Kit and method for detecting thalassemia gene mutation
Through the construction and analysis of multiple PCR targeted sequencing libraries, the limitations of thalassemia gene mutation detection in the prior art were solved, and simultaneous detection of HBA1, HBA2, and HBB genes were realized, reducing the probability of missed detection and improving the detection throughput and range.
Patent Information
- Application Number
- CN202311314314.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-10
- Publication Date
- 2025-04-11
AI Technical Summary
In the detection of mutations in the thalassemia gene, the prior art has problems such as detecting only known mutations, small detection flux, cumbersome operation, and missing α-thalassemia.
A kit and method for detecting mutations in thalassemia genes are provided. Through the construction and analysis of multiple PCR targeted sequencing libraries, deletion and non-deletion mutations of HBA1, HBA2, and HBB genes can be detected simultaneously, reducing the probability of missing detection, and improving the detection throughput and range.
It has achieved efficient and extensive detection of thalassemia gene mutations, reduced the possibility of missing detection of deletion mutations, simplified the detection process, and improved the degree of automation of detection.
Smart Images
Figure BDA0004488947570000031 
Figure BDA0004488947570000101 
Figure BDA0004488947570000111
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene detection, and in particular to a kit and method for detecting thalassemia gene mutation. Background Art
[0002] Thalassemia is an autosomal recessive genetic disease and one of the most common single-gene genetic diseases in the world. It belongs to inherited hemoglobin disorders. Hemoglobin disorders include thalassemia and abnomal hemoglobin. Thalassemia is an autosomal recessive genetic disease, mainly distributed in tropical and subtropical regions such as the Mediterranean region, Africa and Southeast Asia. The provinces and regions south of the Yangtze River in my country are high-incidence areas of the disease. α- and β-thalassemia are inherited hemolytic diseases characterized by reduced synthesis of α- and β-globin chains, respectively, and are two common types of thalassemia. Mutations in the α-globin gene (HBA1, [OMIM+141800], HBA2, [OMIM*141850]) cause α-thalassemia [OMIM#604131], and gene deletion is the main cause of the disease. Mutations in the β-globin gene (HBB, [OMIM+141900]) cause β-thalassemia [OMIM#613985], and the pathogenic mutations in the β-globin gene are mainly point mutations, small deletions or insertions.
[0003] At present, the clinical methods for α-thalassemia and β-thalassemia typing are mainly based on gap-PCR. The gap-PCR technology amplifies different fragments for detection according to the differences in the gene sequences of different deletion mutations to achieve the purpose of typing. The main representatives are the gap-PCR method and PCR reverse dot hybridization method of Yaneng Biotechnology and Cape Biotechnology, as well as the NGS method of BGI. The main shortcomings of existing typing methods such as gap-PCR combined with PCR reverse dot hybridization are that they can only detect known mutations, with low detection throughput and cumbersome operation. The BGI NGS method solves the problem of low detection throughput, but there are still problems that it can only detect known mutations and cumbersome operation. For deletion-type α-thalassemia, this method still uses the gap-PCR method, which can only detect the four common deletion-type α-thalassemia mutations. If other types of deletion mutations exist, they will be missed. Summary of the invention
[0004] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a kit and method for detecting thalassemia gene mutations, so as to solve the problems in the prior art.
[0005] To achieve the above-mentioned purpose and other related purposes, the present invention provides a kit for detecting thalassemia gene mutation, the kit comprising a linker element, a primer pool, and a PCR reagent, the linker element comprising a first nucleotide chain and a second nucleotide chain, the first nucleotide chain comprising a first universal sequence, a molecular tag, and a second universal sequence, the second nucleotide chain comprising a complementary sequence of the second universal sequence, the primer pool comprising primers for detecting HBA gene and HBB gene mutations and primers for detecting an internal reference gene, the primers for detecting the HBA gene comprising primers for detecting an X-specific segment, a Y-specific segment, and a Z-specific segment on an HBA gene cluster, wherein the genomic position of the X-specific segment is chr16:170801-171701; the genomic position of the Y-specific segment is chr16:175048-175797; the genomic position of the Z-specific segment is chr16:165401-169452 and / or chr16:177538-183301.
[0006] In certain embodiments of the present invention, the primers for detecting HBA and HBB gene mutations also include primers for detecting mutations in the exon region of the HBA gene, primers for detecting high-frequency mutations in the HBA gene, primers for detecting mutations in the exon region of the HBB gene, and primers for detecting high-frequency mutations in the HBB gene. The high-frequency mutation may be a mutation occurring in the exon region, or may be a mutation occurring in the intron region. The high-frequency mutation is a mutation that has been reported as a high-frequency mutation or a hotspot mutation in the Chinese population in prior art materials such as books, documents, patents, and databases.
[0007] In certain embodiments of the present invention, the nucleotide sequences of the primers used to detect mutations in the exon region of the HBA gene are shown in SEQ ID NOs. 1-10.
[0008] In certain embodiments of the present invention, the nucleotide sequence of the primer for detecting high-frequency mutations of the HBA gene is shown as SEQ ID NO.11.
[0009] In certain embodiments of the present invention, the nucleotide sequences of the primers for detecting mutations in the exon region of the HBB gene are shown in SEQ ID NOs. 12-16.
[0010] In certain embodiments of the present invention, the nucleotide sequences of the primers for detecting high-frequency mutations of the HBB gene are shown in SEQ ID NOs. 17-24.
[0011] In certain embodiments of the present invention, the nucleotide sequences of the primers for detecting the X-specific segment, the Y-specific segment, and the Z-specific segment on the HBA gene cluster are shown in SEQ ID NOs. 29-37.
[0012] In certain embodiments of the present invention, the nucleotide sequences of the primers used to detect the internal reference gene are shown in SEQ ID NOs. 25-28.
[0013] The present invention also provides use of the kit in constructing a multiplex PCR targeted sequencing library.
[0014] The present invention also provides a method for constructing a multiplex PCR targeted sequencing library, which comprises using the kit to construct the library.
[0015] The present invention also provides a multiplex PCR targeted sequencing library obtained by the method.
