms, is not limited to the embodiments and examples described herein, and those skilled in the art can make various changes or modifications without violating the connotation of the present application, and the equivalent form obtained also falls within the protection scope of the present application. In addition, in the description below, a large number of specific details are given in order to provide a more comprehensive understanding of the present application, and it should be understood that the present application can be implemented without one or more of these details.

[0074] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing implementation modes and embodiments and are not intended to limit this application.

[0075] the term

[0076] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0077] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0078] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0079] As used herein, "combination thereof", "any combination thereof", "any combination thereof" etc. include all suitable combinations of any two or more of the listed items.

[0080] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc., shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0081] In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0082] In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0083] In this application, "one embodiment", "another embodiment", etc. are used for descriptive purposes only and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, they only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0084] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0085] In the present application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1 to 10, indicating that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges included therein.

[0086] The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

[0087] In the present application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0088] In the present application, natural circular RNA (circRNA) is a type of single-stranded closed circular RNA molecule mainly formed by reverse splicing of messenger RNA precursor (pre-mRNA) exons. Due to its special circular structure, it lacks the 5'-end 7-methylguanylate "cap" structure and the 3'-end polyadenylate "tail". It is understandable that those skilled in the art can also synthesize it artificially according to needs.

[0089] In this application, a motif refers to a short nucleic acid segment with characteristics in a nucleic acid.

[0090] In the present application, "[C / U]" means that the position can be either C or U.

[0091] In the present application, degradation mainly refers to the hydrolysis of phosphodiester bonds, which can occur in vivo or in vitro.

[0092] One embodiment of the present application provides the use of ribonuclease DIS3 or its mutant in the preparation of a degradation agent for circular RNA, or the use of ribonuclease DIS3 or its mutant as a degradation agent in degrading circular RNA;

[0093] The mutant has both endonuclease activity and exonuclease activity.

[0094] Optionally, the circular RNA comprises a uracil-rich motif.

[0095] Optionally, the length of the motif is 4 bp to 10 bp (for example, 4, 5, 6, 7, 8, 9, 10 bp), and further optionally, is 6 bp or 7 bp.

[0096] Optionally, the proportion of uracil in the motif is 28% to 70% (for example, about 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%).

[0097] Optionally, the motif includes one or more of a P1 motif, a P2 motif and a P3 motif:

[0098] The nucleotide sequence of the P1 motif is UU[C / U]GCU;

[0099] The nucleotide sequence of the P2 motif is GCUCUGC;

[0100] The nucleotide sequence of the P3 motif is GUUGCCU.

[0101] Further optionally, the circular RNA includes multiple motifs of P1, P2 and P3, and further, includes the P1, P2 and P3 motifs simultaneously.

[0102] Optionally, the motif includes a C1 motif; the nucleotide sequence of the C1 motif is UUUGCUG.

[0103] Further optionally, the number of the C1 motifs is 15 to 25 (for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25). It is understandable that the present application does not specifically limit the distribution of the multiple C1 motifs in the circular RNA, and they may be uniformly or unevenly randomly distributed in the circular RNA. For example, the multiple C1 motifs are continuously distributed in the circular RNA. "Continuously distributed" in the present application refers to adjacent C1 motifs, the 3' end of one and the 5' end of the other are directly connected by a phosphodiester bond.

[0104] As for the mutants in the present application, as long as they have endonuclease activity, or both endonuclease activity and exonuclease activity, the present application does not make any special limitation on the mutants, and may be, but is not limited to, a mutant having one of the following mutations: D146N and D487N.

[0105] Another embodiment of the present application provides a method for preparing circular RNA, which comprises the following steps:

[0106] Constructing the motif defined in the above embodiment in the target circular RNA to prepare the easily degradable circular RNA; or,

[0107] The motif defined above in the target circular RNA is removed to prepare a circular RNA that is not easily degraded.

[0108] The term "easy to degrade" or "not easy to degrade" in the present application refers to ribonuclease DIS3 or its mutants.

[0109] The present application does not particularly limit the method for constructing the motif. The motif may be directly inserted into a circular RNA that does not have the motif, or one or more bases in the circular RNA that does not have the motif may be directly mutated, deleted, etc., to ultimately form the motif on the circular RNA.

[0110] The present application does not particularly limit the method for removing the motif, which may be direct deletion, or mutation of the U contained therein to other bases, such as replacement with A.

