Application of genetic markers related to chicken shank length in genetic breeding

Abstract

This application belongs to the field of biotechnology and discloses the application of genetic markers related to chicken shank length in genetic breeding. The molecular markers are SNP4, SNP5, and SNP6 sites of the Hes5C gene; SNP4 is the g.1419472C>T site, SNP5 is the g.1419866C>T site, and SNP6 is the g.1419886A>G site. This invention analyzes the five SNP sites of the Hes5C gene and determines the relationship between SNP4, SNP5, and SNP6 sites and chicken body size traits, particularly shank length, as well as the relationship between different sites, genotypes of different sites, haplotype combinations, and the size and shape of roosters and hens, providing guidance for genetic breeding related to chicken body size traits. Furthermore, this invention also proposes primers and kits for implementing this application.

Description

Technical Field

[0001] This application is in the field of biology and relates to the application of genetic markers related to chicken shank length in genetic breeding. Background Technology

[0002] The following literature provides relevant research on genetic markers for chicken shank length:

[0003] Publication number CN118932083A discloses a molecular marker, detection reagent, and application for evaluating growth traits of the Guangdong West Dalmatian chicken. The molecular marker is composed of two single nucleotide polymorphism sites, SNP1 and SNP2. SNP1 is located at position 959 of the EAF2 gene and is a G or A polymorphism, with three genotypes: AA, AG, and GG. SNP2 is located at position 7655 of the EAF2 gene and is a C or T polymorphism, with three genotypes: TT, TC, and CC. The EAF2 gene is located at positions 25936949–25950320 bp in the sequence shown in NC_052538.1.

[0004] Patent application CN118667968A, entitled "A molecular genetic marker associated with shank length at different ages of chickens and its application", discloses an SNP locus associated with shank length at 6 weeks, 8 weeks and 10 weeks of age of chickens. This locus is located in the intron region of the IGF2BP1 gene, at chr27:6079608bp of GRCg6a 104.

[0005] Patent application CN118272537A, entitled "A SNP molecular marker related to chicken shank length and its application", discloses that the SNP molecular marker is a polymorphic site at position 47,795,071 of chromosome 1 of the chicken genome.

[0006] Meanwhile, in organisms, a SNP mutation occurs at almost every 300bp. Therefore, birds have a large genome and a great many SNP sites.

[0007] In summary, it is evident that the molecular markers associated with chicken shank length are diverse. For breeding purposes, screening for closely related SNP loci is technically challenging and requires extensive analysis combining whole-genome resequencing results and chicken growth status to identify relatively accurate loci closely related to shank length. Summary of the Invention

[0008] The purpose of this invention is to provide an application of genetic markers related to chicken shank length in genetic breeding. This invention analyzes five SNP loci of the Hes5C gene and determines the relationship between SNP4, SNP5, and SNP6 loci and chicken body size traits, especially shank length, as well as the relationship between different loci, genotypes, haplotype combinations of different loci, and the size and shape of roosters and hens, providing guidance for genetic breeding related to chicken shank length.

[0009] In addition, the present invention also proposes primers and reagent kits for implementing this application.

[0010] To achieve the above objectives, this application discloses the application of a genetic marker related to chicken shank length in genetic breeding, wherein the molecular marker is the SNP4, SNP5, and SNP6 sites of the Hes5C gene; the SNP4 site is the g.1419472C>T site, the SNP5 site is the g.1419866C>T site, and the SNP6 site is the g.1419886A>G site.

[0011] Preferably, the chicken is the Zhangjiajie White-feathered Silkie Chicken. The Zhangjiajie White-feathered Silkie Chicken originates from Wulingyuan District, Zhangjiajie City, Hunan Province, and is a dual-purpose (meat and egg) local breed. This breed was newly discovered during the Third National Genetic Resources Survey in 2021, characterized by its long shanks and relatively stable heritability. The new breed designation of the Zhangjiajie White-feathered Silkie Chicken can be found in Announcement No. 846 issued by the Ministry of Agriculture and Rural Affairs of the People's Republic of China.

[0012] In the above applications, the body size characteristics are one or more combinations of body oblique length, keel length, and tibia length.

[0013] In the above applications, the SNP4 locus is associated with the body oblique length, tibia length, and keel length of roosters;

[0014] The SNP5 locus is associated with the body oblique length, tibia length, and keel length of hens;

[0015] The SNP6 locus is associated with the body oblique length, tibia length, keel length, and tibia length index of roosters and hens.

[0016] In the above applications, the TT genotype at the SNP4 locus is associated with body oblique length, tibia length, and keel length; the AG genotype at the SNP1 locus is associated with keel length.

[0017] The AG genotype at the SNP6 locus is associated with the body oblique length, shank length, and keel length of roosters; the AG genotype at the SNP6 locus is associated with the body oblique length and shank length of hens.

[0018] In the above applications, the haplotype combination H8H11 of the rooster is related to the rooster's body oblique length, shank length, and keel length; the haplotype combination H5H11 of the hen is related to the hen's body oblique length and shank length.

[0019] The haplotype combination H8H11 is a combination of haplotypes H8 and H11; the haplotype combination H5H11 is a combination of haplotypes H5 and H11.

[0020] The nucleotide combination of SNP4, SNP5, and SNP6 in haplotype H5 is CCA; the nucleotide combination of SNP4, SNP5, and SNP6 in haplotype H8 is CTG; and the nucleotide combination of SNP4, SNP5, and SNP6 in haplotype H11 is TTA.