[0016] The present invention provides a method for detecting thalassemia gene mutation, the detection method comprising the following steps:
[0017] 1) sequencing the multiplex PCR targeted sequencing library;
[0018] 2) Sequencing data analysis:
[0019] According to the number of reads in the sequencing data and the formula: The calculation result is processed as follows to obtain the copy number of the corresponding gene: when the calculation result is 0.1-0.5, the copy number is regarded as 1, and the remaining calculation results are rounded off to get the copy number; in the formula, P S1 IC is the number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the sample to be tested; S1 is the number of reads obtained by sequencing the primers used to detect the internal reference gene in the sample to be tested; P NC The number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the control sample; IC NC The number of reads obtained by sequencing the primers used to detect the internal reference gene in the control sample; HBA gene and HBB gene deletion mutations were analyzed based on the copy number;
[0020] 3) Analysis of gene mutation types:
[0021] 3.1) Analysis of HBA gene deletion mutation:
[0022] Determine the type of HBA gene deletion mutation based on the obtained copy number and the following table:
[0023]
[0024] 3.2) Analysis of HBB gene deletion mutation:
[0025] If the copy number is 0, the HBB gene is homozygous deleted; if the copy number is 1, the HBB gene is heterozygous deleted; if the copy number is 2, the HBB gene has not undergone a deletion mutation.
[0026] The present invention also provides a device for detecting thalassemia gene mutation, the device comprising:
[0027] 1) A sequencing data acquisition module: used to acquire sequencing data of the multiplex PCR targeted sequencing library, wherein the multiplex PCR targeted sequencing library is constructed using the kit for detecting thalassemia gene mutations;
[0028] 2) Copy number acquisition module: used according to the number of reads in the sequencing data and the formula: Calculate, process the calculation results and obtain the copy number. The processing method is: when the calculation result is 0.1-0.5, the copy number is regarded as 1, and the remaining calculation results are rounded off to obtain the copy number. In the formula, P S1 IC is the number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the sample to be tested; S1 is the number of reads obtained by sequencing the primers used to detect the internal reference gene in the sample to be tested; P NC The number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the control sample; IC NC is the number of reads obtained by sequencing the primers used to detect the internal reference gene in the control sample;
[0029] 3) Gene mutation type analysis module: used to analyze the mutation types of HBA gene and HBB gene according to the copy number of the copy number acquisition module.
[0030] As described above, the kit and method for detecting thalassemia gene mutations of the present invention have the following beneficial effects: it can realize the simultaneous detection of thalassemia gene HBA1, HBA2, HBB gene deletion type and non-deletion type, greatly reducing the possibility of missing deletion mutations. Compared with traditional detection methods, the present invention has higher throughput, wider detection range, easier detection of rare mutations, and simultaneous detection of α-thalassemia and β-thalassemia genes. Compared with the existing NGS detection method, the detection process of the present invention is simpler, the detection range is wider, the probability of missed detection is lower, and only one tube reaction is required for one sample, which makes it easier to realize the automation of the detection process. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 Shown is an experimental flow chart for constructing a multiplex PCR targeted sequencing library according to the present invention.
[0032] Figure 2 Shown is the quality control electrophoresis diagram of the library of the present invention.
[0033] Figure 3 Shown is the HBA1 gene IGV map of the present invention.
[0034] Figure 4 Shown is the HBA2 gene IGV map of the present invention.
[0035] Figure 5 Shown is the IGV map of the HBB gene of the present invention.
[0036] Figure 6 Shown is a schematic diagram of a device for detecting thalassemia gene mutations.
[0037] Figure 7 Shown is a schematic diagram of an electronic terminal of the present invention. DETAILED DESCRIPTION
[0038] The present invention provides a novel thalassemia gene mutation detection method and kit. The method includes: targeting all exon regions of HBA1, HBA2, and HBB genes causing thalassemia, sites of some clearly pathogenic / potentially pathogenic intron regions, specific regions for HBA1 and HBA2 deletion typing, and specific primers for specific regions of internal reference genes, for sequencing library construction, and realizing simultaneous detection of α-thalassemia and β-thalassemia through high-throughput sequencing and data analysis.
[0039] The present invention provides a kit for detecting thalassemia gene mutations, the kit comprising an adapter element (UMI-Adapter), a primer pool, and a PCR reagent, the adapter element comprising a first nucleotide chain and a second nucleotide chain, the first nucleotide chain comprising a first universal sequence (US1), a molecular tag (UMI), and a second universal sequence (US2), the second nucleotide chain comprising a complementary sequence (US2-R) of the second universal sequence, the primer pool comprising primers for detecting HBA gene and HBB gene mutations and primers for detecting The primer composition for detecting the internal reference gene, the primers for detecting the HBA gene include primers for detecting the X-specific segment, the Y-specific segment, and the Z-specific segment on the HBA gene cluster, wherein the genomic position of the X-specific segment is chr16:170801-171701; the genomic position of the Y-specific segment is chr16:175048-175797; the genomic position of the Z-specific segment is chr16:165401-169452 and / or chr16:177538-183301.
[0040] In certain embodiments of the present invention, the primers for detecting HBA and HBB gene mutations also include primers for detecting mutations in the exon region of the HBA gene, primers for detecting high-frequency mutations of the HBA gene, primers for detecting mutations in the exon region of the HBB gene, and primers for detecting high-frequency mutations of the HBB gene.
[0041] In certain embodiments of the present invention, the primers for detecting HBA gene mutations include primers for detecting HBA1 and HBA2 gene mutations.
[0042] In certain embodiments of the present invention, the nucleotide sequences of the primers used to detect mutations in the exon region of the HBA gene are shown in SEQ ID NOs. 1-10.
[0043] In certain embodiments of the present invention, the nucleotide sequence of the primer for detecting high-frequency mutations of the HBA gene is shown as SEQ ID NO.11.
[0044] In certain embodiments of the present invention, the nucleotide sequences of the primers for detecting mutations in the exon region of the HBB gene are shown in SEQ ID NOs. 12-16.
[0045] In certain embodiments of the present invention, the nucleotide sequences of the primers for detecting high-frequency mutations of the HBB gene are shown in SEQ ID NOs. 17-24.
[0046] In certain embodiments of the present invention, the nucleotide sequences of the primers for detecting the X-specific segment, the Y-specific segment, and the Z-specific segment on the HBA gene cluster are shown in SEQ ID NOs. 29-37.
[0047] In certain embodiments of the present invention, the nucleotide sequences of the primers used to detect the internal reference gene are shown in SEQ ID NOs. 25-28.
[0048] In certain embodiments of the present invention, the molar concentration of each primer in the primer pool is the same.
[0049] In certain embodiments of the present invention, the concentration of each primer in the primer pool is not specifically limited, and may be, for example, 25 nM to 500 nM, as long as each primer can be diluted to a final use concentration of 5 nM to 100 nM.
[0050] In certain embodiments of the present invention, the first universal sequence includes a sequence fragment that binds to a sequencing primer. The sequence fragment that binds to a sequencing primer is identical to or complementary to the sequencing primer.
[0051] The sequencing primer in the present invention refers to a sequence fixed in a sequencing instrument.