[0111] Another embodiment of the present application provides a nucleic acid molecule, whose nucleotide sequence is UU[C / U]GCU, GCUCUGC, GUUGCCU or UUUGCUG.

[0112] Another embodiment of the present application provides the use of an expression regulating reagent of polyadenylic acid binding protein PABPC1 and / or nucleoporin TPR in the preparation of a reagent for regulating the export of circular RNA from the nucleus.

[0113] Optionally, the circular RNA comprises an adenine-rich motif.

[0114] Optionally, the length of the motif is 6 bp to 10 bp (eg, 6, 7, 8, 9, 10 bp).

[0115] Optionally, the proportion of adenine in the motif is 50% to 100% (for example, about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%).

[0116] Optionally, the motif includes one or more of a P4 motif, a P5 motif, a P6 motif, a P7 motif and a P8 motif:

[0117] The nucleotide sequence of the P4 motif is AAATATGT;

[0118] The nucleotide sequence of the P5 motif is AAATAAAA;

[0119] The nucleotide sequence of the P6 motif is AAGAAATG;

[0120] The nucleotide sequence of the P7 motif is AAAGAGAA;

[0121] The nucleotide sequence of the P8 motif is AAAAAAAA.

[0122] Another embodiment of the present application provides a method for preparing circular RNA, which comprises the following steps:

[0123] Constructing the motif defined in the above embodiment in the target circular RNA to prepare circular RNA that is easy to be exported from the cell nucleus; or,

[0124] The motifs defined in the above examples present in the target circular RNA are removed to prepare circular RNA that is easily retained in the cell nucleus.

[0125] The present application does not particularly limit the method for constructing the motif. The motif may be directly inserted into a circular RNA that does not have the motif, or one or more bases in the circular RNA that does not have the motif may be directly mutated, deleted, etc., to ultimately form the motif on the circular RNA.

[0126] The present application does not particularly limit the method for removing the motif, which may be direct deletion of the motif, or mutation of the A having the motif to other bases.

[0127] Another embodiment of the present application provides a method for regulating the export of circular RNA from the nucleus of a target cell, which comprises the step of regulating the export of circular RNA from the nucleus by regulating the expression of polyadenylic acid binding protein PABPC1 and / or nuclear pore protein TPR in the target cell.

[0128] In the present application, regulation may be up-regulation or down-regulation, promoting the expression of PABPC1 and / or TPR, promoting the nuclear export of circular RNA, and vice versa, inhibiting the nuclear export.

[0129] Another embodiment of the present application provides a nucleic acid molecule, whose nucleotide sequence is AAATATGT, AAATAAAA, AAGAAATG, AAAGAGAA or AAAAAAAA.

[0130] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0131] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0132] DIS3 protein is an evolutionarily conserved ribozyme in the Exosome Complex. It is an orthologous protein of the RNase II / RNP superfamily. It exists in most organisms from bacteria to humans and has endoribonuclease activity and 3'-5' end exoribonuclease activity. The RNB motif of DIS3 protein has been confirmed to be related to its 3'-5' exoribonuclease activity, and its PIN motif has been confirmed to be related to its endoribonuclease activity, and the PIN motif plays an important role in the activity of DIS3 protein. The PIN domain is a compact domain of about 100 amino acids, which exists in proteins of organisms from various kingdoms. This motif is usually found in enzymes involved in RNA processing, such as SMG5 and SMG6 proteins. The PIN motif contains three to four conserved acidic amino acids, which are used to coordinate divalent metal ions to catalyze RNA cleavage and release 5' monophosphate nucleotides (nucleotide 5'monophosphate) products.

[0133] The present application believes that circular RNA is mainly degraded by endoribonuclease. It has been verified that DIS3 can effectively degrade circular RNA with U-rich characteristics. At the same time, we also modify circular RNA in vitro so that circular RNA can be more or less easily degraded by DIS3 protein.

[0134] Example 1: Knockdown of DIS3 protein expression using shRNA in 293T cells results in upregulation of the expression levels of some circular RNAs in the cells

[0135] In order to study the correlation between DIS3 protein level and circular RNA level in 293T cells, two shRNAs that can effectively reduce hDIS3 protein level in 293T cells were designed in the present embodiment. Plasmids plKO.1-shDIS3-1 and plKO.1-shDIS3-4 expressing these two shRNAs were constructed, and lentivirus that can be integrated into the 293T cell genome and express these two plasmid shRNA fragments was packaged using 293FT cells. The packaged lentivirus was infected with 293T cells and screened with puromycin to obtain a 293T cell line with stable reduced DIS3 protein expression level, which was identified using a protein immunoblotting experiment ( Figure 1A ).