[0021] Hes protein is a basic helical-loop-helical (bHLH) transcription factor that, as a target gene of the Notch classical signaling pathway, interacts with other proteins to participate in cartilage proliferation and differentiation. Hes 5 is derived from a family of proteins homologous to the Drosophila genes Hairy and mitotic enhancers. This family contains seven transcription factors (Hes 1-Hes 7) that act as transcriptional repressors by binding to the N-box sequence CACNAG and forming nonfunctional heterodimers with other bHLH proteins. The Notch signaling pathway is involved in the differentiation of various cell types and organs, including the peripheral and central nervous systems, pancreas, hematopoietic cells, and muscle, and can also affect cell proliferation by increasing or decreasing mitotic activity. In vitro models and in vivo tests of chondrocyte hypertrophy indicate that specific HES factors (including Hes 5) have the ability to directly transcribe Sox 9 during chondrogenesis and differentiation to coordinate cartilage development. In mouse studies, Notch 1 was found to strongly inhibit chondrocyte differentiation and proliferation, while the inhibitory effect of HES1 was lower than that of Notch 1. This indicates that the Notch signaling pathway's inhibition of chondrogenesis may be mediated through multiple pathways besides Hes1, and that other Hes genes in the Notch receptor family also play important roles in chondrogenesis. In human chondrocytes, the human Hes5 gene is coupled to Notch, and changes in the concentration and activity of the γ-secretase inhibitor (DAPT) can inhibit Notch 3 mitosis and reduce Hes5 expression. This suggests that the Hes5 gene is a direct downstream effector of the Notch receptor family in human chondrocytes, and that co-induction by the Notch and BMP signaling pathways can enhance the transcriptional activation of the Hes5 gene.

[0022] The Hes5 gene is a candidate gene for the chicken shank length trait. To find molecular genetic markers for selecting high-breeding individuals in chickens, two pairs of primers were designed to amplify the transcript (Hes5C) of this gene for polymorphism detection. Polymorphism analysis of 188 Zhangjiajie white-feathered black-bone chickens revealed five mutation sites in the Hes5C gene: g.1419472C>T (SNP4), g.1419866C>T (SNP5), g.1419886A>G (SNP6), g.1419900G>A (SNP7), and g.1419904T>C (SNP8). The base types of these mutation sites were consistent with the results of whole-genome resequencing. Based on the PIC values, SNP4, SNP5, SNP6, and SNP8 exhibited moderate genetic polymorphism (0.25 < PIC < 0.5), while SNP7 showed low genetic polymorphism (PIC < 0.25). All five polymorphic loci of the Hes5C gene were in Hardy-Weinberg equilibrium in the rooster population (P > 0.05).

[0023] The SNP4 locus of different genotypes in the Hes5C gene showed highly significant differences in body length, shank length, and keel length (P<0.01). The TT genotype in roosters exhibited the best growth characteristics at this locus, with significantly higher average body length (24.820±0.794), shank length (11.672±0.141), and keel length (18.060±0.598). The SNP6 locus was significantly correlated with body size traits in both male and female chickens. The CC genotype showed higher body length (19.185±0.174) in female chickens and higher shank length (8.603±0.168) in the TT genotype compared to other genotypes. Roosters with the CT genotype showed significantly higher body length, shank length, and keel length than those with the CC genotype (P < 0.05). Hens with the CT genotype exhibited a significantly higher body length than the TT genotype (P < 0.01) and a significantly higher shank length than the CC genotype (P < 0.05). The H8H11 haplotype of the Hes5C gene showed a greater advantage in three body size traits in roosters: body length (25.950 ± 0.318), shank length (11.615 ± 0.172), and keel length (18.825 ± 0.397). These results indicate that the haplotype H8H11 can serve as an effective molecular marker for breeding improvement of tall-shanked individuals in Zhangjiajie White-feathered Silkie Chickens. The Hes5C gene can be used as a candidate gene to assist in the selection of the "tall-legged" trait in Zhangjiajie White-feathered Silkie Chickens.

[0024] Meanwhile, the present invention also discloses primers for amplifying molecular markers related to the Hes5C gene. The primers are used to achieve any of the applications described above. The primers include a first primer pair for amplifying a first nucleotide sequence containing the SNP4 site and a second primer pair for amplifying a second nucleotide sequence containing the SNP5 and SNP6 sites.

[0025] The nucleotide sequences of the upstream and downstream primers of the first primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0026] The nucleotide sequences of the upstream and downstream primers of the second primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4;

[0027] The first nucleotide sequence is shown in SEQ ID NO.5;

[0028] The second nucleotide sequence is shown in SEQ ID NO.6.

[0029] In addition, the present invention also discloses a kit containing the primers described above.

[0030] The beneficial effects of this application are:

[0031] 1. This experiment uses a combination of genome resequencing technology and growth performance data to deeply explore candidate genes that may affect the shank length of roosters and to analyze their mechanisms of action in the regulation of chicken growth, development and skeletal system.

[0032] 2. This invention analyzed five SNP loci of the Hes5C gene and determined the relationship between SNP4, SNP5 and SNP6 loci and the body size trait of chickens, as well as the relationship between different loci, genotypes and haplotype combinations of different loci and the size and shape of roosters and hens, providing guidance for the genetic breeding of body size traits of Zhangjiajie white-feathered black-bone chickens.