[0052] In certain embodiments of the present invention, the first universal sequence (US1) further comprises a fragment that binds to an oligonucleotide chain on a flow cell of a sequencing chip. The fragment that binds to an oligonucleotide chain on a flow cell of a sequencing chip is a fragment that is identical to or complementary to an oligonucleotide chain on a flow cell of a sequencing chip.
[0053] In certain embodiments of the present invention, the first universal sequence further comprises a first index sequence (Index1), which is disposed at the 5' end of the first universal sequence or the adapter element. The first index sequence can be designed by a commonly used method in the prior art, and the function of the first index sequence is to restore and classify each sequencing data (Reads) as belonging to a certain sample.
[0054] In the present invention, the linker element including the fragment bound to the oligonucleotide chain on the flow cell of the sequencing chip, the first index sequence and the sequence fragment bound to the sequencing primer is called a full-length linker element.
[0055] An adapter element that includes only the sequence fragment that binds to the sequencing primer is referred to as a non-full-length adapter element.
[0056] The molecular tag (Unique Molecular Identifier, UMI) is a randomized or specific short nucleotide sequence, which is usually designed as a completely random nucleotide chain (such as NNNNNN) or a partially degenerate nucleotide chain (such as NNNRNYN) random base.
[0057] In certain embodiments of the present invention, the length of the molecular tag can be any length of 5 to 15 bp, such as 5 to 7 bp, 7 to 9 bp, 9 to 11 bp, 11 to 13 bp, or 13 to 15 bp.
[0058] In the present invention, since the T sticky end of the linker element has a second universal sequence of about 10 bp for forming a double strand to meet the requirements of the connection reaction, the molecular tag of the present invention can exist in the linker element in a single-stranded form, and when preparing the linker element, the molecular tag does not need an antisense strand matching it to form a double strand.
[0059] The second universal sequence (US2) is used to form a double strand when the adapter element is annealed. In one embodiment, the second universal sequence is a sequence that has no identical or complementary sequence in the human genome.
[0060] In certain embodiments of the present invention, the 3' end of the second universal sequence (US2) is base T.
[0061] In certain embodiments of the present invention, the second universal sequence (US2) may have any length of 8 to 20 bp, such as 8 to 10 bp, 10 to 12 bp, 12 to 14 bp, 14 to 16 bp, 16 to 18 bp, or 18 to 20 bp.
[0062] In certain embodiments of the present invention, the complementary sequence of the second universal sequence is reverse complementary to the second universal sequence. The complementary sequence of the second universal sequence has a phosphorylation modification group at the 5' end and a phosphorylation modification group or an amino modification group or a dideoxynucleoside modification group at the 3' end.
[0063] The first nucleotide chain and the second nucleotide chain anneal to form a double-stranded DNA. In certain embodiments of the present invention, the 3' end of the linker element after annealing is a sticky end with a T base protruding. The sticky end is used for TA connection.
[0064] An exemplary nucleotide sequence of the linker element of the present invention is as follows:
[0065] Examples of non-full-length linker elements:
[0066] The single underline indicates the first universal sequence (US1) (italics indicate the fragment bound to the sequencing primer), the double underline indicates the molecular index (UMI), and the wavy underline indicates the second universal sequence (US2)
[0067] Example of the second universal sequence complementary sequence US2-R:
[0068] 5'Phosphorylation-GGTGCACTAA-Phosphorylation3'(SEQ ID NO.40)
[0069] In certain embodiments of the present invention, the molar concentration of each specific primer in the primer pool is the same.
[0070] In certain embodiments of the present invention, each specific primer in the primer pool includes a third universal sequence (US3) and a specific sequence (GS) from the 5' end to the 3' end.
[0071] In certain embodiments of the present invention, the third universal sequence (US3) of each specific primer is the same.
[0072] The third universal sequence is another segment that binds to the sequencing primer.
[0073] In certain embodiments of the present invention, the length of the third universal sequence may be 15 to 33 bp, such as 15 to 20 bp, 20 to 25 bp, 25 to 30 bp, or 30 to 33 bp. In a preferred embodiment, the length of the third universal sequence is 20 to 25 bp.
[0074] The specific sequence of each specific primer in the primer pool is different due to different detection regions and has gene specificity.
[0075] In certain embodiments of the present invention, the sequence of the specific primer is exemplified as follows:
[0076] The underlined part is the third universal sequence, and the bold part is the specific sequence.
[0077] Mg in the kit 2+ The concentration is not limited, as long as Mg 2+ Dilute to working concentration.
[0078] In certain embodiments of the present invention, Mg 2+ The working concentration is 1.5-5 mM. 2+ The working concentrations are 1.5-2mM, 2-2.5mM, 2.5-3mM, 3-3.5mM, 3.5-4mM, 4-4.5mM, and 4.5-5mM.
[0079] In certain embodiments of the present invention, the Mg 2+ Provided by MgCl2. In certain embodiments of the invention, the MgCl2 is contained in the PCR buffer.
[0080] In certain embodiments of the present invention, the kit further comprises a universal primer (UC), which is used in combination with a specific primer in a primer pool to specifically amplify a target region.
[0081] There are multiple universal primers.
[0082] In certain embodiments of the present invention, the universal primers include a first universal primer (UC1) and a second universal primer (UC2).
[0083] In certain embodiments of the present invention, when the first universal sequence does not include the first index sequence, the sequence of the first universal primer is identical to or complementary to the sequence fragment to which the sequencing primer binds.
[0084] The sequence of the first universal primer is exemplified as follows: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQID NO.41)
[0085] In certain embodiments of the present invention, the second universal primer includes a fragment that binds to an oligonucleotide chain on a sequencing chip flow cell, a second index sequence (Index2), and a sequence fragment that binds to a sequencing primer.
[0086] In certain embodiments of the present invention, the 3' end of the second universal primer sequence is identical to the third universal sequence.
[0087] In certain embodiments of the present invention, the universal primer further comprises a third universal primer (UC3).
[0088] In certain embodiments of the present invention, the third universal primer includes a fragment that binds to an oligonucleotide chain on a flow cell of a sequencing chip, a first index sequence, and a sequence fragment that binds to a sequencing primer.
[0089] In certain embodiments of the present invention, the 3' end of the third universal primer is entirely or partially identical or complementary to the first universal sequence.
[0090] The second universal primer UC2 sequence is exemplified as follows:
[0091] Among them, the single underline represents the fragment bound to the oligonucleotide chain on the sequencing chip flow cell, the bold represents the second index sequence Index2, and the wavy underline represents the third universal sequence (US3).
