Application of SMAD6 in TGCT auxiliary diagnosis and prognosis evaluation

Abstract

The invention relates to application of SMAD6 in auxiliary diagnosis and prognosis evaluation of TGCT (Transforming Growth Computed Tomography). According to the invention, a novel TGCT prognosis biomarker (SMAD6) is identified through difference analysis, Cox regression and survival analysis on the basis of a TGCT sample in multiple centers. Subsequently, the expression level of SMAD6 in normal testicular tissues and TGCT is evaluated through immunohistochemical staining. Finally, the relationship between the SMAD6 and biological characteristics, mutation landscape, immune cell infiltration and immunotherapy response is also studied. The invention defines that SMAD6 is a risk factor of poor TGCT prognosis. An immunohistochemical result shows that the SMAD6 is highly expressed in the TGCT tissue. GSEA shows that SMAD6 is related to activation of tumor-related pathways and inhibition of immune-related pathways. In addition, high SMAD6 expression is associated with lower CD8 + T cell infiltration, while patients with low SMAD6 expression gain more benefits in immunotherapy. The invention fully reveals the potential of SMAD6 as a TGCT prognosis and immunotherapy reaction biomarker, and provides a new scientific basis and theoretical basis for personalized treatment of TGCT.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology and relates to the application of SMAD6 in auxiliary diagnosis and prognosis evaluation of TGCT. Background Art

[0002] Testicular germ cell tumor (TGCT) is a rare malignant tumor, accounting for less than 1% of all adult tumors. Despite this, it is one of the most common solid tumors in men aged 15 to 44 years. In recent years, the incidence of TGCT has been increasing worldwide, especially in Europe and the United States, where its incidence is generally high. The occurrence of TGCT is affected by both genetic and environmental factors. Cryptorchidism is the primary risk factor, which is related to the impact of exposure to certain exogenous substances during pregnancy on fetal testicular development. TGCT is mainly divided into seminoma and non-seminoma, among which non-seminoma includes embryonal cell carcinoma, choriocarcinoma, yolk sac tumor, teratoma and trophoblastoma. If there are multiple tumor cell components in TGCT, it is called mixed germ cell tumor. Different histological subtypes of TGCT show different biological characteristics, clinical manifestations and prognostic differences, which leads to different treatment options. Seminomas are highly sensitive to chemotherapy and radiotherapy, while non-seminomas are usually treated with surgery and chemotherapy. Patients with early-stage TGCT respond well to orchiectomy and adjuvant radiotherapy or chemotherapy; patients with stage I disease have a five-year survival rate of 95% with surgical resection alone. However, 12%-30% of patients may experience recurrence and metastasis even after orchiectomy, and the prognosis for these patients is generally poor.

[0003] At present, the prognostic evaluation of TGCT mainly relies on traditional serum tumor markers (STMs), such as lactate dehydrogenase (LDH), β-human chorionic gonadotropin (β-HCG), and alpha-fetoprotein (AFP). However, these markers may have false positive or false negative results. As a non-specific marker of cell renewal, increased levels of LDH may be related to inflammation, infection, or the presence of other tumors; β-HCG may be elevated under various factors such as hyperthyroidism, hypogonadism, or marijuana use; AFP may also have false positive results in cases of genetic persistence of alpha-fetoprotein or liver dysfunction. The levels of STMs in about half of TGCT patients may not reach the recognition threshold of clinical detection, resulting in false negative results. Therefore, these STMs lack sufficient sensitivity and specificity when used to predict the prognosis of TGCT patients. In summary, it has become particularly urgent and necessary to conduct in-depth research on tumor heterogeneity, combine bioinformatics and multi-omics analysis methods, explore and identify new biomarkers, and further explore and develop new prognostic biomarkers related to TGCT with higher sensitivity and specificity, which will help provide more accurate prognostic assessment and support clinical decision-making. Summary of the invention

[0004] The purpose of the present invention is to solve the problems existing in the prior art, thereby providing a biomarker SMAD6 that is highly correlated with testicular germ cell tumors. By using SMAD6 as a marker, it can be used to effectively predict the incidence and prognosis of testicular germ cell tumors, significantly reduce the probability and severity of the disease, and reduce damage to human health.

[0005] In order to solve the above technical problems, the present invention is implemented through the following technical solutions.

[0006] A first aspect of the present invention provides the use of a reagent for detecting the expression level of SMAD6 in the preparation of a product for auxiliary diagnosis and / or prognosis evaluation of testicular germ cell tumors.

