Yangtze River cowfish polymorphism SNP molecular marker as well as development method and application of Yangtze River cowfish polymorphism SNP molecular marker

Abstract

The invention relates to a Yangtze river globefish polymorphic SNP molecular marker as well as a development method and application thereof, and belongs to the technical field of DNA molecular markers, nucleotide sequences of sites of the Yangtze river globefish polymorphic SNP molecular marker are as shown in SEQ ID NO: 1-NO.19, primers for amplifying the sites of the SNP molecular marker are as shown in Snpp 01-57, and the primers for amplifying the sites of the SNP molecular marker are as shown in SEQ ID NO: 1-SEQ ID NO: 2-SEQ ID NO: 3-SEQ ID NO: 4. The SNP molecular markers provided by the invention are all derived from high-quality chromosome-level genomes of the Yangtze-River cowfish, screening is carried out in combination with re-sequencing data of three geographical populations, polymorphic SNP loci in the genomes of the Yangtze-River cowfish can be more comprehensively detected, and by utilizing a KASP genotyping technology, the SNP molecular markers can be used for detecting the genomes of the Yangtze-River cowfish. Genetic typing can be efficiently and accurately performed on the polymorphic SNP sites of the Yangtze river globefish, the detection cost is remarkably reduced, and an effective genetic molecular marker is provided for population genetics research such as genetic diversity evaluation, genetic differentiation analysis and genetic relationship identification of the Yangtze river globefish and the sibling species of the Yangtze river globefish.

Description

Technical Field

[0001] The present invention relates to the technical field of DNA molecular markers, and in particular to a Yangtze River finless porpoise polymorphic SNP molecular marker and a development method and application thereof. Background Art

[0002] The Yangtze finless porpoise (Neophocaena asiaeorientalis) mainly inhabits the main stream of the middle and lower reaches of the Yangtze River, Dongting Lake and Poyang Lake, and the tail of its tributaries. It is currently the only freshwater cetacean living in the Yangtze River. It belongs to the Odontoceti suborder, Phocoenidae family, and Neophocaena genus, and has an important conservation status and research value. In recent decades, with the rapid economic development of the Yangtze River Basin, the intensity of human activities has increased sharply, resulting in the continuous deterioration of the ecological environment in the Yangtze River Basin and the serious decline of aquatic biological resources. As an important indicator of the health of the Yangtze River ecosystem, the Yangtze finless porpoise has only a thousand left, and its population is extremely endangered. Conservation efforts for the Yangtze finless porpoise are usually focused on addressing external threats that may limit its population recovery, such as human activity disturbances and natural climate impacts. However, conducting population genetics research on the Yangtze finless porpoise, analyzing the level of genetic diversity and genetic structure characteristics of its population at the molecular level, and then formulating scientific protection and management plans are of great significance to the protection of the germplasm resources of the Yangtze finless porpoise.

[0003] Genetic markers are important tools in population genetics research. They have now developed into the third generation of DNA molecular markers represented by SNP (single nucleotide polymorphism). Compared with second generation molecular markers such as SSR (microsatellite) and AFLP (amplified fragment length polymorphism), SNP has the advantages of uniform distribution in the genome, large number, high throughput, rich polymorphism, high accuracy, easy genotyping and no need to detect fragment length, and has excellent application prospects in the field of conservation genetics. At present, the research on population genetics of Yangtze finless porpoise mainly relies on molecular markers such as microsatellites. This method has problems such as long screening time, easy typing errors and low throughput. Existing methods for developing SNP molecular markers for finless porpoises, such as genomic libraries and CATS (comparative anchored sequence tracking), are often time-consuming, complex to operate and costly. By using KASP genotyping technology to screen high-quality chromosome-level genome and resequencing data of Yangtze finless porpoises, efficient screening of polymorphic SNP sites in the whole genome was achieved. This method is superior to traditional methods in terms of effectiveness, accuracy and cost-effectiveness.