[0092] The third universal primer UC3 sequence is exemplified as follows:
[0093] Among them, the single underline represents the fragment bound to the oligonucleotide chain on the flow cell of the sequencing chip, the bold represents the first index sequence Index1, and the wavy underline represents the sequence that is partially identical or complementary to the sequence fragment bound to the sequencing primer in the first universal sequence US1.
[0094] In certain embodiments of the present invention, the PCR reagents include PCR buffer, Mg 2+ , dNTPs, DNA polymerase, any one or more of water.
[0095] The PCR reagent may be homemade or a commercially available kit, such as 2x WHSeq PCR Mix (Weinheim, XW7001).
[0096] In certain embodiments of the present invention, the kit also includes reagents commonly used in constructing sequencing libraries, which can be obtained commercially. For example, the kit also includes DNA fragmentation, end repair, dA tailing reagents, ligation reagents, magnetic bead purification and recovery reagents, anhydrous ethanol, nuclease-free water, etc.
[0097] The present invention also provides use of the kit in constructing a multiplex PCR targeted sequencing library.
[0098] The present invention also provides a method for constructing a multiplex PCR targeted sequencing library, which comprises using the kit to construct the library.
[0099] In certain embodiments of the present invention, the steps of constructing the multiplex PCR targeted sequencing library in step 1) are as follows:
[0100] 1.1) Connecting the fragmented, end-repaired, phosphorylated and 3'-A-treated nucleic acid sample to the adapter element, and purifying and recovering the pre-library with the adapter element;
[0101] 1.2) using the primer pool and the first universal primer to perform PCR amplification on the pre-library obtained in step 1.1 to enrich the target region;
[0102] 1.3) Purifying and recovering the amplified product of step 1.2, mixing it with the first universal primer and the second universal primer, or with the second universal primer and the third universal primer, and then performing PCR amplification again, so as to introduce linker elements at both ends of the amplified product of step 1.2;
[0103] 1.4) Purify and recover the amplified product of step 1.3 to obtain the multiplex PCR targeted sequencing library.
[0104] In step 1.1), fragmentation, end repair and 3' A addition treatment can be completed by purchasing a commercial kit and following the instructions.
[0105] In certain embodiments of the present invention, based on the reaction system of step 1.2), the concentration of each specific primer in step 1.2) is 5-100 nM. For example, the concentration of each specific primer is 5-20 nM, 20-40 nM, 40-60 nM, 60-80 nM, 80-100 nM.
[0106] In certain embodiments of the present invention, the number of PCR amplification cycles in step 1.2) is 5 to 12 cycles. 5 to 12 cycles can ensure the specificity of PCR amplification.
[0107] During the first cycle of amplification in step 1.2), the specific primer binds to the target region in the pre-library for extension. The extension process will complete the 5'-end single-stranded portion of the adapter element into double-stranded DNA, forming a binding site for the first universal primer. In the second cycle of amplification and subsequent cycles, the specific primer and the first universal primer can perform bidirectional amplification to achieve enrichment of the target region. Step 1.2) produces double-stranded DNA with the following structure: from the 5' end to the 3' end (the same applies to the conversion direction), they are the first universal sequence (US1), molecular tag UMI, second universal sequence (US2), target region insertion sequence (TS), specific sequence (GS), and third universal sequence (US3).
[0108] The purification and recovery in step 1.3) and step 1.4) can be performed using commercial kits and conventional techniques in the art, such as purification and recovery using magnetic beads.
[0109] In certain embodiments of the present invention, the number of cycles of PCR amplification in step 1.3) is 15 to 30 cycles. Preferably, the number of cycles of PCR amplification in step 1.3) is 20 to 25 cycles.
[0110] Step 1.1) using a non-full-length linker element without a first index sequence;
[0111] The primers used for amplification in step 1.3) are the third universal primer and the second universal primer.
[0112] In certain embodiments of the present invention, the multiplex PCR targeted sequencing library obtained in step 1.4) is a complete target region sequencing library, which can be sequenced on a machine after passing quality control, and the genomic variation information of the target region can be obtained through bioinformatics analysis.
[0113] In certain embodiments of the present invention, the steps of bioinformatics analysis are: distinguishing different samples based on Index information, then deduplicating sequencing reads based on UMI information to obtain deduplicated data for each sample, and aligning the deduplicated data of each sample to the human reference genome (GRCh38).
[0114] The present invention also provides a multiplex PCR targeted sequencing library obtained by the method.
[0115] The present invention provides a method for detecting thalassemia gene mutation, the detection method comprising the following steps:
[0116] 1) sequencing the multiplex PCR targeted sequencing library;
[0117] 2) Sequencing data analysis:
[0118] According to the number of reads in the sequencing data and the formula: The calculation result is processed as follows to obtain the copy number of the corresponding gene: when the calculation result is 0.1-0.5, the copy number is regarded as 1, and the remaining calculation results are rounded off to get the copy number; in the formula, P S1 IC is the number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the sample to be tested; S1 is the number of reads obtained by sequencing the primers used to detect the internal reference gene in the sample to be tested; P NC The number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the control sample; IC NC The number of reads obtained by sequencing the primers used to detect the internal reference gene in the control sample; HBA gene and HBB gene deletion mutations were analyzed based on the copy number;
[0119] 3) Analysis of gene mutation types:
[0120] 3.1) Analysis of HBA gene deletion mutation:
[0121] Determine the type of HBA gene deletion mutation based on the obtained copy number and the following table:
[0122]
[0123] 3.2) Analysis of HBB gene deletion mutation:
[0124] If the copy number is 0, the HBB gene is homozygous deleted; if the copy number is 1, the HBB gene is heterozygous deleted; if the copy number is 2, the HBB gene has not undergone a deletion mutation.
[0125] In the present invention, the control sample is a sample that is clearly free of HBA1, HBA2, HBB and internal reference gene deletions.
[0126] In certain embodiments of the invention, the method further comprises non-deletion mutation analysis.
[0127] In certain embodiments of the present invention, the method for non-deletion mutation analysis is a prior art, for example, after base calibration of the sequence, SNP and Indel mutations are analyzed using software, and the detected mutations are then annotated using the software.
[0128] The present invention also provides a device for detecting thalassemia gene mutation, the device comprising:
[0129] 1) A sequencing data acquisition module: used to acquire sequencing data of the multiplex PCR targeted sequencing library, wherein the multiplex PCR targeted sequencing library is constructed using the kit for detecting thalassemia gene mutations;
[0130] 2) Copy number acquisition module: used according to the number of reads in the sequencing data and the formula: Calculate, process the calculation results and obtain the copy number. The processing method is: when the calculation result is 0.1-0.5, the copy number is regarded as 1, and the remaining calculation results are rounded off to obtain the copy number. In the formula, P S1 IC is the number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the sample to be tested; S1 is the number of reads obtained by sequencing the primers used to detect the internal reference gene in the sample to be tested; P NC The number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the control sample; IC NC is the number of reads obtained by sequencing the primers used to detect the internal reference gene in the control sample;
[0131] 3) Gene mutation type analysis module: used to analyze the mutation types of HBA gene and HBB gene according to the copy number of the copy number acquisition module.