[0007] Preferably, the reagent for detecting the expression level of SMAD6 includes primers for detecting the SMAD6 gene level and / or a reagent for detecting the SMAD6 protein level.

[0008] Preferably, the primers for detecting the SMAD6 gene level are selected from at least one of the following primer pairs:

[0009] Primer pair 1: the upstream sequence is as shown in SEQ ID NO: 1 (5'-GCAACCCCTACCACTTCAGC-3'), and the downstream sequence is as shown in SEQ ID NO: 2 (5'-GTGGCTTGTACTGGTCAGGAG-3');

[0010] Primer pair 2: the upstream sequence is shown in SEQ ID NO: 3 (5'-CTCCCTCATCACTGCTCCGGG T-3'), and the downstream sequence is shown in SEQ ID NO: 4 (5'-GGTGCTCCCAGTACGCCACG-3');

[0011] Primer pair 3: the upstream sequence is shown in SEQ ID NO: 5 (5'-GGGCCCGAATCTCCGC-3'), and the downstream sequence is shown in SEQ ID NO: 6 (5'-AGAATTCACCCGGAGCAGTG-3').

[0012] Preferably, the reagent for detecting SMAD6 protein level is selected from anti-SMAD6 antibody (ProteinTech Group, Inc, YT4338).

[0013] It should be understood that, in the absence of special instructions, in the context of the present invention, the primers and / or primer pairs refer to PCR primers for synthesizing SMAD6 gene cDNA chains in PCR, so as to detect the expression level of SMAD6 gene mRNA. Except for the primers, primer pairs and / or antibodies listed in the present invention, those skilled in the art are fully capable of using conventional methods and means in the art including but not limited to molecular biology according to the gene sequence of SMAD6 to design corresponding primers, primer pairs, antibodies, and screen the designed primers, primer pairs, antibodies by conventional experimental means, or commercially available, as long as specific detection of SMAD6 expression level can be achieved.

[0014] A second aspect of the present invention provides use of a SMAD6 inhibitor in the preparation of a medicament for preventing and / or treating testicular germ cell tumors.

[0015] Preferably, the SMAD6 inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the SMAD6 gene.

[0016] Preferably, the SMAD6 inhibitor is selected from shRNA designed based on the SMAD6 gene; more preferably, the shRNA sequence designed based on the SMAD6 gene is selected from one or more of SEQ ID NO: 7 (5'-CCGGCG GCGACTTTGGCGAAGTCGTCTCGAGACGACTTCGCCAAAGTCGCCGTTTTT-3'), SEQ ID NO: 8 (5'-CCGGCTTACACTGAAACGGAGGCTACTCGAGTAGCCTCCGTTTCAGTGTAAGTTTTT-3'), and SEQ ID NO: 9 (5'-CCGGGGATTCCCAGCAGCTCTTTGGCTCGAGCCAAGAGCTGCTGGGAAT CCTTTTTG-3').

[0017] It should be understood that, unless otherwise specified, in the context of the present invention, the SMAD6 inhibitor refers to a substance that can specifically down-regulate the expression level of SMAD6 and / or the transcription level of its mature mRNA and / or the expression level or activity of SMAD6 protein, such as a small molecule compound, antisense oligonucleotides, si RNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA Erasers, Target Masking and / or multi-target methods to down-regulate the expression level and / or activity of SMAD6. Those skilled in the art can design an inhibitory agent that can inhibit its expression level based on the gene sequence of SMAD6, or they can be obtained commercially, as long as the level and / or activity of SMAD6 can be reduced.

[0018] A third aspect of the present invention provides a kit for auxiliary diagnosis and / or prognosis evaluation of testicular germ cell tumors, comprising a reagent for detecting the expression level of SMAD6.

[0019] Preferably, the reagent for detecting the expression level of SMAD6 includes primers for detecting the SMAD6 gene level and / or a reagent for detecting the SMAD6 protein level.

[0020] Preferably, the primers for detecting the SMAD6 gene level are selected from at least one of the following primer pairs:

[0021] Primer pair 1: the upstream sequence is shown in SEQ ID NO: 1, and the downstream sequence is shown in SEQ ID NO: 2;

[0022] Primer pair 2: the upstream sequence is shown in SEQ ID NO: 3, and the downstream sequence is shown in SEQ ID NO: 4;

[0023] Primer pair 3: the upstream sequence is shown as SEQ ID NO: 5, and the downstream sequence is shown as SEQ ID NO: 6.