[0033] 3. Association analysis with some body size traits showed that SNP4, SNP5, and SNP6 were significantly associated with tibia length in chickens. The TT genotype at SNP4 exhibited the best growth characteristics in roosters regarding body oblique length, tibia length, and keel length. SNP6 was significantly associated with body size traits in both male and female chickens (P < 0.05). Haplotype combinations of the three SNPs significantly affected the body size trait of Zhangjiajie Silkie Chicken (P < 0.01). The TT genotype and H8H11 haplotype combination at the Hes5C gene g.1419472C>T (SNP4) locus can be used as candidate genes to assist in the breeding of chickens with the "tall leg" trait. Attached Figure Description

[0034] Figure 1AA comparison of shank length between different sexes of the Zhangjiajie white-feathered black-bone chicken;

[0035] Figure 1B A comparative chart showing the difference in shank length to weight ratio between different sexes of Zhangjiajie white-feathered black-bone chicken;

[0036] Figure 1C A comparison of shank length between different sexes in the high and low shank length groups of Zhangjiajie white-feathered black-bone chickens;

[0037] Figure 1D Agarose gel electrophoresis image of DNA from individual poultry blood samples;

[0038] Figure 1E Autosomal SNP density map of the Zhangjiajie white-feathered black-bone chicken population;

[0039] Figure 1F A statistical chart of SNP variants in Zhangjiajie white-feathered black-bone chicken;

[0040] Figure 1G A statistical chart showing the heterozygosity ratio of SNPs in Zhangjiajie white-feathered black-bone chicken.

[0041] Figure 1H Principal component analysis results;

[0042] Figure 1I A population structure analysis diagram of the Zhangjiajie White-feathered Silkie Chicken;

[0043] Figure 1J NJ tree diagram for Zhangjiajie white-feathered black-boned chicken;

[0044] Figure 2A A schematic diagram of the selection area for the Zhangjiajie White-feathered Silkie Chicken population with varying shank lengths;

[0045] Figure 2B Venn diagram of the selected genes for Zhangjiajie white-feathered black-bone chicken;

[0046] Figure 2C GO annotation diagram of candidate differentially expressed genes for Zhangjiajie white-feathered black-bone chicken;

[0047] Figure 2D A schematic diagram of the top 20 representative KEGG pathways of Zhangjiajie white-feathered black-bone chicken;

[0048] Figure 3A The image shows the PCR amplification results of the Hes5C gene.

[0049] Figure 3B A comparison of Sanger sequencing data for SNP4, SNP5, SNP6, SNP7, and SNP8.

[0050] Figure 3CAssociation analysis diagram of SNP4, SNP5, SNP6 loci with body size traits of Zhangjiajie white-feathered black-bone chicken;

[0051] Figure 3D A correlation diagram between SNP7, SNP8 loci and body size traits of Zhangjiajie white-feathered black-bone chicken;

[0052] Figure 3E Linkage disequilibrium analysis of SNP4, SNP5 and SNP6 sites of the Hes5C gene. Detailed Implementation

[0053] The present invention will now be clearly and completely described in conjunction with embodiments thereof. It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0054] Part 1 Materials and Methods

[0055] 1.1 Sample Information

[0056] Samples were collected twice by the Wulingyuan District Animal Husbandry and Fisheries Affairs Center. The shank length, body oblique length, and keel length of 251 Zhangjiajie White-feathered Silkie chickens (117 males and 134 females) at 300 days of age were measured using vernier calipers. 5 mL of blood was collected from the subwing vein and placed in EDTA anticoagulant tubes. After mixing, the blood was transferred to cryopreservation tubes. DNA was extracted using the phenol-chloroform extraction method, and the concentration and quality of the DNA were detected using a nucleic acid quantification analyzer and 1.5% agarose gel electrophoresis.

[0057] 1.2 Quality control and variant detection of resequencing data

[0058] The whole-genome resequencing was commissioned to Guangzhou GeneDio Biotechnology Co., Ltd. Quality-tested genomic DNA was randomly fragmented into 300-400 bp segments using a Covaris fragmenter. The DNA fragments underwent end repair, 3' end poly A tailing, sequencing adapter ligation, fragment screening, and PCR amplification to complete the library preparation. Finally, the constructed library was resequentially sequenced at 10× using Illumina HiSeq.

[0059] Clean reads were aligned to the chicken genome (GCF_016699485.2) using Burrows-Wheeler Aligner (v0.7.17) software. The alignment results were sorted using samtools software, and coverage statistics were performed using bedtools software. The Genome Analysis Toolkit (GATK) software was used to identify and retrieve all single nucleotide polymorphisms (SNPs) and insertions / deletions (INDELs) from the entire genome of each individual sample. Detected variants were filtered using VariantFiltration with the filter parameter set to -Window. 4. The filters "-filter"QD<4.0||FS>60.0||MQ<40.0" and "-G_filter"GQ<20" mean that sites with a quality / depth ratio less than 4.0, a Fisher test p-value greater than 60, a root mean square of read alignment quality less than 40, and a genotype quality less than 20 will be filtered out. Finally, high-quality SNPs are obtained and annotated using ANNOVAR software.

