Molecular markers of TaARF14-1D, a gene regulating wheat storage protein content, and their applications.

By detecting the genotype of specific SNP sites in the wheat genome and using KASP molecular marker technology to identify the content of wheat storage proteins, the problem of identification difficulties in existing technologies has been solved, enabling efficient identification and early screening of storage protein content and improving the quality of wheat processing.

CN119859708BActive Publication Date: 2025-12-02INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510254670.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-05
Publication Date
2025-12-02
Estimated Expiration
2045-03-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify or assist in identifying the storage protein content of wheat, which affects the improvement of wheat processing quality.

Method used

By detecting the genotype of specific SNP sites in the wheat genome, fluorescence detection is performed using primer combinations to determine the genotype of the wheat to be tested. The content of storage proteins is then identified based on the genotype results, and KASP molecular marker technology is used for identification.

Benefits of technology

It enables accurate identification of wheat storage protein content, allowing for early screening of wheat with high storage protein content and improving bread processing quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005298015310000071
    Figure BDA0005298015310000071
  • Figure BDA0005298015310000081
    Figure BDA0005298015310000081
  • Figure BDA0005298015310000091
    Figure BDA0005298015310000091
Patent Text Reader

Abstract

This invention discloses a molecular marker for the wheat storage protein content regulatory gene TaARF14-1D and its application. This invention belongs to the field of biotechnology, specifically relating to a molecular marker for the wheat storage protein content regulatory gene TaARF14-1D and its application. The method for identifying or assisting in the identification of wheat storage protein content according to this invention includes method A or B: A) detecting the genotype of a SNP site in the wheat genome to be tested, and identifying the wheat storage protein content based on the genotype. The SNP site is a single SNP site on the wheat 1D chromosome, with nucleotide type A or G, and is the 71st nucleotide of sequence 4; B) detecting the haplotype in the wheat genome to be tested, and identifying the wheat storage protein content based on the haplotype. The wheat variety with haplotype TaARF14-1D-Hap1 has a higher storage protein content than the wheat variety with haplotype TaARF14-1D-Hap2.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the molecular marker of the wheat storage protein content regulatory gene TaARF14-1D and its application. Background Technology

[0002] Wheat storage proteins mainly include glutenin and prolamins. The composition and content of storage proteins determine the rheological properties of wheat dough, and changing the composition and content of storage proteins is of great significance for improving the processing quality of wheat.

[0003] The wheat auxin response factor (ARF) family is a group of key transcription factors in plants that play a central role in plant development. They bind to auxin response elements (AuxREs) and regulate gene expression, influencing processes such as cell division, differentiation, and tissue development. Molecular interactions have confirmed that TaARF14 can bind to the promoter of storage protein-encoding genes. Transgenic studies show that TaARF14 overexpression promotes storage protein accumulation, increases dough strength, elasticity, and extensibility, and improves bread processing quality. Identifying allelic variants with high TaARF14 gene expression will contribute to the breeding of high-quality, strong-gluten wheat varieties. Summary of the Invention

[0004] The main problem this invention aims to solve is how to identify or assist in the identification of wheat storage protein content.

[0005] To address the above problems, this invention provides a method for identifying or assisting in the identification of wheat storage protein content.

[0006] The method of the present invention for identifying or assisting in the identification of wheat storage protein content includes method A or B:

[0007] A) Detect the genotype of the SNP site in the wheat genome to be tested, and identify or assist in identifying the wheat storage protein content based on the genotype. The SNP site is a SNP site on the wheat chromosome 1D, and its nucleotide type is A or G, which is the 71st nucleotide of sequence 4 in the sequence listing.

[0008] B) Detect haplotypes in the genome of the wheat to be tested, and identify or assist in identifying the wheat storage protein content based on the haplotypes. The storage protein content of wheat variety with haplotype TaARF14-1D-Hap1 is higher than that of wheat variety with haplotype TaARF14-1D-Hap2.

[0009] The allelic variations of haplotype TaARF14-1D-Hap1 at positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548, and 427153766 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are A, T, G, G, T, G, C, C, and T, respectively.

[0010] The allelic variations of haplotype TaARF14-1D-Hap2 at positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548, and 427153766 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are T, A, A, A, C, C, T, T, and A, respectively.