[0136] The RNA of the cell line was extracted. The RNA extraction method was as follows: first, the culture medium was discarded, the cells were washed twice with PBS, and the liquid was aspirated. The cells were placed on ice and Trizol reagent was added (1 mL for a 10 cm culture dish; 0.5 mL for a 6 cm culture dish; 0.2 mL for each empty well of a 6-well plate). The liquid became viscous, the cells were detached from the wall, and the liquid was fully blown until clear. The cell lysate was aspirated into a DEPC-treated EP tube, 0.2 times the volume of chloroform was added, the tube was shaken for 15 seconds, inverted several times, and allowed to stand at room temperature for 2-3 minutes. Centrifuged at 4°C 12000g for 15 minutes, and the liquid was layered: bottom layer - red phenol chloroform phase; middle layer - pink junction phase; upper layer - colorless liquid phase, all RNA was in this phase. Carefully transfer the supernatant to a new EP tube, and do not aspirate the middle layer. Add an equal volume of isopropanol, inverted several times, and allowed to stand at room temperature for 10 minutes. Centrifuge at 4℃12000g for 15 minutes, discard the supernatant, and a small milky white precipitate can be seen at the bottom of the EP tube, which is RNA. Add 1mL 75% DEPC-ethanol and wash twice. Aspirate the supernatant and air-dry for 10 minutes. Add 20-30μL of DEPC water, mix well, and dissolve RNA. Measure the concentration: A260 / 280 between 1.8-2.0, A260 / 230 around 2.0; A260 between 0.1-1, and store the sample at -80℃.

[0137] Then reverse transcription was performed to obtain cDNA. The reverse transcription system was as follows: 5× PrimerScript RT Master Mix (for Real Time), RNA 1 μg, DEPC treated water.

[0138] The difference in circular RNA levels between cell lines with low DIS3 protein expression levels and cell lines with normal DIS3 protein expression levels was compared using a real-time fluorescence quantitative amplification assay. The real-time fluorescence quantitative amplification assay was performed in a Biorad realtime PCR instrument. The reaction system was as follows: 2×SYBR Green Taq Mix, Primer (F+R) 10μM, cDNA 1μL, ddH2O 8μL. The reaction conditions were as follows:

[0139] Table 1

[0140]

[0141] It was found that in the 293T cell line with low DIS3 protein expression level, the levels of circular RNA circLRP6 (2), circPRMT5 (4-7), and circUBAC2 (2-4) were significantly increased ( Figure 1B ). Figure 1B Among the three groups of results, each group corresponds to scramble, DIS3-sh1 and DIS3-sh2 from left to right.

[0142] The detection primer pair of circLRP6(2) is: upstream primer (SEQ ID NO.1): ctggcatgtgattggcttgg; downstream primer (SEQ ID NO.2): atcgcaagtcccgtctgttt. The detection primer pair of circPRMT5(4-7) is: upstream primer (SEQ ID NO.3): catcttccggctcctcaagg; downstream primer (SEQ ID NO.4): ggtcaaaactctggccaggt. The detection primer pair of circUBAC2(2-4) is: upstream primer (SEQ ID NO.5): tcactgcagctagtaatttgcc; downstream primer (SEQ ID NO.6): acacaaagagcttctggcagt.

[0143] The present application further uses Northern blot hybridization experiments to detect and verify the level changes of circular RNA circLRP6 (2), circPRMT5 (4-7), and circUBAC2 (2-4). First, the probes for Northern blot hybridization experiments of circLRP6 (2) and circPRMT5 (4-7) were designed, and then the DIG Northern Starter Kit of Roche was used to synthesize digoxigenin-labeled probes for Northern blot hybridization experiments. The experimental process was carried out according to the DIG Northern Starter Kit of Roche. The results of the Northern blot experiment also showed that the levels of circular RNA circLRP6 (2) and circPRMT5 (4-7) in the 293T cell line with low DIS3 protein expression level were significantly increased ( Figure 1C ).