[0024] Preferably, the reagent for detecting SMAD6 protein level is selected from anti-SMAD6 antibody (ProteinTech Group, Inc, YT4338).

[0025] Preferably, the kit further comprises one or more of PCR enzyme, PCR buffer, dNTPs and fluorescent substrate.

[0026] Preferably, the fluorescent substrate is selected from Syber Green or a fluorescently labeled probe.

[0027] A fourth aspect of the present invention provides a pharmaceutical composition for preventing and / or treating testicular germ cell tumors, comprising a SMAD6 inhibitor and a pharmaceutically acceptable carrier.

[0028] Preferably, the SMAD6 inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the SMAD6 gene.

[0029] Preferably, the SMAD6 inhibitor is selected from shRNA designed based on the SMAD6 gene; more preferably, the shRNA sequence designed based on the SMAD6 gene is selected from one or more of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9.

[0030] A fifth aspect of the present invention provides the use of a SMAD6 inhibitor in the preparation of a drug for improving the immunotherapeutic activity of testicular germ cell tumors.

[0031] Preferably, the SMAD6 inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the SMAD6 gene.

[0032] Preferably, the SMAD6 inhibitor is selected from shRNA designed based on the SMAD6 gene; more preferably, the shRNA sequence designed based on the SMAD6 gene is selected from one or more of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9.

[0033] Preferably, the immunotherapy is selected from one or more of anti-PD-1 antibody therapy, anti-PD-L1 antibody therapy, and CA RT therapy.

[0034] Most TGCT patients can significantly improve their prognosis after surgical resection, adjuvant chemotherapy or radiotherapy. Although the five-year survival rate of TGCT is relatively high, according to statistics, up to 30% of advanced patients relapse after treatment. For these patients, prognostic assessment is an important part of formulating treatment strategies, but this process still faces many complex challenges. However, the treatment of refractory patients still faces major challenges. Immunotherapy may provide an effective treatment option for these patients. Studies have shown that some refractory TGCT patients may benefit from PD-L1 inhibitors, but predictive markers associated with tumor response are still unclear. In view of this, it is particularly urgent and important to find new indicators that can improve the accuracy of predicting immunotherapy response.

[0035] Existing studies have shown that the SMAD protein family is a class of classic transcription factors that transmit signals from transforming growth factor-β (TGF-β) ligands by activating serine / threonine kinase receptors. These signals significantly affect the epithelial cell to mesenchymal cell transition (EMT) process, thereby regulating the migration and invasion ability of tumor cells. Among them, SMAD6, as a key regulator of the TGF-β signaling pathway, plays an important role in promoting tumor growth, spread and metastasis. During the EMT process, epithelial cells lose their typical epithelial characteristics and transform into mesenchymal cells with migration and invasion capabilities, which is considered to be an important mechanism to promote tumor metastasis. Studies have shown that SMAD6 regulates the EMT process of non-small cell lung cancer by preventing the growth inhibition mediated by the TGF-β signaling pathway, thereby promoting tumor development and leading to poor prognosis of patients. Similarly, many studies have also shown that SMAD6 has a promoting effect on the proliferation, progression and EMT process of various cancers. However, the role and mechanism of SMAD6 in TGCT still need to be further confirmed.

[0036] In the present invention, SMAD6 has been verified by a large number of experiments as a risk factor for TGCT. First, a comprehensive analysis of the PFI and OS cohorts of TG CT showed that the high expression of SMAD6 was significantly associated with the poor prognosis of the patient. Subsequently, the high expression of SMAD6 was confirmed in TGCT by IHC staining method. The above results show that SMAD6 has the ability to serve as a prognostic biomarker for TGCT. In order to clarify the important potential function of SMAD6 in TGCT, GSEA enrichment analysis was performed. The results show that SMAD6 activates the EMT pathway associated with tumor invasion and metastasis.

[0037] It is worth noting that in the GSEA enrichment analysis, the present invention also found that SMAD6 significantly inhibited the immune-related pathways, indicating that SMAD6 may play a role in the tumor immune microenvironment. The tumor microenvironment is composed of tumor cells, immune cells, stromal cells, vascular endothelial cells and their secreted cytokines and extracellular matrix. These components play an important role in the occurrence, development and metastasis of tumors, especially the abnormal activation of immune cells significantly affects the clinical prognosis of patients. Studies have shown that in the TGCT tumor microenvironment, the infiltration degree of immune cells, especially T cells, is significantly correlated with the pathological grade and metastasis recurrence of the tumor. In the present invention, the expression of SMAD6 and CD8 + The negative correlation between SMAD6 and T cell infiltration was verified by IHC staining. This important finding suggests that SMAD6 may promote the immune escape ability of tumor cells by regulating the tumor immune microenvironment, ultimately having an adverse effect on patient prognosis.