[0004] Based on the genome and resequencing data of the Yangtze finless porpoise and combined with the KASP genotyping technology, this paper developed a polymorphic SNP molecular marker for the Yangtze finless porpoise, providing strong technical support for subsequent Yangtze finless porpoise conservation genetics research, germplasm resource protection and the formulation of related genetic management measures. Summary of the invention

[0005] Technical problems to be solved: In order to solve the technical problems existing in the prior art such as long screening time, easy typing errors and low throughput, complex operation and high cost, the present invention proposes a Yangtze finless porpoise polymorphic SNP molecular marker and its development method and application, and provides 19 Yangtze finless porpoise polymorphic SNP molecular markers and their corresponding primers, providing effective genetic molecular markers for the study of Yangtze finless porpoise population genetic diversity.

[0006] Technical solution: A Yangtze River finless porpoise polymorphic SNP molecular marker, the Yangtze River finless porpoise polymorphic SNP molecular marker comprises 19 SNP molecular markers, which are numbered as SNP 01-19, and the nucleotide sequences of the Yangtze River finless porpoise polymorphic SNP molecular marker sites are shown in SEQ ID NO: 1 to SEQ ID NO: 19.

[0007] A primer for amplifying a polymorphic SNP molecular marker of a Yangtze finless porpoise, the primer comprising a KASP primer combination of 19 SNP sites SNP01-19, which are numbered as Snpp 01-57, the nucleotide sequences of two forward primers and one reverse primer of the KASP primer combination are shown in SEQ ID NO:20 to SEQ ID NO:76, and each KASP primer combination is used to amplify a corresponding SNP molecular marker.

[0008] Preferably, each KASP primer combination consists of two forward primers F1 (FAM) and F2 (VIC) with different terminal bases and a reverse primer R, and the 5' ends of the forward primers F1 (FAM) and F2 (VIC) of the primer combination are respectively connected to the universal fluorescent labels FAM: 5'-GAAGGTGACCAAGTTCATGCT-3' and VIC: 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0009] A method for developing a polymorphic SNP molecular marker for Yangtze River finless porpoises comprises the following steps:

[0010] Step 1: Obtain candidate SNP sites by comparing the Yangtze River porpoise genome with the resequencing data; wherein the SNP sites must meet the following conditions at the same time: a. retain sites with an average depth greater than or equal to 5 and a maximum depth less than or equal to 500; b. retain sites with a quality score of Phred-scaled quality score greater than or equal to 30; c. retain sites with no deletions and a quality value greater than 1000; d. retain sites with no other variations within 100 bp before and after the site; e. retain sites with low heterozygosity and uniform distribution on the chromosome; f. retain sites with a PIC value between 0.2-0.5 and polymorphic in all individuals;

[0011] Step 2: Use KASP genotyping technology to determine the SNP sites that are polymorphic and accurately genotyped.

[0012] The present application also discloses the application of the above-mentioned Yangtze River finless porpoise polymorphic SNP molecular markers, primers or molecular markers obtained by the development method in the analysis of Yangtze River finless porpoise genetic diversity.

[0013] Preferably, the specific operation steps of the application are:

[0014] Step 1: Extract genomic DNA from Yangtze River porpoise samples;

[0015] Step 2: Using the genomic DNA of the Yangtze River finless porpoise sample extracted in the first step as a template, a PCR amplification reaction system was prepared according to the 19 SNP molecular marker sites, and PCR amplification was performed using the corresponding primers of the KASP primer combination;

[0016] Step 3: Perform fluorescence scanning on the PCR amplification product obtained in the second step, read and analyze the fluorescence signal, and thus obtain the genotyping results of the Yangtze River finless porpoise sample at the 19 SNP molecular marker sites;

[0017] Step 4: Based on the genotyping results of the Yangtze River finless porpoise samples obtained in the third step at 19 SNP molecular marker sites, the genetic diversity parameters were calculated using GenAlEx (version: 6.51b2) software.

[0018] Preferably, a total of 1070 SNP site data are obtained through the screening conditions in step 1, and according to the principle of uniform distribution on the chromosome, 50 SNP sites are randomly selected from the 1070 SNP sites for first-generation sequencing verification to exclude false positive sites, and finally 35 polymorphic SNP sites are preliminarily screened and retained; KASP primers are designed using Primer 3.0 software for the upstream and downstream 150bp interval sequences of the 35 SNP sites; each KASP primer combination consists of two forward primers F1 (FAM) and F2 (VIC) with different terminal bases and a reverse primer R, and the 5' ends of the forward primers F1 (FAM) and F2 (VIC) of the primer combination are connected to FAM: 5'-GAAGGTGACCAAGTTCATGCT-3' and VIC: 5'-GAAGGTCGGAGTCAACGGATT-3' universal fluorescent labels, respectively.