[0144] Example 2: Degradation of in vitro synthesized circular RNA using DIS3 protein purified from Escherichia coli

[0145] First, the present application example purified different versions of DIS3 protein in vitro, including DIS3-WT, DIS3-D146N (endonuclease activity mutation), DIS3-D487N (exonuclease activity mutation) and DIS3-DMU (with D146N and D487N double mutations). The expression plasmid with His-tagged protein (with PET-28a plasmid as backbone vector) was transformed into E. coli expression strain BL21 [Transetta (de3) competent cells (Transgen Biotech, CD801)]. 5mL LB medium with 100mg / L kanamycin and monoclonal colonies were added and incubated at 37°C at 250rpm. After overnight growth, the culture was diluted into 1L LB medium with 100mg / L kanamycin. The absorbance was monitored at a wavelength of 600nm, and when the absorbance reached 0.4 (OD600=0.4), 1mM IPTG was added to induce protein expression. After overnight incubation at 180rpm (16°C), the expression bacteria were collected by centrifugation (5,000rpm, 10 minutes, 4°C). The expression bacteria were resuspended in lysis buffer (25mMTris pH 8.0, 500mMNaCl, 10mM imidazole, 1mM PMSF), and 1mg / mL lysozyme was added, followed by ultrasonic treatment on ice for 10 minutes (5s ON / OFF). After centrifugation at 10,000rpm for 30 minutes at 4°C, the supernatant cell lysate was incubated with Ni Sepharose (GE Healthcare) at 4°C for 2 hours. Sepharose was washed 4 times with washing buffer (25mM Tris pH 8.0, 500mM NaCl, 20mM imidazole, 1mM PMSF), and the bound protein was eluted with elution buffer (25mM Tris pH8.0, 500mM NaCl, 300mM NaCl, 300mM imidazole). Then, the protein was further purified on gel filtration chromatography (SuperDex-200; GE Healthcare) equilibrated with imidazole-free buffer (25 mM Tris pH = 8.0, 500 mM NaCl, 10% glycerol). The concentration of the purified protein was determined by using a modified Bradford protein assay kit (Sangon Biotech, C503041), and the purified protein samples were subjected to SDS-PAGE electrophoresis and the protein purity was checked by staining with Coomassie Brilliant Blue ( Figure 2A ).

[0146] Next, the present invention uses fluorescent-quenched RNA as a reporter substrate to verify their nuclease activity. The reporter substrate emits fluorescence after being cut by DIS3 or its mutants. Among them, DIS3-WT exhibits the best digestion activity, DIS3-D146N and DIS3-D487N have partial nuclease activity, and DIS3-DMU completely loses its nuclease ability ( Figure 2B ). Figure 2B The curves in the figure correspond to RNase A, DIS3-WT, DIS3-D146N, DIS3-D487N, DIS3-DMU and Blank from top to bottom, and the curves corresponding to DIS3-DMU and Blank are basically overlapping.

[0147] Then, the present invention uses NEB's T4 ligase to synthesize and purify circular and linear circPRMT5 (4-7) and circLRP6 (2). The synthesis system is as follows: 5'-phosphorylated linear RNA 1 μM, PEG6000 10%, 10×T4 Ligase buffer, T4Ligase 0.05U / μL. The purified circular and linear circPRMT5 (4-7) were verified by RNase R ( Figure 2C ).

[0148] Next, for in vitro cleavage assays, the purified circular or linear RNA was incubated with DIS3 protein at 37°C, and the incubation was terminated at different time points. The reaction system was: Tris-HCl pH=8.0 10mM, NaCl 75mM, 2-mercaptoethanol 1mM, MgCl21mM, RNA 0.5μM, Protein 0.5μM.

[0149] The incubated samples were subjected to denaturing polyacrylamide gel electrophoresis and stained with ethidium bromide to see the digestion results. Figure 2D . Combined Figure 2DIt can be seen that: First, DIS3-WT effectively digested circPRMT5(4-7) and circLRP6(2) in vitro, indicating that DIS3 protein can independently degrade circular RNA in vitro without the exonuclease complex. Second, DIS3-D146N and DIS3-DMU almost completely lost the ability to degrade circular RNA in vitro, consistent with the dependence of DIS3's endonuclease activity. Third, in DIS3-D487N, the ability to degrade circular RNA decreased, which supports the cooperation of substrate degradation between the endonuclease and nuclease activities of DIS3. Fourth, unlike in cells, DIS3-WT can also digest linear circPRMT5(4-7) and circLRP6(2) in vitro, which may be due to the lack of physiological accessibility between them in this condition.