[0060] 1.3 Group Structure and Linkage Disequilibrium Analysis

[0061] Using GCTA software, principal component analysis (PCA) was performed based on the SNP markers obtained after screening. This yielded the variance explained by each principal component and the score matrix of each sample within each principal component. Scatter plots were then used to present the results and explore population structure and genetic differences. Admixture and PopHelper were used for population structure analysis. Admixture inferred the population structure, while PopHelper plotted the genetic composition of each sample in each subpopulation as a bar chart. Finally, based on all SNP information from both datasets, a phylogenetic tree was constructed using MEGA-X software using the Neighbor-Joining (NJ) method. The phylogenetic tree's expansion value was obtained after up to 1000 calculations.

[0062] 1.4 Selection Signal Analysis

[0063] For the filtered SNP dataset, PopGenome software was used to perform sliding windowing based on physical length, with a window size of 100kb and a step size of 10kb. The genetic differentiation index (Fst) and nucleotide diversity (πratio) for the high and low groups were calculated to identify severely differentiated regions. For Fst, the Fst value was standardized to a normally distributed ZFst value according to the formula: "ZFst for each window = (Fst for each window - average Fst for all windows) / standard deviation of Fst for all windows". For π, group H was used as the experimental group and group L as the control group. The ratio was calculated using the formula "log2(πratio(πL / πH)". A Manhattan plot was used to visually illustrate the distribution between the two populations. The top 5% of both ZFst and πratio values ​​were used as thresholds, and the windows within these thresholds were selected regions. GO enrichment classification and KEGG pathway analysis were used to perform functional enrichment analysis on differentially expressed genes in the candidate regions.

[0064] 1.5 PCR amplification and DNA sequencing of candidate gene polymorphic sites

[0065] Based on previous resequencing analysis, this study explored the differences in tibia length among different populations within the same genetic group. Candidate genes and variant sites related to tibia length were screened for PCR amplification and DNA sequencing. Primers were designed using Primer 5.0 software based on gene sequence information provided by NCBI. The total PCR reaction volume was 25 μL: 12.5 μL of 2×Taq PCR Mix, 1 μL each of forward and reverse primers (10 μM), 1 μL of DNA template (500 ng / μL), and 9.5 μL of double-distilled water. The reaction program was: 95℃ for 5 min, 95℃ for 30 s, TM for 30 s, 72℃ for 1 min 20 s, 34 cycles, 72℃ for 5 min. PCR products were detected by 1.5% agarose gel electrophoresis. All primers and sequencing were performed by Beijing Qingke Biotechnology Co., Ltd. Finally, the sequencing peak chromatogram was analyzed using SnapGene software.

[0066] 1.6 Data Analysis

[0067] All data were statistically analyzed using SPSS 27.0. One-way ANOVA and t-tests were used for analysis of variance and significance analysis, respectively. All data are expressed as mean ± standard error. P < 0.05 indicated a significant difference, P < 0.01 indicated a highly significant difference, and P > 0.05 indicated no significant difference.

[0068] Genotypic analysis, linkage disequilibrium analysis, and haplotype analysis were performed on gene SNP loci using the SHEsis online software. When the haplotype frequency was less than 0.03, it was considered that no haplotype existed. The Hardy-Weinberg expected value was determined by the χ2 test, and the population polymorphism information content (PIC) was calculated.

[0069] Part Two: Results and Analysis

[0070] 2.1 Analysis of the differences in shank length between tall and short legs of Zhangjiajie white-feathered black-boned chickens

[0071] After measuring the shank length of 30 roosters and 30 hens, the six with the longest shanks were selected from each sex as the high-shank group (HT), and the six with the shortest shanks as the low-shank group (LT) for significance analysis. The results showed that the shank length of both roosters and hens in the HT group was significantly higher than that in the LT group, and the difference reached a highly significant level (P<0.001). Figure 1A The shank-to-weight ratio can be used as an indicator to assess growth rate and body size development. The shank-to-weight ratio differed significantly among roosters (P<0.05), while it did not differ significantly among hens (P>0.05). Figure 1B The results highlighted the significant differences in shank length index among roosters. Of particular note was that within the HT group, the minimum shank length of roosters was significantly greater than that of hens, with the difference also reaching a highly significant level (P<0.001). Figure 1C This indicates that roosters' shank length is significantly longer than that of hens not only in cross-group comparisons but also in intra-group comparisons. Comprehensive analysis leads to the following conclusion: In Zhangjiajie white-feathered black-bone chickens, roosters have significantly longer shank lengths than hens, suggesting that this difference in shank length may have a genetic basis.

[0072] Figure 1A A comparison of shank length between different sexes of the Zhangjiajie white-feathered black-bone chicken;

[0073] Figure 1B A comparative chart showing the difference in shank length to weight ratio between different sexes of Zhangjiajie white-feathered black-bone chicken;

[0074] Figure 1C A comparison of shank length between different sexes in the high and low shank length groups of Zhangjiajie white-feathered black-bone chickens.

[0075] 2.1 Data quality control and variation detection

[0076] To ensure that the extracted DNA samples meet the requirements for subsequent library construction, this embodiment uses 1.5% agarose gel electrophoresis to detect the purity and integrity of the DNA samples. Figure 1D As can be seen, the DNA bands are clear and without tailing, and the OD260 / 280 values ​​of each sample are between 1.8 and 2.0. This indicates that the DNA samples have not degraded and all meet the requirements for sequencing library preparation.