[0132] In certain embodiments of the present invention, the gene mutation type analysis module includes a deletion mutation analysis submodule, which is used to analyze the gene deletion mutation type of HBA according to the obtained copy number and the following table:
[0133]
[0134] In certain embodiments of the present invention, the deletion mutation analysis submodule is also used to analyze the deletion mutation type of the HBB gene according to the following method: if the copy number is 0, the HBB gene is homozygous for deletion; if the copy number is 1, the HBB gene is heterozygous for deletion; if the copy number is 2, the HBB gene has not undergone a deletion mutation.
[0135] In certain embodiments of the present invention, the gene mutation type analysis module also includes a non-deletion mutation analysis submodule, which is used to analyze SNP and Indel variations and perform annotations after base calibration of the sequence.
[0136] The non-deletion mutation analysis submodule can be obtained by integrating software in the prior art.
[0137] The device for detecting thalassemia gene mutations is basically the same in principle as the aforementioned method. In the aforementioned method and device embodiments, the definitions of the same features, calculation methods, enumeration of implementation methods and enumeration of preferred implementation methods can be used interchangeably and will not be repeated.
[0138] It should be noted that it should be understood that the division of the various modules of the above device is only a division of logical functions. In actual implementation, they can be fully or partially integrated into one physical entity, or they can be physically separated. And these modules can all be implemented in the form of software called by processing elements; they can also be all implemented in the form of hardware; some modules can also be implemented in the form of software called by processing elements, and some modules can be implemented in the form of hardware. For example, the copy number acquisition module can be a separately established processing element, or it can be integrated in a chip of the above device. In addition, it can also be stored in the memory of the above device in the form of program code, and called and executed by a processing element of the above device. The implementation of other modules is similar. In addition, these modules can be fully or partially integrated together, or they can be implemented independently. The processing element described here can be an integrated circuit with signal processing capabilities. In the implementation process, each step of the above method or each module above can be completed by an integrated logic circuit of hardware in the processor element or instructions in the form of software.
[0139] For example, the above modules may be one or more integrated circuits configured to implement the above methods, such as one or more application specific integrated circuits (ASICs), or one or more digital signal processors (DSPs), or one or more field programmable gate arrays (FPGAs). For another example, when a module is implemented in the form of a processing element scheduling program code, the processing element may be a general-purpose processor, such as a central processing unit (CPU) or other processors that can call program code. For another example, these modules may be integrated together and implemented in the form of a system-on-a-chip (SOC).
[0140] The present invention also provides a computer-readable storage medium on which a computer program is stored, and the program implements the above-mentioned detection method when executed by a processor.
[0141] Those skilled in the art can understand that all or part of the steps of implementing the above-mentioned method embodiments can be completed by hardware related to the computer program. The aforementioned computer program can be stored in a computer-readable storage medium. When the program is executed, the steps of the above-mentioned method embodiments are executed; and the aforementioned storage medium includes: ROM, RAM, magnetic disk or optical disk and other media that can store program codes.
[0142] The present invention also provides a computer processing device, comprising a processor and the aforementioned computer-readable storage medium, wherein the processor executes a computer program on the computer-readable storage medium to implement the steps of the aforementioned detection method.
[0143] The present invention also provides an electronic terminal, the structural diagram of which is shown in Figure 4 The electronic terminal provided in this example includes: a processor 21, a memory 22, a communicator 23, a communication interface 24 and a system bus 25; the memory 22 and the communication interface 24 are connected to the processor 21 and the communicator 23 through the system bus 25 and communicate with each other, the memory 22 is used to store computer programs, the communication interface 24 is used to communicate with other devices, and the processor 21 and the communicator 23 are used to run computer programs so that the terminal executes the detection method.
[0144] The system bus mentioned above can be a Peripheral Component Interconnect (PCI) bus or an Extended Industry Standard Architecture (EISA) bus, etc. The system bus can be divided into an address bus, a data bus, a control bus, etc. For ease of representation, only one thick line is used in the figure, but it does not mean that there is only one bus or one type of bus. The communication interface is used to realize the communication between the database access device and other devices (such as clients, read-write libraries, and read-only libraries). The memory may include random access memory (RAM), and may also include non-volatile memory, such as at least one disk storage.
[0145] The above-mentioned processor can be a general-purpose processor, including a central processing unit (CPU), a network processor (NP), etc.; it can also be a digital signal processor (DSP), an application specific integrated circuit (ASIC), a field programmable gate array (FPGA) or other programmable logic devices, discrete gate or transistor logic devices, discrete hardware components.
[0146] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.
[0147] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.
[0148] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.
[0149] The following examples are to illustrate the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.