[0150] Example 3: Circular RNA with U-rich characteristics is easily enriched by DIS3 in sucrose density gradient centrifugation experiments

[0151] In order to find circular RNA that is easy to bind to DIS3 protein, the present application example uses sucrose density gradient centrifugation to enrich circular RNA. First, the present application example constructed a plasmid (based on the p23 plasmid backbone) for overexpressing wild-type DIS3 (DIS3-WT) and endonuclease activity mutant DIS3 (DIS3-D146N) in 293T cells, and used HighGene transfection reagent (ABclonal RM09014) to overexpress in 293T cells. The transfection method was carried out according to the HighGene transfection reagent instructions. About 2×10 7 293T cells overexpressing DIS3 protein were lysed using Lysis Buffer.

[0152] Lysis Buffer includes (component concentrations are final concentrations): Tris-HCl, pH=7.4 20 mM, MgCl2 15 mM, KCl 200 mM, Heparin 1 mg / mL, RNasin 40 U / mL, DTT 1 mM, Triton X-100 1%.

[0153] The supernatant was collected by high-speed centrifugation at 12,000g for 10 minutes at 4°C, and then added to a 5–30wt% sucrose density gradient solution prepared using a gradient analyzer (BioComp) and separated by ultracentrifugation. Centrifuge at 36,000rpm for 16 hours at 4°C using a SW41 rotor (Beckman). Samples of different gradients were collected using a gradient sorter equipped with BioComp, and the UV OD260 value was detected while collecting. RNA was extracted from the collected samples using Trizol reagent, and the extracted RNA was subjected to RT-qPCR experiments (refer to Example 1) to detect circLRP6 (2), circPRMT5 (4-7), and circUBAC2 (2-4) in each component. At the same time, equal amounts of samples were taken from each component for western-blot experiments to see the distribution of DIS3 protein and different exosome complex components. The results showed that many circular RNAs were enriched by DIS3 protein in sucrose density gradient centrifugation experiments ( Figure 3A ).

[0154] Example 4: Sequence preference of DIS3 protein in degrading circular RNA

[0155] Next, samples 3, 4, 7, and 8 in the sucrose density gradient samples of 293T cells overexpressing DIS3-WT and DIS3-D146N were subjected to library sequencing analysis to find the characteristics of these circular RNAs enriched by DIS3-D146N protein. At the same time, the present application example combined with the sequencing results of the 293T cell line knocked down by DIS3 protein to analyze and find that most of the circular RNAs affected by DIS3 protein have three short nucleotide elements (motifs), namely:

[0156] P1: UU[C / U]GCU; P1-1 (SEQ ID NO.7): UUCGCU; P1-2: UUUGCU (SEQ ID NO.8);

[0157] P2 (SEQ ID NO. 9): GCUCUGC;

[0158] P3 (SEQ ID NO. 10): GUUGCCU.

[0159] Furthermore, the present invention optimizes and integrates these three short nucleotide elements and summarizes a short nucleotide element C1 (SEQ ID NO.11) with uracil-rich characteristics: UUUGCUG ( Figure 4A ).

[0160] The present application example selected a circular RNA circUBAC2 (2-4) with multiple motifs and a circular RNA circSRSF4 (8) without a motif for verification ( Figure 4B ). As a result, circular RNA circUBAC2(2-4) could be degraded by DIS3-WT, while circular RNA circSRSF4(8) could not be effectively degraded by DIS3-WT.

[0161] At the same time, the present invention modified the two circular RNAs by removing the bases in the motif region of circUBAC2(2-4) to obtain the motif-free circular RNA circUBAC2(2-4)-Δmotif, and adding circSRSF4(8) to 20 consecutive C1 motifs to obtain circSRSF4(8)-20C1. circUBAC2(2-4), circSRSF4(8), circUBAC2(2-4)-Δmotif and circSRSF4(8)-20C1 were circularized by T4 ligase. Purified DIS3-WT protein was used to digest circUBAC2(2-4), circSRSF4(8), circUBAC2(2-4)-Δmotif and circSRSF4(8)-20C1 in vitro. The digestion rates of these four circular RNAs by DIS3-WT protein were compared. It was found that compared with the circular RNA circUBAC2(2-4), the circular RNA circUBAC2(2-4)-Δmotif without the motif sequence was significantly degraded by DIS3-WT. At the same time, compared with circSRSF4(8), the degradation rate of circSRSF4(8)-20C1 with 20 consecutive C1motifs by DIS3-WT was significantly increased ( Figure 4C ).