[0011] As one implementation method, the method for identifying or assisting in the identification of wheat storage protein content may include the following steps:

[0012] (1) Using the genomic DNA of the wheat to be tested as a template, KASP molecular marker detection was performed using a primer combination;

[0013] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site in the wheat to be tested;

[0014] (3) The storage protein content of the wheat to be tested was determined based on the genotype results: the storage protein content of the wheat to be tested with the genotype AA at the SNP locus was higher than that of the wheat to be tested with the genotype GG at the SNP locus.

[0015] In the above method, the primer composition consists of primer A, primer B, and primer C;

[0016] Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 21-38 of sequence 1 in the sequence listing;

[0017] Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-39 of sequence 2 in the sequence listing;

[0018] The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

[0019] In the above method, the KASP reaction system can be: 2.0 μL KASP 2×Master Mix (LGC, catalog number: 13448166), 0.048 μL KASP primers (3 primers mixed, with a total concentration of 50 μM, wherein the molar ratio of two upstream primers and one downstream primer is 2:2:5), and 2.0 μL template DNA (50 ng / μL).

[0020] The reaction program was as follows: pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, followed by a 1 min amplification cycle at 61℃-55℃ (using a touch-down program, decreasing the temperature by 0.6℃ per cycle); denaturation at 94℃ for 20 s, followed by a 1 min amplification cycle at 55℃; and a further 31 cycles of amplification. Extension at 72℃ for 3 min, followed by storage at 4℃.

[0021] In the above method, the method for determining the genotype of the SNP in the wheat to be tested can be as follows: A base type has FAM fluorescence and is distributed near the x-axis; G base type has HEX fluorescence and is distributed near the y-axis; samples with no detection signal are distributed near the origin.

[0022] In the above method, KASP labeling can be performed on a regular PCR amplification instrument.

[0023] This invention also provides a method for wheat breeding, including method M or N:

[0024] M) Detect the genotype or haplotype of the SNP locus mentioned above in the wheat genome, and select wheat with the genotype AA at the SNP locus as the parent for breeding, wherein AA is the homozygous type of the SNP locus A;

[0025] N) The haplotypes described above in the wheat genome were detected, and wheat with the haplotype TaARF14-1D-Hap1 was selected as the parent for breeding. The allelic variations of the haplotype TaARF14-1D-Hap1 at positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548 and 427153766 in the Chinese spring wheat reference genome sequence RefSeqv1.0 are A, T, G, G, T, G, C, C and T, respectively.

[0026] This invention also provides the application of the methods described above in wheat breeding.

[0027] This invention also provides the application of a substance for detecting SNP polymorphisms or genotypes in the wheat genome in any of the following:

[0028] (1) To identify or assist in the identification of wheat storage protein content;

[0029] (2) Wheat breeding;

[0030] (3) Prepare products for identification or auxiliary identification of wheat storage protein content;

[0031] (4) Prepare products for wheat breeding;

[0032] The SNP site is a SNP site on wheat chromosome 1B, and its nucleotide type is A or G, which is the 71st nucleotide of sequence 4 in the sequence listing.

[0033] In the above methods and applications, the genotype of the SNP locus is AA or GG, where AA is the homozygous type of the SNP locus being A, and GG is the homozygous type of the SNP locus being G; the storage protein content of the wheat sample with the genotype AA at the SNP locus is higher than that of the wheat sample with the genotype GG at the SNP locus.

[0034] The present invention also provides a product containing the substance described in the foregoing applications, wherein the product may be any of the following:

[0035] C1) Products that detect single nucleotide polymorphisms or genotypes related to wheat storage protein content;

[0036] C2) Products used for identifying or assisting in the identification of wheat storage protein content;

[0037] C3) Products used in wheat breeding.

[0038] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0039] In the above applications or products, the substance may be D1), D2), or D3):

[0040] D1) The substance described is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites;

[0041] D2) The substance described is a PCR reagent containing the primer composition described in D1);

[0042] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0043] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).

[0044] Furthermore, in the above applications or products, the primer composition consists of primer A, primer B, and primer C;

[0045] Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 21-38 of sequence 1 in the sequence listing;

[0046] Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-39 of sequence 2 in the sequence listing;

[0047] The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

[0048] The present invention also provides a DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing.