[0038] The present invention clarifies that in the cohort receiving anti-PD-L1 immunotherapy and CAR-T treatment, patients with low SMAD6 expression have a better response to immunotherapy and a longer survival period after immunotherapy. In summary, the expression of SMAD6 may affect the infiltration degree of immune cells and immunotherapy response in TGCT, and ultimately affect the prognosis of patients. In addition, the present invention observed that there were significant differences in the mutation frequencies of KIT and KRAS genes between the SMAD6 high expression group and the low expression group. The receptor tyrosine kinase encoded by the KIT gene plays a key role in the cell survival and proliferation of TGCT. KRAS gene mutations are relatively common in TGCT and many other tumors, and can affect intracellular GTPase activity and promote cell growth. In addition, the amplification of chromosome 12p is the most common copy number variation in TGCT. The difference in the above-mentioned gene mutations may be one of the reasons for the difference in prognosis of SMAD6 subgroups.

[0039] In general, based on TGCT samples from multiple centers, the present invention identified a new TGCT prognostic biomarker SMAD6 through differential analysis, Cox regression and survival analysis, and evaluated the expression level of SMAD6 in normal testicular tissue and TGCT by immunohistochemical staining. Finally, the relationship between SMAD6 and biological characteristics, mutation landscape, immune cell infiltration and immunotherapy response was also studied. The present invention clearly shows that SMAD6 is a risk factor for poor prognosis of TGC T. Immunohistochemistry results showed that SMAD6 was highly expressed in TGCT tissues. GSEA showed that SMAD6 was associated with the activation of tumor-related pathways and the inhibition of immune-related pathways. In addition, high SMAD6 expression was associated with lower CD8 +T cell infiltration is related to SMAD6. In the cohorts receiving anti-PD-L1 immunotherapy and CAR-T treatment, patients with low SMAD6 expression responded better to immunotherapy and had longer survival after immunotherapy, that is, the expression of SMAD6 may affect the infiltration degree of immune cells and immunotherapy response in TGCT. By detecting SMAD6 in the subject, its expression level index is obtained, so that the probability of the subject suffering from TGCT can be reasonably predicted; the tumor progression in TGCT patients can also be reasonably predicted, so as to provide personalized treatment plans to improve clinical treatment effects; the patient's prognosis can also be reasonably evaluated, providing reasonable and effective guidance for treatment and rehabilitation. The present invention fully reveals the potential of SMAD6 as a biomarker for TGCT prognosis and immunotherapy response, and provides a new scientific basis and theoretical basis for personalized treatment of TGCT. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Schematic diagram of the principal component analysis (PCA) results in the GSE18155 dataset.

[0041] Figure 2 Volcano map of DEGs in the GSE18155 dataset.

[0042] Figure 3 Schematic diagram of GO enrichment analysis results.

[0043] Figure 4 The Venn diagram of prognostic genes between GPL96 and GPL97 platforms in GSE3218 and GSE10783 datasets.

[0044] Figure 5 Schematic diagram of the target prognostic gene results obtained by intersection analysis of DEGs and prognostic genes.

[0045] Figure 6 Schematic diagram of the Kaplan-Meier survival analysis results of all cohorts with progression-free interval (PFI) and overall survival (OS) as outcome events.

[0046] Figure 7 Schematic diagram of Cox regression analysis results of PFI and OS in TCGA-TGCT, GSE3218 and GSE10783 patients.

[0047] Figure 8 Schematic diagram of the results of immunohistochemical analysis of SMAD6 expression in normal testicular tissue and TGCT tissue.

[0048] Fig. 9 Schematic diagram of SMAD6 IHC scoring results in TGCT tissue and normal testicular tissue.

[0049] Fig.10 is the ROC area under the SMAD6 curve.

[0050] Fig.11 Schematic diagram of GO enrichment analysis results using GSEA algorithm.

[0051] Fig.12 The top 10 activated pathways ranked by normalized enrichment score (NES).

[0052] Fig.13 The top 10 inhibited pathways ranked by NES.

[0053] Fig.14 Schematic diagram of the correlation between immune cell infiltration score and SMAD6 expression.

[0054] Fig.15 SMAD6 expression and CD8 + Scatter plot of the correlation of T cell infiltration levels.