[0162] Example 5: Modifying the DIS3-preferred fragment on circular RNA to change the degradation rate of circular RNA in cells

[0163] For the circular RNA circUBAC2(2-4) with a DIS3 preference fragment, the present invention uses a method to mutate the uracil on the DIS3 preference sequences P1, P2, and P3 to adenylic acid to remove the DIS3 preference motif on it to obtain the circular RNA circUBAC2(2-4)-mut without a DIS3 preference motif; 20 consecutive DIS3 preference C1 motifs are added to the circular RNA circSRSF4(8) without a DIS3 preference motif to obtain the circular RNA circSRSF4(8)-20C1; on the other hand, the uracil on the C1 motif is replaced with adenylic acid to obtain the N1 motif without DIS3 preference characteristics, which is added to the circular RNA circSRSF4(8) to obtain the circular RNA circSRSF4(8)-20N1( Figure 5A ).

[0164] Different circular RNAs were delivered into 293T cells using LNP. The medium was changed 24 hours after transfection. Cell samples were collected at different time points after the medium change, and the cell RNA was extracted. The RNA samples were subjected to Northern Blot experiments to detect the amount of exogenously transferred circular RNA into the cells, and the changes of exogenously transferred circular RNA into the cells over time were observed. Compared with circular RNA circUBAC2(2-4), the circular RNA circUBAC2(2-4)-mut with mutated motif sequence had a significantly decreased rate of degradation in cells; compared with circSRSF4(8)-20N1 without DIS3 preferred motif, the circSRSF4(8)-20C1 with 20 consecutive DIS3 preferred C1 motifs had a significantly increased rate of degradation in cells ( Figure 5B ).

[0165] Circular RNA is mainly distributed in the cytoplasm of cells, and its nuclear exit mechanism is currently unclear. In order to explore its nuclear exit rules, the present application embodiment uses human embryonic stem cells (H9) and human forebrain neuron cells (FB) differentiated from H9 as models to find genetic elements that regulate the nuclear exit of circular RNA. The results showed that 5 adenylate-enriched short nucleotide sequences can regulate the positioning of circular RNA through RNA binding protein PABPC1. At the same time, the present application achieves the change of the positioning of circular RNA by adding or deleting these nucleotide elements in H9. The implementation of this application is expected to provide good technical support for precise circular RNA medication by changing the positioning of circular RNA in cells.

[0166] Example 6: A type of circular RNA rich in adenylate short nucleotide elements is retained in the H9 cell nucleus

[0167] 1.1 Adenosine-rich circular RNA has a tendency to be nuclear retained

[0168] In order to explore the localization rules of circular RNA in the cytoplasm and nucleus of cells, the present application example first used human embryonic stem cell H9 as a model to analyze the localization expression profiles of circRNA, mRNA and long non-coding RNA (lncRNA) in the nucleus and cytoplasm ( Figure 6 Figure A in the middle). The present application found that compared with mRNA derived from forward splicing, more circRNAs in H9 cells tend to be nuclear localized, accounting for about 11.9% of the total amount of all circular RNAs (about 3 times that of mRNA), second only to lncRNAs with obvious nuclear localization preference ( Figure 6 Figure B). By analyzing the base preference of circular RNA in the cytoplasm and nucleus, we found that circular RNA located in the nucleus has a clear preference for adenylate enrichment, while the content of cytosine and guanine is relatively low ( Figure 7 ). In order to further clarify the relevance of adenylate enrichment for circular RNA nuclear localization, the present application example further screened all 281 circular RNAs localized in the nucleus in H9 and found 77 circular RNAs whose transcripts can simultaneously produce cytoplasmic localized homologous circular RNA subtypes ( Figure 8 The present application found that the adenylate content of these 77 nuclear-localized circular RNAs reached 35.5%, which was significantly higher than the 30.2% of their cytoplasmic-localized homologous circular RNA subtypes ( Figure 8 For example, the circular RNA formed by exons 2 and 3 of the RTN4 transcript is located in the nucleus and has an adenylate content of 34.64%, while the circular RNA formed by transcripts 4 and 5 is located in the cytoplasm and has an adenylate content of 24.50% ( Fig. 9 ). This example shows that the circular RNA localized in the nucleus of H9 cells has a preference for adenylate enrichment. In order to verify whether this feature is universal and evolutionarily conservative, the present application also analyzed the localization of circular RNA in the cytoplasm and nucleus of mouse embryonic stem cells. Although there are fewer circular RNAs localized in the nucleus, only 11 ( Fig.10 Figure A), but the adenylate-enriched characteristic still exists ( Fig.10 (Fig. B).