[0049] This invention also provides the use of the DNA molecule described above in any of the following:

[0050] (1) To identify or assist in the identification of wheat storage protein content;

[0051] (2) Wheat breeding;

[0052] (3) Prepare products for identification or auxiliary identification of wheat storage protein content;

[0053] (4) Prepare products for wheat breeding.

[0054] In this article, the breeding objective may include developing wheat with high storage protein content. The wheat may be a pure line variety or an inbred line.

[0055] The method established in this invention can be used to predict wheat storage protein content, to perform early screening of wheat to be screened, and to be used for molecular marker-assisted breeding of wheat. It has important application value in the research of discovering wheat germplasm resources with increased storage protein content and breeding wheat varieties with increased storage protein content. Attached Figure Description

[0056] Figure 1 The variant sites and haplotype results of the wheat TaARF14-1D gene.

[0057] Figure 2 The results of microplate reader typing of KASP products are shown. Detailed Implementation

[0058] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0060] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0061] The 152 wheat lines from the natural populations in the Huang-Huai wheat region described in the following examples have been documented in: Li J, Xie L, Tian X, Liu S, Xu D, Jin H, Song J, Dong Y, Zhao D, Li G, Li Y, Zhang Y, Zhang Y, Xia X, He Z, Cao S. (2021) TaNAC100acts as an integrator of seed protein and starch synthesis exerting pleiotropic effects on agronomic traits in wheat. Plant Journal 108(3):829-840. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0062] Data were processed using EXCEL statistical software. Experimental results are expressed as mean ± standard deviation. The significance test was performed using an independent samples t-test, and * indicates a significant difference at the P < 0.05 level.

[0063] Example 1: Identification of TaARF4-1D gene polymorphism sites and haplotypes

[0064] The gene number of TaARF14-1D (TraesCS1D02G337400) was entered into the wheat genome variation database (Wheat-SnpHub-Portal, http: / / wheat.cau.edu.cn / Wheat_SnpHub_Portal / ). 183 varieties (MP group and NC-CC group) were selected from the database, and the open reading frames and their upstream and downstream 2Kb variation information were retrieved. A total of 13 variation sites were identified, denoted as Indel 1, Indel 2, Indel 3, Indel 4, SNP 5, SNP 6, SNP 7, SNP 8, SNP 9, SNP 10, SNP 11, SNP 12, and SNP 13. Figure 1The 13 variant sites in the Chinese Spring reference genome sequence RefSeq v1.0 are 427148611, 427148628, 427148806, 427148978, 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548, and 427153766. The above closely linked allelic variant information defines two major haplotypes of TaARF14-1D: TaARF14-1D-Hap1 and TaARF14-1D-Hap2. Figure 1 ).

[0065] Specifically, TaARF14-1D-Hap1 is identified by positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548, and 427153766 in the Chinese spring wheat reference genome sequence RefSeq, which correspond to A, T, G, G, T, G, C, C, and T, respectively; TaARF14-1D-Hap2 is identified by positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548, and 427153766 in the Chinese spring wheat reference genome sequence RefSeq. In v1.0, bits 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548, and 427153766 are T, A, A, A, C, C, T, T, and A, respectively.

[0066] Example 2: Development of molecular markers for the TaARF14-1D haplotype and its specific primer set

[0067] A KASP marker, K-1D-SNP7, was designed using Polymarker (https: / / www.polymarker.info / ) targeting SNP7 of TaARF14-1D (position 427150166 in the Chinese spring wheat reference genome sequence RefSeq v1.0). The design included a set of KASP primers (consisting of forward primers F1 and F2, and reverse primer R), and the primer sequences were evaluated using WheatOmics (http: / / 202.194.139.32 / ).

[0068] Forward primer A: 5'- GAAGGTGACCAAGTTCATGCTTTGGTGAGGCGCTTGGA-3' (SEQ ID No: 1, the underlined part is the FAM fluorescent probe specific recognition sequence);

[0069] Forward primer B: 5'- GAAGGTCGGAGTCAACGGATT TTTGGTGAGGCGCTTGGG-3' (SEQ ID No:2, the underlined part is the HEX fluorescence-specific recognition sequence);

[0070] Downstream primer C: 5'-GGTGAGATCAGCAACAAAAGTG-3' (SEQ ID No:3).