[0150] Example 1
[0151] This embodiment proposes a method and kit for detecting thalassemia gene mutation. The Chinese library construction method of the present invention can refer to the method of Example 1 in the patent application number 2023109577121. The specific steps are as follows:
[0152] 1. Design specific primers for all exon regions of HBA1, HBA2, and HBB genes, sites of some clearly pathogenic / potentially pathogenic intron regions, specific regions for HBA1 and HBA2 deletion typing, and specific regions of internal reference genes, and mix all primers in equal moles to form a primer pool GSP-Thal, and the final concentration of each primer in the primer pool GSP-Thal is 200nM. The primer sequences are as shown in the following table, where primers 1-10 are specific primers for HBA1 and HBA2 gene exons; primer 11 is a hotspot mutation primer for HBA2 gene; primers 12-16 are specific primers for HBB gene exons; primers 17-24 are hotspot mutation primers for HBB gene; primers 25-28 are specific primers for internal reference genes; primers 29-37 are specific primers for HBA1 and HBA2 gene deletion typing:
[0153] Specific primer sequence list
[0154]
[0155]
[0156] 2. Nucleic acid sample detection. In this example, 7 α-deletion standard products of Jingliang Technology (Shenzhen) Co., Ltd. were detected, and thalassemia wild-type gDNA standard product 1 (STD1) was used as a control. The specific information of the standard products is as shown in the following table. The X-specific segment, Y-specific segment, and Z-specific segment in the table are detailed in the patent application number 202310338692X (if there is no special description of the detection method of α-deletion type in this application, the method is the same as the patent application number 202310338692X):
[0157]
[0158] 3. Prelibrary construction: The genomic DNA sample was fragmented, end-repaired and A-added using the Vazyme#ND627 kit, connected to the UMI-Adatper, and purified and recovered by magnetic beads to obtain a prelibrary with molecular tags UMI. The adapter sequence is as follows:
[0159] Without Index1 non-full-length adapter
[0160] 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNNNNNNNNTTAGTGCACCT-3'(SEQID NO.38)
[0161] Complementary sequence
[0162] 5'Phosphorylation-GGTGCACTAA-Phosphorylation3'(SEQ ID NO.39)
[0163] 4. Use the primer pool GSP-Thal in step 1 to enrich the target region of the UMI pre-library obtained in step 3. The reaction procedure is [95℃3min; 98℃2min; (98℃15s, 68℃10min)8cycles; 72℃5min; 12℃Hold; hot cover 105℃]. After the reaction is completed, the magnetic beads are purified and recovered. The reaction system is as follows:
[0164]
[0165]
[0166] The sequence of the first universal primer UC1 is exemplified as follows:
[0167] 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3'(SEQ ID NO.41)
[0168] 5. Use the primers with index to perform PCR amplification on the recovered samples in step 3, add UC2 and UC3 required for sequencing, and the reaction procedure is [95℃3min; 98℃2min; (98℃15s, 60℃2min)21cycles; 72℃5min; 12℃Hold; hot cover 105℃]. After the reaction is completed, the magnetic beads are purified and recovered. The reaction system is as follows:
[0169]
[0170] The second universal primer UC2 sequence is exemplified as follows:
[0171] 5'-AATGATACGGCGACCACCGAGATCTACAC[CTCTCTAT]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3'(SEQ ID NO.42)
[0172] The third universal primer UC3 sequence is exemplified as follows:
[0173] 5'-CAAGCAGAAGACGGCATACGAGAT[GCAGCGTAG]GTCTCGTGGGCTCGG-3'(SEQ IDNO.43)
[0174] 6. Library quality control: Capillary electrophoresis was used to detect the distribution of library fragments. The main peak of the library fragments was between 250 and 500 bp, and the average fragment size was between 300 and 450 bp. The test results are attached. Figure 2 ; Qubit was used to detect the library concentration, which was greater than 0.5 ng / μL.
[0175] 7. All libraries were mixed with equal quality and sequenced using the Illumina Novaseq / FASTASeq300 sequencing platform.
[0176] 8. Bioinformatics analysis. After the sample sequencing is completed, the different samples are distinguished according to the Index information, and then the sequencing reads are deduplicated according to the UMI information to obtain the deduplicated data of each sample. The deduplicated sequencing data of each sample is aligned to the human reference genome (GRCh38) using BWA software, and then mutation analysis is performed. The aligned sequencing data is shown in the attached figure. Figure 3 , Attachment Figure 4 , Attachment Figure 5 As shown in the accompanying figure, it can be seen that the sequencing data can completely cover all exon regions and part of the UTR regions of the HBA1, HBA2, and HBB genes. Therefore, this method can detect point mutations and small insertion and deletion mutations in the exon regions and part of the UTR regions of the HBA1, HBA2, and HBB genes.
[0177] 9. Deletion type analysis. Count the number of reads of the target region after deduplication of each primer of the sample to be tested and the control sample. Compare the reads of each primer of the sample to be tested and the control sample according to the table below to obtain the copy number of the region amplified by the primer, and then calculate the copy number / deletion type of the gene. The control sample is a sample with no HBA1, HBA2, HBB and internal reference gene deletion. The internal reference gene of the sample to be tested has no deletion and the copy number is 2. The analysis example is as follows:
[0178]
[0179] Based on the copy number analysis results of the primers to be tested, the copy number of the HBB gene can be accurately typed. If the copy number is 0, it proves that the HBB gene is homozygous deleted, if the copy number is 1, it proves that the HBB gene is heterozygous deleted, and if the copy number is 2, it is normal.
[0180] Because the HBA1 and HBA2 genes are highly homologous, the deletion typing of the HBA1 and HBA2 genes requires comprehensive analysis using the copy number of primers 29-37. The copy number of the HBA gene is calculated based on the relationship between the number of reads and the copy number in the above table. The corresponding relationship between the copy number and the genotyping is detailed in the patent application number 202310338692X. The copy number results are as follows:
[0181]
[0182] The X-specific segment is primers 29-31; the Y-specific segment is primers 32-34; the Z-specific segment is primers 35-37; the IC-specific internal reference segment is primers 25-28; three specific primers at different positions are designed for each X, Y, and Z-specific segment, and the copy number of each segment is selected from the copy number analysis results of the primers to be tested that are more than two consistent among the three primers. If the analysis results of the three primers in a certain segment are different, the test is abnormal and the abnormal situation analysis is performed.