[0077] After filtering the WGS data, the average data size per individual was 14.22 Gb (clean base). The average alignment rate to the chicken reference genome was 98.59%, the average Q20 alignment was 98.19%, the average Q30 alignment was 94.79%, the GC content ranged from 42.97% to 44.94%, with a relatively high proportion of Q20 and Q30 GC content. The GC content results showed no obvious bias. The average genome coverage depth was 11.49%, and the average 1X coverage was 97.83% (Tables 1-1 and 1-2).

[0078] After filtering the population quality control data of Zhangjiajie white-feathered black-boned chickens, a total of 12,467,759 high-quality SNPs were identified. Among the 41 autosomes, SNPs were most prevalent on chromosomes 1, 2, 3, and Z. The chromosomal distribution of SNPs is shown in [Figure showing the distribution on chromosomes]. Figure 1E .

[0079] Figure 1D Agarose gel electrophoresis image of DNA from individual poultry blood samples;

[0080] Figure 1E This is a diagram showing the autosomal SNP density of the Zhangjiajie White-feathered Silkie chicken population.

[0081] Table 1-1 Sequencing Data Quality Statistics

[0082]

[0083] Table 1-2 Statistical Table of Genome Alignment Results and Sequencing Depth

[0084]

[0085]

[0086] 2.2 Population Structure Analysis of Zhangjiajie White-feathered Silkie Chickens Based on Height and Leg Length

[0087] 2.2.1 SNP test results of high and low shank length groups of Zhangjiajie white-feathered black-boned chicken

[0088] The number of SNPs and heterozygosity detected in the whole genome of HT and LT roosters were statistically analyzed. The number of SNPs for each individual is as follows: Figure 1F As shown, the HT group detected an average of 5,620,173 SNPs, with the number of individual SNPs ranging from 5,428,694 to 5,761,518; the LT group detected an average of 5,627,736 SNPs, with the number of individual SNPs ranging from 5,486,561 to 5,745,243. The average number of SNPs detected in the LT group was slightly higher than that in the HT group. SNP heterozygosity is the proportion of heterozygous SNPs to the genome size. The SNP heterozygosity of each individual is shown in the figure below. Figure 1GAs shown, the average heterozygosity of SNPs in both the HT and LT groups was 0.62%. These data indicate that both the HT and LT groups of roosters exhibit high genetic variability and stability at the genomic level, with similar SNP numbers and consistent heterozygosity.

[0089] 2.2.2 Population Structure Analysis of Zhangjiajie White-feathered Silkie Chickens Based on Height and Leg Length

[0090] To investigate the genetic relationships among different tibia length subgroups within the same population of Zhangjiajie white-feathered black-boned chickens, autosomal variations of 12,467,759 high-quality SNPs were analyzed for population genetic diversity. PCA analysis showed that PC1 (explaining 10.71% of the total variation) and PC2 (explaining 10.2% of the total variation) reflected the genetic relationships among different tibia length subgroups. At the PC1 and PC2 levels, significant segregation was observed between the different tibia length subgroups, but the two groups did not form completely independent populations. Figure 1H Population structure analysis results show that when K=2 (assuming the ancestral population number is 2), the Zhangjiajie White-feathered Silkie Chicken cannot be divided into two completely independent populations. Figure 1I The NJ phylogenetic tree results showed that the HT and LT groups could be clearly distinguished, but individuals L-2-a and L-4-a in the LT group had a closer genetic relationship with individuals in the H group. Figure 1J ).

[0091] The above results indicate that there is a certain degree of genetic differentiation between the HT group and the LT group (i.e., different shank length groups) of Zhangjiajie white-feathered black-bone chicken, but the degree of differentiation is low, and some individuals share similar genetic backgrounds.

[0092] Figure 1F A statistical chart of SNP variants in Zhangjiajie white-feathered black-bone chicken;

[0093] Figure 1G A statistical chart showing the heterozygosity ratio of SNPs in Zhangjiajie white-feathered black-bone chicken.

[0094] Figure 1H The principal component analysis results of Zhangjiajie white-feathered black-bone chicken are shown in the figure.

[0095] Figure 1I A population structure analysis diagram of the Zhangjiajie White-feathered Silkie Chicken;

[0096] Figure 1J NJ tree diagram of Zhangjiajie white-feathered black-boned chicken.

[0097] 2.3 Genome-wide selective scanning and enrichment analysis

[0098] Using the sliding window technique, the Fst value and πratio of each window were calculated, and the top 5% of windows with the highest scores (Fst > 0.06, Log2(πratio) > 1.2) were selected as candidate regions affected by selection. Combining the results of the two selection scans, we labeled 931 selected regions in the genome, with the most abundant selection regions on chromosome Z (222), followed by chromosome 1 (128) and chromosome 2 (125). Figure 2A Compared to group L, group H, as a domesticated population subjected to selective elimination, had 1825 genes identified by the Fst method and 1690 genes identified by the πratio method. The intersection of the two methods identified 415 key genes. Figure 2B ).

[0099] To further investigate key genes influencing tibia length, we performed GO enrichment analysis on candidate differentially expressed genes. Figure 2C The results showed that there were 109 regions with significant differences. Among them, the GO entries classified as biological processes mainly involved ion transmembrane transport, chromosome structure, protein synthesis and modification, cell adhesion and migration, signal transduction, and multicellular development. These processes are closely related to molecular functions such as metabolism, ion balance, potential regulation, cell proliferation and transport, and growth and development regulation. The genes involved include FGF10, Hes5, TGFBR2, SMAD2, CTNNA2, Homer1, ATP5F1A, PLCH2, SLC15A4, PANK4, HSD17B4, Pex10, Skp2, CDH13, ADGR12, and NIPBL (Table 2-1).