[0019] Preferably, the KASP genotyping technique in step 2 is to amplify the target sequence using competitive allele-specific PCR technology, and then determine the validity of the SNP site based on the KASP typing diagram through fluorescence typing analysis.

[0020] Preferably, in the second step, the PCR amplification reaction system is 5 μl, specifically including: 1.25 μl DNA, 2.5 μl 2xKASP Master mix (LGC genomics Ltd) and 1.25 μl KASP primer mixture; the PCR amplification program is: 95°C pre-denaturation for 10 min; 95°C denaturation for 20 s, 61-55°C annealing for 60 s, the temperature is reduced by 1°C each time, and the reaction is carried out for 10 cycles; 95°C denaturation for 20 s, 55°C annealing for 60 s, the reaction is carried out for 27 cycles, and finally 25°C reading for 30 s.

[0021] Beneficial effects: Based on the high-quality chromosome-level genome and resequencing data of Yangtze finless porpoise, the detection rate of actual polymorphic SNP molecular markers can be significantly improved by controlling the screening conditions; the KASP genotyping technology can be used to directly judge the effectiveness of SNP sites based on the genotyping diagram; the screening method has a simple process, does not rely on gel electrophoresis detection, does not require special instruments and equipment, and can realize automatic detection of SNPs; this method can perform fast and highly accurate genotyping of SNP sites, and does not require the design of target-specific primers or probes, with a low development cost, and is suitable for screening and detection of large-scale samples; the above screening method successfully obtained 19 polymorphic SNP molecular markers of Yangtze finless porpoise, further enriching the molecular genetic marker library of Yangtze finless porpoise and providing important genetic resources for its subsequent related research. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1This is the SNP01 locus typing map for this application;

[0023] Figure 2 This is the SNP02 locus typing map for this application;

[0024] Figure 3 This is the SNP03 locus typing map of this application;

[0025] Figure 4 This is the SNP04 locus typing map for this application;

[0026] Figure 5 This is the SNP05 locus typing map for this application;

[0027] Figure 6 This is the SNP06 locus typing map of this application;

[0028] Figure 7 This is the SNP07 locus typing map for this application;

[0029] Figure 8 This is the SNP08 locus typing map for this application;

[0030] Fig. 9 This is the SNP09 locus typing map for this application;

[0031] Fig.10 This is the SNP10 locus typing map for this application;

[0032] Fig.11 This is the SNP11 locus typing map for this application;

[0033] Fig.12 This is the SNP12 locus typing map for this application;

[0034] Fig.13 This is the SNP13 locus typing map for this application;

[0035] Fig.14 This is the SNP14 locus typing map for this application;

[0036] Fig.15 This is the SNP15 locus typing map for this application;

[0037] Fig.16 This is the SNP16 locus typing map for this application;

[0038] Fig.17 This is the SNP17 locus typing map for this application;

[0039] Fig.18 This is the SNP18 locus typing map for this application;

[0040] Fig.19 This is the SNP19 locus typing diagram for this application;. DETAILED DESCRIPTION

[0041] The specific embodiments of the present invention elaborate on the technical solutions of the present invention, aiming to help those skilled in the art to better understand and implement them. The chemical reagents and experimental materials used in the embodiments, unless otherwise specified, can be obtained through commercial channels.

[0042] The Yangtze River finless porpoise polymorphic SNP molecular markers of the present application include 19 SNP molecular markers, which are numbered as SNP 01-19. The nucleotide sequences of the Yangtze River finless porpoise polymorphic SNP molecular marker sites are shown in SEQ ID NO: 1 to SEQ ID NO: 19.