[0055] Fig.16 Figure 2 Kaplan-Meier survival curves between SMAD6 expression subgroups in the immunotherapy datasets (GSE135222 and GSE100797).

[0056] Fig.17 ROC curve for immunotherapy datasets (GSE135222 and GSE100797).

[0057] Fig.18 Schematic diagram of the results of immunohistochemical analysis of CD8 expression in seminoma patients with different SMAD6 expression levels.

[0058] Fig.19 Schematic diagram of the Spearman correlation analysis results between SMAD6 and CD8.

[0059] Fig. 20 Schematic diagram of FMGs analysis results in the SMAD6 low expression group and high expression group.

[0060] Fig.21 Schematic diagram of FMGs analysis results of SMAD6 wild-type and mutant groups.

[0061] Fig. 22 Schematic diagram of the variation frequency analysis results of the top 10 amplified and deleted chromosome fragments between the SMAD6 low expression group and the high expression group.

[0062] Fig.23 Schematic diagram of the differential expression analysis results of SMAD 6 in the first 10 amplified and deleted CNV chromosome fragments between the variant group and the non-variant group. DETAILED DESCRIPTION

[0063] In order to make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0064] In the absence of special instructions, the reagents used in the context of the present invention are all commercially available. The experimental methods used in the present invention are all conventional methods and techniques in the art. Representative results are selected from the biological experiments repeated and presented in the context figures, and the data are shown as mean ± SD and mean ± SEM as specified in the figure. R software package (version 4.3.3) is used for statistical analysis and visualization of data, and some charts are generated by Sangerbox (http: / / vip.sangerbox.com / ). The Spearman correlation coefficient is used in the correlation test. Kaplan-Meier analysis is performed by the "survival" R package. The Wilcoxon rank sum test is used to compare the differences between the two groups. AUC values ​​are used to predict the accuracy of SMAD6. All p values ​​are bilateral, and less than 0.05 is considered to be statistically significant. For the intracellular / in vivo SMAD6 expression level, conventional methods in the art (such as PCR, Western blot, etc.) can be used for detection; and the present invention verifies the detection specificity of the relevant primer pairs (primer pairs 1-primer pairs 3) and antibody YT4338, etc. set forth in the present invention through specific experiments. For the inhibition of SMAD6, the present invention is also verified by the designed shRNA (sequence as shown in SEQ ID NO 7-9), which can specifically inhibit the expression level of SMAD6. And in view of the detection and inhibition of specific gene / protein expression levels belonging to conventional means in the art, and also not belonging to the main improvement direction of the present invention, therefore, the relevant detection results are not particularly presented in the present invention, and those skilled in the art can detect and verify according to the experimental method described in the present invention or other conventional methods in the prior art according to the needs. In addition, in addition to the relevant primer pairs, antibodies and shRNA listed in the present invention, those skilled in the art can also design relevant primer pairs / antibodies, shRNA according to the SMAD6 gene sequence and / or protein structure, or obtain commercial reagents from the market to complete the detection or inhibition of SMAD6 expression level. Therefore, the specific information such as primer pairs, antibodies, shRNA listed in the context of the present invention does not constitute a limitation on the actual protection scope of the present invention.

[0065] Example 1

[0066] First, five independent TGCT cohorts, namely GSE18155, GSE3218 (GPL96, GPL97) and GSE10783 (GPL96, GPL97), were obtained from the GEO database (http: / / www.ncbi.nlm.nih.gov / geo / ). The raw data obtained from GEO were processed using the robust multi-array average (RMA) algorithm in the "affy" R package14. The GSE18155 cohort (n = 28) was analyzed to study the differential expression between normal testicular samples and tumor samples. The PCA results showed that there were significant differences between normal testicular samples and tumor samples in GSE18155 (see Figure 1 ).

[0067] Subsequently, the above cohort was used to identify differentially expressed genes (DEGs). Differential gene analysis was performed using the "limma" R package (version 3.58.1) to screen DEGs between normal testicular samples and tumor samples. The threshold of DEGs was set to |log2 FC|>1, p<0.05. The results showed that a total of 2486 differentially expressed genes were identified in this cohort, including 1710 downregulated DEGs and 776 upregulated DEGs (see Figure 2 ).