[0169] 1.2 Circular RNA containing five short nucleotide elements is exported from the nucleus during forebrain neuronal differentiation

[0170] To further explore the subcellular localization of circular RNA, the present invention compares the distribution of cytoplasmic and nuclear circular RNA in H9 cells and human forebrain neuron cells FB obtained by H9 differentiation for 26 days ( Fig.11The results showed that among all 1082 circular RNAs expressed by both H9 and FB ( Fig.12 Figure A), 123 (11.4%) were localized in the nucleus of H9 cells, while only 16 (1.5%) circular RNAs were nuclear localized in FB ( Fig.12 About 67.5% of the circular RNAs localized in the nucleus of H9 underwent nuclear export during differentiation, which was much higher than the mRNA and lncRNA that underwent nuclear export ( Fig.13 ). Similarly, these nuclear-exporting circular RNAs are also rich in adenylate sequences ( Fig.14 ).

[0171] In order to utilize this sequence characteristic of nuclear localization circular RNA to manipulate the subcellular distribution of circular RNA, the present application example conducted sequence analysis on these circular RNAs. We found that the circular RNAs exported from the nucleus are rich in five adenylate-rich short nucleotide elements, namely AAATATGT (P4 motif, SEQ ID NO.12), AAATAAAA (P5 motif, SEQ ID NO.13), AAGAAATG (P6 motif, SEQ ID NO.14), AAAGAGAA (P7 motif, SEQ ID NO.15) and AAAAAAAA (P8 motif, SEQ ID NO.16) ( Fig.15 ).

[0172] 1.3 Potential circular RNA nuclear export mechanisms

[0173] Through multi-strategy screening, the present invention found that the polyadenylate binding protein PABPC1 controls the nuclear export of these circular RNAs containing polyadenylate elements. On the one hand, knocking down PABPC1 in H9 cells can increase the nuclear export rate of these circular RNAs ( Fig.16 (Figure A) and does not affect the expression of circular RNA, homologous linear RNA and precursor RNA in cells ( Fig.16 Figure B), and heterologous expression of PABPC1 can effectively compensate for this nuclear export phenomenon ( Fig.16 On the other hand, electrophoresis analysis (EMSA) confirmed that PABPC1 purified in vitro could directly bind to 10× short nucleotide motifs and circular RNA containing these motifs ( Fig.17 ).

[0174] Furthermore, the present invention found that PABPC1 can interact with the N-terminus of the nucleoporin TPR ( Fig.18 ); Immunofluorescence experiments found that PABPC1 was enriched on the nuclear membrane, located in the same layer as the nuclear pore complex, located in the outer layer of TPR, and partially co-localized with TPR ( Fig.19); After TPR knockdown, the nuclear export ratio of these circular RNAs increased, while the nuclear export of homologous linear RNAs did not change significantly, which was similar to PABPC1 knockdown ( Fig. 20 ). Based on the above results, it is speculated that PABPC1 cooperates with TPR to functionally regulate the nuclear export of circular RNA rich in short adenylate motifs.

[0175] Example 7: Adding or deleting adenylate-rich nucleotide motifs can achieve control of circular RNA nuclear export

[0176] In this example, the present application attempts to achieve artificial manipulation of the cytoplasmic and nuclear localization of circular RNA by adding or deleting the terminal nucleotide motifs found in Example 6. We artificially introduced circular RNAs originally expressed in the cytoplasm into the embryonic stem cell H9 cell line, including circADCY2 (2, 3), circRTN4 (4, 5), circLDLRAD3 (5), and mutants with short nucleotide motifs (motif1: AAATATGT; motif2: AAATAAAA; motif3: AAGAAATG; motif4: AAAGAGAA) added to these circular RNAs. After 2 days of cell culture, the cytoplasm and nucleus were separated and their contents were detected respectively ( Fig.21 The results showed that the proportion of circular RNAs exported from the nucleus increased significantly after adding short nucleotide motifs ( Fig. 22 ); Similarly, after nuclear-localized circular RNA and mutants with these short nucleotide motifs deleted were introduced into H9 cells ( Fig.21 ), the latter's nuclear ejection phenomenon was significantly suppressed ( Fig.23 ). This example preliminarily confirms that by adding or deleting five adenylate-rich short nucleotide motifs, the cytoplasmic and nuclear localization of circular RNA can be artificially controlled, thereby providing a powerful tool for accurate targeted circular RNA delivery.