[0071] The K-1D-SNP7 marker indicates that the 71st base from the 5′ end of SEQ ID No:4 in the wheat genome (corresponding to the last base at the 3′ end of the two forward primers) is G or A. In SEQ ID No:4, r represents A or G.

[0072] SEQ ID No:4:5'

[0073] -ACGCATGGAGGTTTCTCTGTTCCTCGCCGGGCAGCCGAGGACTGTTTCGCACCTTTGGTGAGGCGCTTGGrAA AAATAATTCCAAACCTGCACATTGATATAGTCACTTTTGTTGCTGATCTCACCACTTCAATCTCTGCA-3'.

[0074] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the nucleotide fragment with "A" at the SNP7 site. The fluorescent signal of the FAM group can be read using an ELISA reader or a real-time PCR instrument.

[0075] Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the nucleotide fragment with "G" at the SNP7 site. The fluorescent signal of the HEX group can be read using an ELISA reader or a real-time PCR instrument.

[0076] Example 3: Establishment of a method for detecting SNP7 locus genotypes using KASP markers

[0077] 1. PCR amplification system and procedure

[0078] Genomic DNA was extracted from common wheat leaves using the CTAB method. The quality and concentration of the genomic DNA had to meet the requirements for PCR, with the following standards: agarose gel electrophoresis showed a single DNA band without obvious diffusion; UV spectrophotometer Nanodrop 2100 (Thermo) detected an A260 / A280 ratio between 1.8 and 2.0 (indicating no protein contamination in the DNA sample), an A260 / A230 ratio between 1.8 and 2.0 (indicating low salt ion concentration in the DNA sample), and no obvious light absorption at 270 nm (indicating no phenol contamination in the DNA sample); the concentration of the wheat genomic DNA to be tested was 50-200 ng / μL.

[0079] 2. KASP-labeled PCR amplification

[0080] Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the KASP primer set synthesized in Example 2 to obtain PCR products.

[0081] Reaction system: 2.0 μL KASP 2×Master Mix (LGC, catalog number: 13448166), 0.048 μL KASP primers (3 primers mixed, total concentration of 50 μM, with the molar ratio of two upstream primers and one downstream primer being 2:2:5), 2.0 μL template DNA (50 ng / μL).

[0082] The reaction program was as follows: pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, followed by a 1 min amplification cycle at 61℃-55℃ (using a touch-down program, decreasing the temperature by 0.6℃ per cycle); denaturation at 94℃ for 20 s, followed by a 1 min amplification cycle at 55℃; and a further 31 cycles of amplification. Extension at 72℃ for 3 min, followed by storage at 4℃.

[0083] The experiment also included a blank control (CK) in the reaction system without template DNA, with one control per plate.

[0084] 3. Genotyping

[0085] Fluorescence signals were detected using a PHERAstar Plus autofocus fluorescence multifunction microplate reader (BMG Labtech GmbH, Ortenberg, Germany), and genotyping was performed using KlusterCaller software (LGC, Hoddesdon, UK). Fluorescence values ​​were read by scanning the FAM and HEX beams of the microplate reader after the PCR amplification products cooled to below 40°C (FAM fluorescent probes were read at excitation wavelengths of 485 nm and emission wavelengths of 520 nm, and HEX fluorescent probes were read at excitation wavelengths of 528 nm and emission wavelengths of 560 nm). The genotype of the wheat sample at the SNP7 locus was determined based on the fluorescence signal color. A-type samples showed FAM fluorescence, distributed near the x-axis; G-type samples showed HEX fluorescence, distributed near the y-axis; samples with no detected signal were distributed near the origin.

[0086] The specific judgment principles are as follows: If the KASP marker amplification product of the wheat to be tested shows a blue fluorescent signal, then the wheat to be tested has a homozygous AA genotype at the SNP7 locus (i.e., a homozygous genotype with SNP7 at the wheat genome); if the KASP marker amplification product of the wheat to be tested shows a red fluorescent signal, then the wheat to be tested has a homozygous GG genotype at the SNP7 locus (i.e., a homozygous genotype with SNP7 at the wheat genome).