[0100] KEGG enrichment analysis revealed a total of 51 pathways enriched. Significantly different regions were mainly enriched in glyoxylate and dicarboxylic acid metabolism, glycine, serine and threonine metabolism pathways, the Noth signaling pathway, ECM-receptor interaction-related pathways, the FOXO signaling pathway, TH17 cell differentiation, and energy metabolism. Figure 2D (Table 2-1).

[0101] Given the relatively small sample size of this study, the Hes5 gene will be selected in the Zhangjiajie white-feathered black-bone chicken population for verification in the future, so as to clarify the correlation between the polymorphism of the candidate gene and the high or low shank length phenotype, and provide a corresponding reference for the breeding of high-shank individuals in actual production.

[0102] Figure 2A A schematic diagram of the selection area for the Zhangjiajie White-feathered Silkie Chicken population with varying shank lengths;

[0103] Figure 2B Venn diagram of the selected genes for Zhangjiajie white-feathered black-bone chicken;

[0104] Figure 2C GO annotation diagram of candidate differentially expressed genes for Zhangjiajie white-feathered black-bone chicken;

[0105] Figure 2D A schematic diagram of the top 20 representative KEGG pathways of Zhangjiajie white-feathered black-bone chicken.

[0106] Table 2-1 Items and genes associated with the regulation of tibia length by selected genes (P<0.05)

[0107]

[0108]

[0109] 2.4 SNP analysis of candidate gene fragments

[0110] Based on previous resequencing analysis, the Hes 5B gene was selected as a candidate gene affecting the shank length trait in male Silkie chickens. Specific primers were designed targeting mutation sites on the exons of the Hes 5B gene, based on the Hes 5B gene sequence information provided by NCBI, and PCR amplification was performed (Table 3-1). Using Zhangjiajie Silkie chicken genomic DNA as a template, PCR amplification was performed. The results showed that the amplified fragment was consistent in size with the target fragment and had good specificity, allowing for direct sequencing. Figure 3A ).

[0111] The SnapGene software was used to compare the sequencing results of the PCR products with the gene reference sequence, such as... Figure 3B As shown. In the Hes5C gene, the following SNPs were identified: at position 1419472, SNP4 is a substitution of cytosine (C) to thymine (T); at position 1419866, SNP5 is also a substitution of cytosine (C) to thymine (T); at position 1419886, SNP6 is a substitution of adenine (A) to guanine (G); at position 1419900, SNP7 is a substitution of guanine (G) to adenine (A); and finally, at position 1419904, SNP8 is a substitution of thymine (T) to cytosine (C).

[0112] Table 3-1 Primer information for PCR amplification of Hes 5 gene variant sites in Zhangjiajie White-feathered Silkie Chicken

[0113]

[0114]

[0115] The target sequence amplified by primers SEQ ID NO.1 and SEQ ID NO.2 is:

[0116] ctttgtgtgtgtcagggaatgggtcagaaggcaaagtaggtcaggccccagaaaatctctaataagtgctccatttctttcac

[0117] agctcaggaagccggtggtggagaaaatgcgccgtgaccggattaacagcagcattgagcagctgaagctgctcctgga

[0118] gaaggagttccagagacaccaacccaactccaagctggagaaagctgatgtcctggaggtggccgtcagctacctgaag

[0119] cagcagagccagctgcaggagccaggtgagcacataacaccatcgcatcacttgctcccacgggcacctgctgtcccag

[0120] agatccctaggctgcccccacccccagatcaaggcccacagtcaaggctcacggactcaggctcctgaaagaagcttca

[0121] agcataagctgccactgccccgtgcttgggcaacaatcttaactcactctatttgcctttttttcttttctagcattcattcacaagaacccagaacaggacttcaacagcggata(SEQ ID NO.5);

[0122] The target sequence amplified by primers SEQ ID NO.3 and SEQ ID NO.4 is:

[0123] tgagcacataacaccatcgcatcacttgctcccacgggcacctgctgtcccagagatccctaggctgcccccacccccag [[ID=z3]]

[0124] atcaaggcccacagtcaaggctcacggactcaggctcctgaaagaagcttcaagcataagctgccactgccccgtgcttg

[0125] ggcaacaatcttaactcactctatttgcctttttttcttttctagcattcattcacaagaacccagaacaggacttcaacagcggat

[0126] acctgcggtgcttaagggaagcgatgcattttctatcctactatgaacccaggaaggaaactcaggcccagctgatcaagc

[0127] acttctgcaaagctcagatgggtgcggatgtcacgcgctctcccaccacgcacagtgcgccttgctcaccctgtgtgtttgc

[0128] cagaaagcagcctgcccacaaaactgcccacaaaaccgcccagaaaactgcagcagcagctcataccatctggagacc

[0129] ctggtagacctgctgatgaacttggctttattcctatgttttgctaaaaagaaaaaaaattagagggacttgtgatttaacagtccctcttcaaagtaggaaacactgctttccaaaggtgggagggggaaggctttgtttttc (SEQ ID NO. 6);

[0130] Figure 3A The image shows the PCR amplification results of the Hes5C gene, where wells 1-4 and wells 5-9 are HES5C gene PCR amplification product 1 and PCR amplification product 2, respectively.