[0068] To explore the biological functions of these DEGs in TGCT, GO enrichment analysis was performed on the up-regulated and down-regulated DEGs by the “clusterProfiler” R package (version 4.10.0) to analyze the biological processes, cellular components, and molecular functions of DEGs. Pathways with p < 0.05 were considered to be significantly different. The results showed that the up-regulated DEGs were mainly enriched in collagen-containing extracellular matrix, regulation of cell-cell adhesion, and regulation of leukocyte-cell adhesion, while the down-regulated DEGs were mainly enriched in cellular processes in multicellular organism reproduction, sperm cell differentiation, sperm development, and ciliary motility (see Figure 3 ), the above results indicate that these genes may be involved in the occurrence and development of tumors as well as biological processes such as cancer cell proliferation, migration and invasion.

[0069] Example 2

[0070] In order to explore the genes related to prognosis in TGCT, we first performed univariate Cox regression analysis on five cohorts including TCGA-TGCT, GSE3218 (GPL96, GPL97) and GSE10783 (GPL96, GPL97) based on the "survival" R package (version3.5.8) to screen genes related to progression-free interval (PFI) and overall survival (OS). In order to comprehensively screen prognostic genes, the prognostic genes screened from the GSE3218 datasets from two different platforms were integrated, and the same method was also applied to the GSE10783 dataset. The threshold of prognostic genes was set to hazard ratio (HR) > 1 or < 1, and p < 0.05. Among them, GSE3218 screened 2900 prognostic genes, and GSE10783 screened 3699 prognostic genes (see Figure 4 ). Figure 5 The genes associated with OS in the GSE10783 cohort, the genes associated with OS in the GSE3218 cohort, the genes associated with PFI in the TCGA cohort, and the DEGs in the GSE18155 cohort are shown in Figure 1. By intersecting these four gene sets, a differentially expressed gene closely related to prognosis was finally identified, namely SMAD6.

[0071] In order to explore the prognostic value of SMAD6 in TGCT patients, the patients were divided into high-SMAD6 expression group and low-SMAD6 expression group according to the optimal cut-off value determined by the "survminer" R package (version 0.4.9), and the Kaplan-Meier survival analysis and univariate and multivariate Cox regression analysis were used to evaluate the prognostic value of SMAD6. The results showed that in the survival analysis of all cohorts, higher expression of SMAD6 was significantly associated with shorter PFI and OS (see Figure 6 ; p < 0.0001). Univariate and multivariate Cox regression analysis showed that SMAD6 not only played a significant role in predicting OS and PFI, but also remained an independent prognostic factor for TGCT patients after adjusting for other clinical characteristics (see Figure 7 ).

[0072] Example 3

[0073] First, the expression level of SMAD6 was verified using clinical samples. Given that seminoma accounts for a large proportion of TGCT, representative seminoma samples were selected for detection. Testicular tissues (8 normal testicular tissues and 33 seminoma tissues) were stained with IHC using anti-SMAD6 antibody (ProteinTechGroup, Inc, YT4338) to evaluate the expression difference of SMAD6 in normal testicular tissue and tumor tissue. The staining percentage scoring criteria were: 0 (<5%), 1 (5–25%), 2 (25–50%), 3 (50–75%), 4 (>75%); the staining intensity score was 0 (negative), 1 (weakly positive), 2 (moderately positive), 3 (strongly positive). The IHC score was obtained by the sum of the positive cell percentage score and the staining intensity score. The receiver operating characteristic (ROC) curve and the area under the ROC curve (AUC) were then used to estimate the prediction accuracy of SMAD6. The higher the AUC value, the better the accuracy. Generally, AUC>0.7 indicates good predictive performance. The results showed that the expression level of SMAD6 in seminoma tissue was significantly higher than that in normal testicular tissue, and it was mainly located in the cytoplasm (see Figure 8 ). The SMAD6 IHC score in seminoma tissue was significantly higher than that in normal testicular tissue (see Fig. 9 The ROC curve showed that SMAD6 protein had a good ability to distinguish normal testicular tissue from seminoma tissue (AUC = 0.91 (see Fig.10 ). The above results show that there is a significant difference in the expression level of SMAD6 protein between normal testicular tissue and tumor tissue, and SMAD6 has a good predictive performance for testicular germ cell tumors.

[0074] To explore the biological characteristics of SMAD6, GSEA analysis was subsequently performed (see Fig.11 ). According to the absolute value of the normalized enrichment score (NES), the top 10 activated and inhibited pathways were selected. It can be observed that pathways related to tumor progression are activated, including epithelial cell to mesenchymal cell transition (EMT), mesenchymal cell differentiation, etc. (see Fig.12 ). Immune-related pathways are inhibited, including MHC protein complexes, lymphocyte-mediated immunity, natural killer cell-mediated immunity, B cell receptor signaling pathways, etc. (see Fig.13 These results suggest that SMAD6 may activate pathways associated with tumor cell proliferation and inhibit processes associated with antigen presentation and immune cell activation, showing its key role in the progression of TGCT and the immune microenvironment.