[0183] 10. The statistics and analysis results of sequencing depth of each sample are as follows:
[0184]
[0185]
[0186] 11. Non-deletion analysis The information of point mutations and small indel mutations in the target gene is obtained through bioinformatics analysis in the prior art, and the detected mutations are annotated. The analysis method is exemplified as follows:
[0187] 11.1 Raw data quality control: Perform quality control on raw sequencing data and remove adapters and low-quality data
[0188] Program name: cutadapt (version 4.4) fastp 0.23.0
[0189] Program command: cutadapt -g ^ file:primer.fa sample_R1.fastq.gz sample_R2.fastq.gz -o
[0190] sample_R1.clean.gz-p sample_R2.clean.gz--json sample.cutadapt.json-aADAPTER
[0191] fastp -h sample.html -j sample.json -i sample_R1.fastq.gz -I sample_R2.fastq.gz
[0192] Reference: https: / / cutadapt.readthedocs.io / en / stable / guide.html
[0193] https: / / github.com / OpenGene / fastp
[0194] 11.2 UMI Tag Extraction and Alignment: UMI Deduplication Processing
[0195] Program name: sentieon (202112.06) umi extract & umi consensus
[0196] Program commands:
[0197] sentieon umi extract read_structure\
[0198] sample_R1.fastq.gz sample_R2.fastq.gz|\
[0199] sentieon bwa mem-R"@RG\tID:sample\tSM:sample\tLB:sample\tPL:MGI"\
[0200] -t 10-pC Ref-|\
[0201] sentieon umi consensus-o sample_consensus.fastq.gz
[0202] refer to: https: / / support.sentieon.com / appnotes / umi / #sentieon-reg-umi- pipeline
[0203] 11.3 Sequence alignment and sorting: Aligning sequences to reference sequences
[0204] Program name: sentieon (202112.06) bwa mem&util sort
[0205] Program commands:
[0206] sentieon bwa mem-R"@RG\tID:sample\tSM:sample\tLB:sample\tPL:MGI"\
[0207] -t 10-pC Ref results / consensus / ${sample}_consensus.fastq.gz|\
[0208] sentieon util sort -t 10-i--o sample.consensus.bam--sam2bam--umi_post_process
[0209] refer to: https: / / support.sentieon.com / appnotes / umi / #sentieon-reg-umi- pipeline
[0210] 11.4 Analysis of mutation information:
[0211] Program name: sentieon (202112.06) driver --algo TNscope && --algo Haplotyper
[0212] Program commands:
[0213] sentieon driver-r Ref--interval bed\
[0214] -i sample.consensus.bam\
[0215] --algo TNscope--tumor_sample sample sample.raw.vcf.gz
[0216] sentieon driver -r Ref-i sample.consensus.bam–interval bed--algoHaplotyper--emit_mode gvcf
[0217] --emit_conf 10sample.g.vcf.gz
[0218] refer to: https: / / support.sentieon.com / versions / 202112.06 / manual / TNscope_ usage / tnscope / #general
[0219] https: / / support.sentieon.com / versions / 202112.06 / manual / usages / general / #driver-binary
[0220] 11.5 Variant Information Annotation
[0221] Program name: table_annovar.pl (Mon, 8Jun 2020)
[0222] Program command: table_annovar.pl sample annodb / -buildver hg38-outfilesample.anno-remove-protocol
[0223] refGene,ensGene,dbscsnv11,cosmic70,dbnsfp41a,genomicSuperDups,intervar_20180118
[0224] -operation g,g,f,f,f,r,f-nastring.-polish--intronhgvs 100-otherinfo
[0225] refer to:
[0226] https: / / annovar.openbioinformatics.org / en / latest / user-guide / startup / #table_annovarpl
[0227] 12. The results of the non-missing analysis are as follows:
[0228] serial number Detection of mutations STD1 No pathogenic / suspected pathogenic mutations were detected STD2 No pathogenic / suspected pathogenic mutations were detected STD3 No pathogenic / suspected pathogenic mutations were detected STD4 No pathogenic / suspected pathogenic mutations were detected STD5 No pathogenic / suspected pathogenic mutations were detected STD6 NM_000518.5(HBB):c.316-197C>T(IVS2-654C>T) STD7 No pathogenic / suspected pathogenic mutations were detected
[0229] The final result of thalassemia mutation analysis was obtained by combining the results of deletion and non-deletion type analysis; the test results were consistent with expectations, and the standard STD6 contained a known pathogenic point mutation NM_000518.5 (HBB): c.316-197C>T (IVS2-654C>T).
[0230] The genotype detection result of the standard obtained in this example is consistent with its annotated genotype, with an accuracy of 100%.
[0231] Example 2
[0232] This example investigates the accuracy of missing typing detection in clinical samples.
[0233] The experimental steps are the same as those in Example 1, except that the samples used for the test are clinical samples with known mutations. A total of 37 clinical samples were tested, with STD1 as the control. The results of the deletion test are shown in the following table. The data in the table can illustrate that the accuracy of the method and kit of the present invention when testing this batch of 37 samples is 100%.
[0234] According to the analysis results of this example, this embodiment establishes a highly multiplexed PCR targeted library construction method that can be used to detect thalassemia gene mutations, which can detect target genes efficiently, accurately and specifically.
[0235]
[0236]
[0237]
Claims
1. A kit for detecting thalassemia gene mutation, characterized in that: The kit comprises a linker element, a primer pool, and a PCR reagent. The linker element comprises a first nucleotide chain and a second nucleotide chain. The first nucleotide chain comprises a first universal sequence, a molecular tag, and a second universal sequence. The first universal sequence comprises a sequence fragment that binds to a sequencing primer, and the molecular tag is a randomized or specific nucleotide sequence. The second nucleotide chain comprises a complementary sequence of the second universal sequence so that the linker element forms a double strand when annealed. The primer pool comprises primers for detecting mutations of the HBA gene and the HBB gene and primers for detecting mutations of the HBA gene and the HBB gene. The primer composition for detecting the internal reference gene, the primers for detecting the HBA gene include primers for detecting the X-specific segment, the Y-specific segment, and the Z-specific segment on the HBA gene, wherein the genomic position of the X-specific segment is chr16:170801-171701; the genomic position of the Y-specific segment is chr16:175048-175797; the genomic position of the Z-specific segment is chr16:165401-169452 and / or chr16:177538-183301.
2. The kit according to claim 1, characterized in that The primers for detecting HBA and HBB gene mutations also include primers for detecting HBA gene exon region mutations, primers for detecting HBA gene high-frequency mutations, primers for detecting HBB gene exon region mutations, and primers for detecting HBB gene high-frequency mutations.
3. The kit according to claim 2, characterized in that Also includes any one or more of the following features: 1) The primers for detecting HBA gene mutations include primers for detecting HBA1 and HBA2 gene mutations; 2) The nucleotide sequences of the primers used to detect mutations in the exon region of the HBA gene are shown in SEQ ID NOs. 1 to 10; 3) The nucleotide sequence of the primer for detecting high-frequency mutation of HBA gene is shown in SEQ ID NO.11; 4) The nucleotide sequences of the primers used to detect mutations in the exon region of the HBB gene are shown in SEQ ID NOs. 12 to 16; 5) The nucleotide sequences of the primers for detecting high-frequency mutations of the HBB gene are shown in SEQ ID NOs. 17 to 24; 6) The nucleotide sequences of the primers used to detect the X-specific segment, the Y-specific segment, and the Z-specific segment on the HBA gene are shown in SEQ ID NOs. 29 to 37; 7) The nucleotide sequences of the primers used to detect the internal reference gene are shown in SEQ ID NOs. 25 to 28; 8) The molar concentration of each primer in the primer pool is the same.
4. The kit according to claim 1, characterized in that Also includes any one or more of the following features: 1) The length of the molecular tag is any length of 5 to 15 bp; and / or the length of the second universal sequence is any length of 8 to 20 bp; 2) The first base at the 3' end of the second universal sequence is T, and / or the 5' end of the complementary sequence of the second universal sequence has a phosphorylation modification group, and / or the 3' end has a phosphorylation modification group, an amino modification group or a dideoxy modification group; 3) the first universal sequence also includes a fragment bound to the oligonucleotide chain on the flow cell of the sequencing chip and / or a first index sequence, and the first index sequence is located at the 5' end of the first universal sequence; 4) The kit also includes universal primers, which are used in combination with specific primers in the primer pool to specifically amplify the target region.