[0131] Figure 3B A comparison of Sanger sequencing data for SNP4, SNP5, SNP6, SNP7, and SNP8.

[0132] 2.5 Population genetic parameter analysis of the Hes5 gene in Zhangjiajie white-feathered black-boned chickens

[0133] Sequencing results of 5 SNPs mutation sites of the Hes5C gene in 188 Zhangjiajie white - feather乌鸡 individuals were statistically analyzed, and the genotypes, genotype frequencies and population genetic parameters were analyzed (Table 4 - 1). After chi - square goodness - of - fit test analysis, the genotype frequencies and allele frequencies of the polymorphic sites of the Hes5C gene were in Hardy - Weinberg equilibrium in the rooster population (P>0.05). In the hen population, the g.1419886A>G and g.1419904T>C sites of the Hes5C gene did not reach Hardy - Weinberg equilibrium (P<0.05), which may be related to the small number of experimental populations or the degree of inbreeding.

[0134] For the SNP4, SNP5, SNP6, SNP7 and SNP8 sites of the Hes5C gene, the dominant genotypes are CC, CC, AA, GG and TT, and the occurrence frequencies are 56.00%, 46.40%, 58.3%, 90.50% and 67.00% (male); 51.90%, 45.20%, 64.40%, 88.5% and 55.80% (female). Except for the SNP7 site, the polymorphic information content shows moderate polymorphism (0.25<PIC<0.5), specifically 0.322, 0.348, 0.289, 0.325 (male); 0.316, 0.350, 0.292, 0.326 (female). To sum up, the experimental results can be used as effective genetic markers to a certain extent and as recommended indicators for the evaluation of the genetic resources of this population.

[0135] Table 4 - 1 Analysis of population genetic parameters of Hes5 gene polymorphism in Zhangjiajie white - feather乌鸡

[0136]

[0137]

[0138] 2.6 Effects of SNP sites of the Hes5 gene on some body size traits of Zhangjiajie white - feather乌鸡

[0139] The 3 body size traits of 188 Zhangjiajie white - feather乌鸡 were respectively associated with the genotypes of the SNP sites of the Hes5C gene. As Figure 3C and Figure 3DAs shown, association analysis was performed on different genotypes at the five SNP loci of the Hes5C gene. SNP4 of the Hes5C gene showed highly significant or significant correlations with body length (P<0.01), shank length (P<0.01), and keel length (P<0.05) in roosters. In particular, roosters with the TT genotype showed significantly better results than those with the CC genotype in these traits (P<0.01). SNP5 showed a significant correlation with body length, shank length, and keel length in hens (P<0.05). For SNP6, body length, shank length, and keel length in roosters were significantly correlated with this locus (P<0.05), while in hens, these traits and the shank length index showed highly significant or significant correlations with SNP6 (P<0.05). In roosters, the AG genotype showed significantly higher body length, shank length, and keel length than the AA genotype (P<0.05). In hens, the AG genotype showed a significantly higher body length than the GG genotype (P<0.01), and a significantly higher shank length than the AA genotype (P<0.05). Notably, different genotypes at SNP7 and SNP8 loci were not significantly associated with body shape traits in roosters (P>0.05). In hens, only the Bb and bb genotypes were detected at the SNP8 locus, and they showed a significant correlation with body length and keel length (P<0.05), which may be related to the small sample size.

[0140] Figure 3C Association analysis diagram of SNP4, SNP5, SNP6 loci with body size traits of Zhangjiajie white-feathered black-bone chicken;

[0141] Figure 3D This is a correlation diagram between SNP7, SNP8 loci and the body size trait of Zhangjiajie white-feathered black-boned chicken.

[0142] 2.7 Linkage disequilibrium and haplotype association analysis of the Hes5 gene

[0143] Linkage disequilibrium and haplotype analysis were performed on SNP4, SNP5, and SNP6 sites of the Hes5C gene using SHEsis software. Figure 3E As shown, the three SNP sites in the Hes5C gene were not in linkage disequilibrium (D′<0.398, r2<0.125). A total of 8 haplotypes (CCA, CCG, CTA, CTG, TCA, TCG, TTA, TTG) were detected and named H5, H6, H7, H8, H9, H10, H11, and H12, respectively. The highest frequency of haplotype H6 was 0.525 in roosters and 0.484 in hens (P>0.05) (Table 5-1).

[0144] The results indicate that the genetic associations among the three loci of the Hes5C gene are weak, exhibiting low-degree linkage disequilibrium (r). 2<0.13) suggests that these sites are relatively independent during genetic recombination.

[0145] Figure 3E Linkage disequilibrium analysis of SNP4, SNP5 and SNP6 sites of the Hes5C gene.

[0146] Table 5-1 Hes5C Genotype Analysis

[0147]

[0148] 2.8 Effects of Hes5 gene SNP haplotype combinations on some body size traits of Zhangjiajie white-feathered black-boned chickens

[0149] To assess the multiple interactions between SNP sites, haplotype combinations generated by H5–H12 of the Hes5C gene were analyzed. A variety of haplotype combinations were screened out. Haplotype combinations with fewer than 3 samples were not included in the association analysis, as shown in Table 6-1.