[0075] Based on the GSEA results, it can be clearly seen that SMAD6 expression levels are closely correlated with tumor immune-related pathways. To further investigate this finding, the correlation between SMAD6 expression and immune infiltrating cells in TGCT was analyzed using multiple algorithms (see Fig.14 ). The analysis results of the four algorithms showed that the expression of SMAD6 was significantly correlated with CD8 + There was a significant negative correlation between the immune infiltration scores of T cells (see Fig.15 The above results suggest that SMAD 6 may inhibit CD8 + The infiltration of T cells leads to a poor prognosis in patients with TGCT.

[0076] Given the potential association between SMAD6 and the tumor immune microenvironment, in order to evaluate the predictive value of SMAD6 for immunotherapy response, survival analysis was further performed on patients in the two cohorts of GSE135222 and GSE100797 who received immunotherapy, which received anti-PD-L1 immunotherapy and CAR-T therapy, respectively. The results showed that patients in the SMAD6 low expression group had a better prognosis after immunotherapy (see Fig.16 ). The ROC curve shows that SMAD6 performs well in predicting immunotherapy response (see Fig.17 ). The above results suggest that patients with low SMAD6 expression may achieve better therapeutic effects in anti-PD-L1 immunotherapy and CAR-T therapy.

[0077] Example 4

[0078] In order to study the relationship between SMAD6 and CD8 +The relationship between T cells, the expression of CD8 in tumor tissues under different SMAD6 expression levels was observed by IHC staining, and the correlation between SMAD 6 and CD8 expression was evaluated by Spearman correlation analysis. Specifically, based on the "IOBR" R package (version 0.99.8), the infiltration degree of immune cells in TGCT samples was quantified. First, GSE3218 and GSE10783 were merged into the GSE3218_10783 cohort after removing the batch effect, and the normal samples were excluded. Then, the data from TCGA-TGCT and GSE 3218_10783 cohorts were analyzed using TIMER, EPIC, MCPcounter, xCell and CIBERSORT algorithms, and 22 immune cell infiltration scores were finally obtained. At the same time, the correlation between SMAD6 gene expression and various immune cell infiltration levels was explored by Spearman correlation analysis. In addition, data from GSE135222 and GSE100797 were extracted from the BEST database. These two cohorts received anti-PD-L1 immunotherapy and CAR-T therapy, respectively. Kaplan-Meier survival analysis and ROC curve analysis were then performed to evaluate the prognostic and efficacy predictive value of SMAD6 in immunotherapy.

[0079] In immune infiltration analysis, SMAD6 was found to inhibit tumor CD8 + Therefore, this finding was verified by comparing the expression levels of SMAD6 and CD8 in seminoma samples. IHC staining showed that CD8 expression was significantly reduced in seminoma samples with high SMAD6 expression compared with seminoma samples with low SMAD6 expression (see Fig.18 In addition, Spearman correlation analysis showed that there was a significant negative correlation between SMAD6 and CD8 expression (r = -0.61, p = 1.7e-4) (see Fig.19 ).

[0080] Subsequently, the role of SMAD6 in TGCT was studied from a multi-omics perspective. Specifically, the “maptools” (version 2.18.0)21 and “ComplexHeatmap” (version 2.16.0) R packages were used to analyze the mutation status of the top 10 genes with the highest mutation frequency in the TCGA-TGCT cohort in the SMAD6 high and low expression groups. At the same time, the “ComplexHeatmap” R package was used to map the copy number variation (CNV) landscape of the top 10 amplified and deleted chromosome fragments in TCGA-TGCT. Subsequently, the chi-square test was used to compare the differences in high-frequency mutant genes (FMGs) and CNVs in the SMAD6 high and low expression groups. The results showed that in the SMAD6 low expression group, the mutation frequencies of KIT and KRAS were significantly higher (see Fig. 20 ); KIT and KRAS showed significant expression differences of SMAD6 between the mutant and wild-type groups (see Fig.21 ).