5. The kit according to claim 1, characterized in that The kit also includes universal primers, which are used in combination with specific primers in the primer pool to specifically amplify the target region. The universal primers include a first universal primer and a second universal primer. When the first universal sequence does not include the first index sequence, the sequence of the first universal primer is identical to or complementary to the sequence fragment bound to the sequencing primer; when the connector element includes the first index sequence and a fragment bound to the oligonucleotide chain on the sequencing chip flow cell, the sequence of the first universal primer is identical to or complementary to the sequence composed of the first index sequence and the fragment in the first universal sequence bound to the oligonucleotide chain on the sequencing chip flow cell, or is identical to the fragment in the first universal sequence bound to the oligonucleotide chain on the sequencing chip flow cell; the second universal primer includes the fragment bound to the oligonucleotide chain on the sequencing chip flow cell, the second index sequence and the sequence fragment bound to the sequencing primer; preferably, the 3' end of the second universal primer sequence is identical to the third universal sequence.
6. The kit according to claim 1, characterized in that The kit also includes universal primers, which are used in combination with specific primers in a primer pool to specifically amplify a target region. The universal primers include a second universal primer and a third universal primer. The second universal primer includes a fragment that binds to an oligonucleotide chain on a flow cell of a sequencing chip, a second index sequence, and a sequence fragment that binds to a sequencing primer; the third universal primer includes a fragment that binds to an oligonucleotide chain on a flow cell of a sequencing chip, a first index sequence, and a sequence fragment that binds to a sequencing primer.
7. Use of the kit according to any one of claims 1 to 6 in constructing a multiplex PCR targeted sequencing library.
8. A method for constructing a multiplex PCR targeted sequencing library, characterized in that: The construction method comprises using the kit described in any one of claims 1-6 to construct a library.
9. The method according to claim 8, characterized in that The construction method comprises the following steps: 1.1) Connecting the fragmented, end-repaired, phosphorylated and 3'-A-treated nucleic acid sample to the adapter element, and purifying and recovering the pre-library with the adapter element; 1.2) using the primer pool and the first universal primer to perform PCR amplification on the pre-library obtained in step 1.1 to enrich the target region; 1.3) Purifying and recovering the amplified product of step 1.2, mixing it with the first universal primer and the second universal primer, or with the second universal primer and the third universal primer, and then performing PCR amplification again, so as to introduce linker elements at both ends of the amplified product of step 1.2; 1.4) Purify and recover the amplified product of step 1.3 to obtain the multiplex PCR targeted sequencing library.
10. The multiplex PCR targeted sequencing library obtained by the method according to claim 8 or 9.
11. A method for detecting thalassemia gene mutation, characterized in that: The detection method comprises the following steps: 1) sequencing the multiplex PCR targeted sequencing library according to claim 10; 2) Sequencing data analysis: According to the number of reads in the sequencing data and the formula: The calculation result is processed as follows to obtain the copy number of the corresponding gene: when the calculation result is 0.1-0.5, the copy number is regarded as 1, and the remaining calculation results are rounded off to get the copy number; in the formula, P S1 IC is the number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the sample to be tested; S1 is the number of reads obtained by sequencing the primers used to detect the internal reference gene in the sample to be tested; P NC The number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the control sample; IC NC The number of reads obtained by sequencing the primers used to detect the internal reference gene in the control sample; HBA gene and HBB gene deletion mutations were analyzed based on the copy number; 3) Analysis of gene mutation types: 3.1) Analysis of HBA gene deletion mutation: Determine the type of HBA gene deletion mutation based on the obtained copy number and the following table: 3.2) Analysis of HBB gene deletion mutation: If the copy number is 0, the HBB gene is homozygous deleted; if the copy number is 1, the HBB gene is heterozygous deleted; if the copy number is 2, the HBB gene has not undergone a deletion mutation.
12. The method according to claim 11, characterized in that The method also includes non-deletion mutation analysis.
13. A device for detecting thalassemia gene mutation, characterized in that: The device comprises: 1) A sequencing data acquisition module: used to acquire sequencing data of the multiplex PCR targeted sequencing library, wherein the multiplex PCR targeted sequencing library is constructed using the kit for detecting thalassemia gene mutations; 2) Copy number acquisition module: used according to the number of reads in the sequencing data and the formula: Calculate and process the calculation results to obtain the copy number. The processing method is as follows: when the calculation result is 0.1-0.5, the copy number is regarded as 1, and the remaining calculation results are rounded off to obtain the copy number. In the formula, P S1 IC is the number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the sample to be tested; S1 is the number of reads obtained by sequencing the primers used to detect the internal reference gene in the sample to be tested; P NC The number of reads obtained by sequencing the primers used to detect HBA or HBB gene mutations in the control sample; IC NC is the number of reads obtained by sequencing the primers used to detect the internal reference gene in the control sample; 3) Gene mutation type analysis module: used to analyze the mutation types of HBA gene and HBB gene according to the copy number of the copy number acquisition module.
14. The device according to claim 13, characterized in that The gene mutation type analysis module includes a deletion mutation analysis submodule, which is used to analyze the gene deletion mutation type of HBA according to the obtained copy number and the following table: And / or, the deletion mutation analysis submodule is also used to analyze the deletion mutation type of the HBB gene according to the following method: if the copy number is 0, the HBB gene is homozygous deleted; if the copy number is 1, the HBB gene is heterozygous deleted; if the copy number is 2, the HBB gene has not undergone a deletion mutation.
15. The device according to claim 13, characterized in that The gene mutation type analysis module also includes a non-deletion mutation analysis submodule, which is used to analyze SNP and Indel variations and perform annotations after base calibration of the sequence.
16. A computer-readable storage medium, characterized in that: A computer program is stored thereon, and when the program is executed by a processor, the detection method described in any one of claims 11-12 is implemented.
17. A computer-readable storage medium, characterized in that: A computer program is stored thereon, and when the program is executed by a processor, the detection method described in any one of claims 11-12 is implemented.
18. A computer processing device, characterized in that It comprises a processor and the computer-readable storage medium as described in claim 17, wherein the processor executes the computer program on the computer-readable storage medium to implement the steps of the detection method as described in any one of claims 11-12.
19. An electronic terminal, characterized in that: include: Processor, memory, communicator, communication interface and system bus; The memory and the communication interface are connected to the processor and the communicator through the system bus and complete communication with each other. The memory is used to store computer programs, the communication interface is used to communicate with other devices, and the processor and the communicator are used to run the computer program so that the electronic terminal executes the steps of the detection method described in any one of claims 11-12.