[0087] Example 4: Application of molecular marker K-1D-SNP7 and its KASP primer set in identifying wheat multi-environment storage protein phenotypes

[0088] 1. Field phenotypic identification and data analysis of 152 natural wheat populations in the Huang-Huai region

[0089] 152 natural wheat varieties from the Huang-Huai wheat region were planted in Anyang, Henan and Suixi, Anhui in 2012-2013 and 2013-2014, and in Anyang, Henan and Gaoyi, Hebei in 2014-2015. A completely randomized block design with three replicates was used, with single-row plots, row length 1.5m, row width 0.2m, and 50 grains / row. Field management practices followed local wheat field management standards.

[0090] Protein content was determined using a near-infrared reflectance spectrometer (Perten DA 7200, Springfield, IL, USA). BLUE values ​​for protein phenotypes in various environments are shown in Table 1.

[0091] 2. The genotype of wheat strain SNP7 in the Huang-Huai wheat region was identified using the method described in Example 3. The specific genotype identification results are shown in Table 1.

[0092] Table 1. Genotyping and phenotypic data analysis of molecular marker K-1D-SNP7 on 152 representative wheat lines from the Huang-Huai wheat region.

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099] 3. Association analysis between wheat TaARF14-1D gene SNP7 locus genotype and storage protein

[0100] Based on the typing results from step 2, a t-test was performed using EXCEL statistical software to determine the genetic effect of the ARF14-1D gene haplotype on the storage protein. The results of the genetic effect analysis on the storage protein are shown in Table 2 (* indicates a significant difference, P < 0.05).

[0101] Table 2. Phenotypic relationship between SNP7 locus genotype and wheat storage protein content trait.

[0102]

[0103] The above results indicate that wheat varieties with the genotype AA at the SNP7 locus have significantly higher storage protein content than wheat varieties with the genotype GG. Based on the study in Example 1, the haplotype type corresponding to the wheat variety with the genotype AA at the SNP7 locus is ARF14-1D-Hap1. In subsequent breeding of wheat varieties with high storage protein content, wheat varieties with the genotype AA at the SNP7 locus or the haplotype type ARF14-1D-Hap1 can be used as parents for breeding.

[0104] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for identifying the storage protein content of wheat, characterized in that... This includes detecting the genotype of SNP sites in the genome of the wheat to be tested, and identifying the wheat storage protein content based on the genotype. The SNP site is the 71st nucleotide of sequence 4 in the sequence listing, and its nucleotide type is A or G. The genotype of the SNP site is AA or GG, where AA is the homozygous type of the SNP site being A, and GG is the homozygous type of the SNP site being G. The storage protein content of the wheat to be tested with the genotype AA at the SNP site is higher than that of the wheat to be tested with the genotype GG at the SNP site.

2. A method for wheat breeding, characterized in that... The genotype of the SNP locus described in claim 1 in the wheat genome was detected, and wheat with the genotype AA at the SNP locus was selected as the parent for breeding. The storage protein content of the wheat to be tested with the genotype AA at the SNP locus was higher than that of the wheat to be tested with the genotype GG at the SNP locus.

3. The application of the method of claim 1 in wheat breeding.

4. The application of substances for detecting the genotype of SNP sites in the wheat genome in any of the following: (1) Identify the storage protein content of wheat; (2) Wheat breeding; (3) Prepare products for identifying the content of wheat storage protein; (4) Preparation of wheat breeding products; The SNP site is the 71st nucleotide of sequence 4 in the sequence listing, and its nucleotide type is A or G; the genotype of the SNP site is AA or GG, where AA is the homozygous type of the SNP site being A, and GG is the homozygous type of the SNP site being G; the storage protein content of the wheat sample with the genotype AA at the SNP site is higher than that of the wheat sample with the genotype GG at the SNP site. The purpose of the breeding is to select wheat with the genotype AA at the SNP locus as the parent for breeding.

5. The application according to claim 4, characterized in that, The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

6. The application according to claim 5, characterized in that, The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 21-38 of sequence 1 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-39 of sequence 2 in the sequence listing; The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

Citation Information

Patent Citations

  • SNP molecular marker of wheat root-related traits and application

    CN109797149A

  • Molecular marker of wheat storage protein regulatory gene TaMADS4-1B, specific primer and application

    CN118345189A