[0081] Furthermore, the CNV status of the first 10 amplified and deleted chromosome segments between the SMAD6 high expression group and the low expression group was compared by Wilcoxon test to evaluate the correlation between the mutation status of these 10 genes and the CNV of the 10 amplified and deleted chromosome segments and SMAD6 expression. The results showed that the amplification of 8q12.1, 8q11.23 and 8q23.3 and the deletion of 11q12.2 and 11p15.5 had a higher frequency of variation in the SMAD6 low expression group (see Fig. 22 SMAD6 expression levels also showed statistically significant differences between the amplification groups at 8q12.1, 8q11.23, 8q13.3, and 8q23.3, and the deletion and non-variant groups at 11q12.2 and 11p15.5 (see Fig.23 ).

[0082] In general, based on TGCT samples from multiple centers, the present invention identified a new TGCT prognostic biomarker SMAD6 through differential analysis, Cox regression and survival analysis, and evaluated the expression level of SMAD6 in normal testicular tissue and TGCT by immunohistochemical staining. Finally, the relationship between SMAD6 and biological characteristics, mutation landscape, immune cell infiltration and immunotherapy response was also studied. The present invention clearly shows that SMAD6 is a risk factor for poor prognosis of TGC T. Immunohistochemistry results showed that SMAD6 was highly expressed in TGCT tissues. GSEA showed that SMAD6 was associated with the activation of tumor-related pathways and the inhibition of immune-related pathways. In addition, high SMAD6 expression was associated with lower CD8 +T cell infiltration is related to SMAD6. Patients with low SMAD6 expression have better responses to immunotherapy and longer survival after immunotherapy. That is, SMAD6 expression may affect the infiltration degree of immune cells in TGCT and the response to immunotherapy. By detecting SMAD6 in the subject's body and obtaining its expression level index, it is possible to effectively predict the probability of the subject suffering from TGCT; it is also possible to reasonably predict the tumor progression in TGCT patients, thereby providing personalized treatment plans to improve clinical treatment effects; it is also possible to reasonably evaluate the patient's prognosis and provide reasonable and effective guidance for treatment and rehabilitation; the present invention clarifies that SMAD6 can inhibit CD8 + Infiltration of T cells leads to poor prognosis. By inhibiting the expression of SMAD6, the effect of immunotherapy in TGCT patients can be improved, and the potential of SMAD6 expression level as a predictor of immunotherapy response can be detected, highlighting the importance of SMAD6 in individualized treatment strategies. The present invention fully reveals the potential of SMAD6 as a biomarker for TGCT prognosis and immunotherapy response, and provides a new scientific basis and theoretical foundation for the personalized treatment of TGCT.

[0083] The above specific implementation method part specifically introduces the analytical method involved in the present invention. It should be noted that the above introduction is only to help those skilled in the art better understand the method and ideas of the present invention, rather than limiting the relevant content. Without departing from the principle of the present invention, those skilled in the art may also make appropriate adjustments or modifications to the present invention, and the above adjustments and modifications shall also fall within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SMAD6 expression levels in the preparation of a product for auxiliary diagnosis and / or prognosis evaluation of testicular germ cell tumors.

2. The use according to claim 1, characterized in that: The reagent for detecting the expression level of SMAD6 includes primers for detecting the SMAD6 gene level and / or a reagent for detecting the SMAD6 protein level.

3. The use according to claim 2, characterized in that: The primers for detecting the SMAD6 gene level are selected from at least one of the following primer pairs: Primer pair 1: the upstream sequence is shown in SEQ ID NO: 1, and the downstream sequence is shown in SEQ ID NO: 2; Primer pair 2: the upstream sequence is shown in SEQ ID NO: 3, and the downstream sequence is shown in SEQ ID NO: 4; Primer pair 3: the upstream sequence is shown in SEQ ID NO: 5, and the downstream sequence is shown in SEQ ID NO:

6.

4. The use according to claim 2, characterized in that: The reagent for detecting SMAD6 protein level is selected from anti-SMAD6 antibody.

5. The use according to claim 2, characterized in that: The reagent for detecting SMAD6 protein level is selected from YT4338.

6. Use of SMAD6 inhibitors in the preparation of drugs for preventing and / or treating testicular germ cell tumors.

7. The use according to claim 6, characterized in that: The SMAD6 inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the SMAD6 gene.

8. A kit for auxiliary diagnosis and / or prognosis assessment of testicular germ cell tumors, characterized in that: Includes reagents for detecting SMAD6 expression levels.

9. The kit according to claim 7, characterized in that The reagent for detecting the expression level of SMAD6 includes primers for detecting the expression level of SMAD6 gene and / or a reagent for detecting the level of SMAD6 protein.

10. Application of SMAD6 inhibitors in the preparation of drugs for improving the immunotherapeutic activity of testicular germ cell tumors.

Images