[0177] The technical features of the above-mentioned implementation modes and examples can be combined in any appropriate manner. To make the description concise, not all possible combinations of the technical features in the above-mentioned implementation modes and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0178] The above-described embodiments only express several implementation methods of the present invention, which is convenient for understanding the technical solutions of the present invention in detail, but cannot be understood as limiting the scope of protection of the invention patent. It should be pointed out that, for those of ordinary skill in the art, without departing from the concept of the present invention, several variations and improvements can be made, which all belong to the protection scope of the present invention. In addition, it should be understood that after reading the above-mentioned teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and the equivalent forms obtained also fall within the protection scope of this application. It should also be understood that the technical solutions obtained by those skilled in the art on the basis of the technical solutions provided by the present invention through logical analysis, reasoning or limited experiments are all within the protection scope of the claims attached to the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the contents of the attached claims, and the description and drawings can be used to explain the contents of the claims.

Claims

1. Use of ribonuclease DIS3 or its mutant in the preparation of a circular RNA degradation reagent, or, Use of ribonuclease DIS3 or its mutant as a degradation agent in degrading circular RNA; in, The mutant has both endonuclease activity and exonuclease activity.

2. The use according to claim 1, characterized in that: The circular RNA comprises a uracil-rich motif.

3. The use according to claim 2, wherein: The length of the motif is 4 bp to 10 bp.

4. The use according to claim 2, wherein: The proportion of uracil in the motif is 28% to 70%.

5. The use according to any one of claims 2 to 4, wherein: The motif includes one or more of the P1 motif, the P2 motif and the P3 motif: The nucleotide sequence of the P1 motif is UU[C / U]GCU; The nucleotide sequence of the P2 motif is GCUCUGC; The nucleotide sequence of the P3 motif is GUUGCCU.

6. The use according to any one of claims 2 to 4, wherein: The motifs include the C1 motif; the nucleotide sequence of the C1 motif is UUUGCUG.

7. The use according to claim 6, wherein: The number of the C1 motifs is 15 to 25; or / and, a plurality of the C1 motifs are continuously distributed in the circular RNA.

8. The use according to any one of claims 1 to 4 and 7, wherein: The mutant has one of the following mutations: D146N and D487N.

9. A method for preparing circular RNA, comprising the following steps: Constructing a motif as defined in any one of claims 2 to 8 in a target circular RNA to prepare an easily degradable circular RNA; or, The motif defined in any one of claims 2 to 8 present in the target circular RNA is removed to prepare a circular RNA that is not easily degraded.

10. The method for preparing circular RNA according to claim 9, wherein: Methods for removing the motif include mutating uracil to other bases.

11. A nucleic acid molecule whose nucleotide sequence is UU[C / U]GCU, GCUCUGC, GUUGCCU or UUUGCUG.

12. Application of expression control reagents of polyadenylic acid binding protein PABPC1 and / or nucleoporin TPR in the preparation of circular RNA export control reagents.

13. The use according to claim 12, wherein: The circular RNA comprises an adenine-rich motif.

14. The use according to claim 13, wherein: The length of the motif is 6 bp to 10 bp.

15. The use according to claim 13, wherein: The proportion of adenine in the motif is 50% to 100%.

16. The use according to any one of claims 13 to 15, wherein: The motifs include one or more of P4 motif, P5 motif, P6 motif, P7 motif and P8 motif: The nucleotide sequence of the P4 motif is AAATATGT; The nucleotide sequence of the P5 motif is AAATAAAA; The nucleotide sequence of the P6 motif is AAGAAATG; The nucleotide sequence of the P7 motif is AAAGAGAA; The nucleotide sequence of the P8 motif is AAAAAAAA.

17. A method for preparing circular RNA, comprising the following steps: Constructing the motif defined in any one of claims 13 to 16 in the target circular RNA to prepare the circular RNA that is easy to exit the cell nucleus; or removing the motif defined in any one of claims 13 to 16 present in the target circular RNA to prepare the circular RNA that is easy to retain in the cell nucleus.

18. The method for preparing circular RNA according to claim 17, wherein: The method of removing the motif comprises deleting the motif.

19. A method for regulating the export of circular RNA from the nucleus in a target cell, comprising the step of regulating the export of circular RNA from the nucleus by regulating the expression of polyadenylic acid binding protein PABPC1 and / or nucleoporin TPR in the target cell.

20. A nucleic acid molecule whose nucleotide sequence is AAATATGT, AAATAAAA, AAGAAATG, AAAGAGAA or AAAAAAAA.

Images