[0150] In the Hes5C gene, the H8H11 haplotype combination was significantly higher than the H5H5 and H5H10 haplotype combinations (P<0.01), showing a greater advantage in the three body size traits of roosters: body length, shank length, and keel length. The H5H11 haplotype combination showed a greater advantage in body length and shank length in hens (Tables 6-1 and 6-2).

[0151] In the Zhangjiajie Silkie chicken population, the H8H11 haplotype of the Hes5C gene (P < 0.01) was highly or significantly correlated with shank length. The H8H11 haplotype combination of the Hes5C gene may provide a greater economic advantage for breeding the shank length trait in Zhangjiajie Silkie chickens. These results provide a theoretical basis for the Hes5C gene to be used as a candidate gene for assisting in the breeding of shank length and body size traits in Zhangjiajie Silkie chickens.

[0152] Table 6-1 Association analysis between Hes5C gene haplotype combinations and certain body size traits in roosters

[0153]

[0154] Table 6-2 Association analysis between Hes5C gene haplotype combinations and some body size traits in hens

[0155]

[0156]

[0157] Note: Different lowercase letters indicate statistically significant differences (P<0.05).

[0158] Summarize:

[0159] Different shank length groups of Zhangjiajie white-feathered black-bone chickens exhibited a certain degree of differentiation. Selection signal analysis identified 17 genes potentially associated with shank length, including FGF10, Hes5, TGFBR2, SMAD2, CTNNA2, Homer1, ATP5F1A, PNAK4, CDH13, ADGR12, NIPBL, PLCH2, PTPRC, and SLC15A4. GO enrichment and KEGG pathway analysis revealed significant enrichment of differentially expressed genes in glyoxylate and dicarboxylic acid metabolic pathways, glycine, serine, and threonine metabolic pathways, the Notch signaling pathway, the FOXO signaling pathway, and ECM synthesis.

[0160] SNPs were identified in the Hes5 gene screened by previous resequencing analysis. Five truly distributed SNPs were found in the exon regions of the Hes5C subtype: g.1419472C>T (SNP4), g.1419866C>T (SNP5), g.1419886A>G (SNP6), g.1419900G>A (SNP7), and g.1419904T>C (SNP8). Association analysis with some body size traits showed that SNP4, SNP5, and SNP6 were significantly associated with shank length in Zhangjiajie Silkie chickens. The TT genotype at SNP4 exhibited the best growth characteristics in roosters regarding body oblique length, shank length, and keel length. SNP6 was significantly associated with body size traits in both male and female chickens. The TT genotype and H8H11 haplotype combination at the g.1419472C>T (SNP4) site of the Hes5C gene can be used as candidate genes to assist in the breeding of the "tall-legged" trait of Zhangjiajie white-feathered black-bone chicken.

Claims

1. The application of a molecular marker associated with chicken shank length in the genetic breeding of Zhangjiajie white-feathered black-boned chickens, characterized in that, The reference genome is GCF_016699485.2; the molecular markers are the SNP4, SNP5, and SNP6 sites of the Hes5C gene; the SNP4 site is the g.1419472C>T site, the SNP5 site is the g.1419866C>T site, and the SNP6 site is the g.1419886A>G site. The SNP4 locus is associated with the body oblique length, tibia length, and keel length of roosters; The SNP5 locus is associated with the body oblique length, tibia length, and keel length of hens; The SNP6 locus is associated with the body oblique length, tibia length, and keel length of roosters, and the SNP6 locus is associated with the body oblique length, tibia length, keel length, and tibia length index of hens. The SNP4 site is located in the first target sequence as shown in SEQ ID NO.5; the first target sequence was obtained by PCR amplification using the primers shown in SEQ ID NO.1 and SEQ ID NO.2 with Zhangjiajie white-feathered black-bone chicken genomic DNA as a template; The SNP5 and SNP6 sites are located in the second target sequence as shown in SEQ ID NO. 6; the second target sequence was obtained by PCR amplification using the primers shown in SEQ ID NO. 3 and SEQ ID NO. 4 with Zhangjiajie white-feathered black-bone chicken genomic DNA as a template.

2. The application according to claim 1, characterized in that, The TT genotype at the SNP4 locus is superior to the CC genotype in terms of body oblique length, tibia length, and keel length in roosters. The AG genotype at the SNP6 locus is superior to the AA genotype in terms of body oblique length, shank length, and keel length in roosters; the AG genotype at the SNP6 locus is superior to the GG genotype in terms of body oblique length and superior to the AA genotype in terms of shank length in hens.

3. The application according to claim 1, characterized in that, The haplotype combination H8H11 for roosters is superior to haplotype combinations H5H5 and H5H10 in terms of body oblique length, shank length, and keel length; the haplotype combination H5H11 for hens is superior to other haplotype combinations in terms of body oblique length and shank length. The haplotype combination H8H11 is a combination of haplotypes H8 and H11; the haplotype combination H5H11 is a combination of haplotypes H5 and H11; the haplotype combination H5H5 is a combination of haplotypes H5 and H5; the haplotype combination H5H10 is a combination of haplotypes H5 and H10. The nucleotide combination of SNP4, SNP5, and SNP6 in haplotype H5 is CCA; the nucleotide combination of SNP4, SNP5, and SNP6 in haplotype H8 is CTG; the nucleotide combination of SNP4, SNP5, and SNP6 in haplotype H11 is TTA; and the nucleotide combination of SNP4, SNP5, and SNP6 in haplotype H10 is TCG.

Images