[0043] SEQ ID NO:1

[0044]

[0045]

[0046] SEQ ID NO:3

[0047] ATTATCGTTGTGTTATGTTGTAAATACCTGGTTAGGTGCCCATTCCCCCTCCCCATTCAGTTGAGCCTGG

[0048] CTGGGGCACAGGTTGGAAATAATCTTCTTCTCACCCCTCCACCCACTACCCCGCCGGCACCTGGCGTG

[0049] GAGTTTGGCACACGGCATGCGCGAACTCTCAATTAATATGGCGAAAAATCACCTGCCTGTAGTCAAGA

[0050] GAGGCAGAAAAATCATGCGTTTAAAAAAATCATATATTCATTTCATTTTGACTTTCACTTAGTCCACTTC

[0051] ATCATTTTTTTAGAATTTACCTACACCAAGGAATTTATTATCAGCATCAAATACATGGTGGTACACATAC

[0052] TTACTTACTTGGATTGATAAACAATGTATGTTTATCAGTGGAAGGATGGAAGGATCCATAAATGTTTGT

[0053] GTTTGCTGTGAATATAAATTAATTTTTTCATACTTATCAGATATGGAATGAGAGAGATATCTTCCACTTAA

[0054] AGCAAACCTTACACAGGGAGCGTTTGTATTTACAGAATAAATTGAAGAGCAAATATTTATTTAGCAAA

[0055] ATTCTTCTTTGCATAAGGTTTCAAGATAGCTGTTTTATGTAACTAGTCACTGAATAAACTTAGATGTGTT

[0056] TCGCACCCAACATCATCAGCCATCCAGCTGGGGTGTCAAAGGGGCTCATTCGTAGAGATATTCTAGGA

[0057] ACAAAGGAGCTAAATATACATTTGACAGAACCGCTAGATAGTAACTTGATCCACTACCAGATTCTAAA

[0058] GTGGTTTGGTGATAGGCTCTCAGACTTAATTTCTAAATCCTCCTACTTAGGGAATTTCTACAGCTGGTA

[0059] CTATGACTTCTGGAGTATTCTAGCAGAAGTTCTCAAGAGAATCCAACCCTACTTCTGTTCAGCTATTGG

[0060] TTTCTGGTCACCCAGATTATAGAATGCTGGAGATGGAAGATTTCCTGGAGATCGAAGATTTCTTAGAGATGGACTCTTTTGCTTCTGAAAGTATGGTTATGGTC;

[0061] SEQ ID NO:4

[0062] ACCCAAACCTCTGTCTCCCAGATTAGATTCTGCAATGGTGTACAGAGGCTGAGATTTCGGCCTCAAGT

[0063] ACCTTATGCAGGGGGTCATTCATTTGTGTTTGTGGGAGAAGTAGAAATAGTTGTACCTTTATCATCATG

[0064] GGAATGGCAAGAGCTATTGCTAAAATCTCTGTGGCTTGGAAGCAAGTGCTAGGGCCAGGGATAAAGG

[0065] TAAAGAGGAGCCACATAAAGATGTGACAGGGCAGCTTGAATTGCAACATGGACCCACTACAGAACAC

[0066] TCTCTTGTACAGGACCACAAGCAAAACGTGCAGCCTCTAAGTCGCAGTTAAAGGTCACAGTAGTATT

[0067] GCCATTTGCTATAAATGTTACCGCCAAAATTTAAAGGGGCTCACATGTGCTATATCTCTTTTGTCATGTA

[0068] GGAGTTGCAAGAGGCAAATCATATCTATTACTTTCATTTAAAGTAATCTCAATCTTGCCATTACTGAG

[0069] AATAGGGTTGAATACTTCTTTGTCTGGAGGAGGCTTTCTTGTGCATTGCAGCATGTTTAGTTGCTTCC

[0070] ATGGCTTCTATCCACTTTAGCTATTTCCCCGACTTCTACCCCTGATGCCCACTAGATGCTACCCACTCAC

[0071] CTTGATTTTTGAAAAACAAATTGTCTCCAGACACTGCCAAATGTCTCTCGAGGGCAAAAATTTTCCC

[0072] CGGTTGATAACCATTGCTTTAGAGGGAAGGACTCAGTGTGCCCCAGATCACCAGACCCAAAACACAT

[0073] GACTCCTGAATCTTGTAGGGTCTCTTTCCACTTTCTGGTATATATGTGTCTTACTAAAGTATTGAGAAT

[0074] ACTTGTTCACTCTTGCTTACCAGGCCAATCAGAATGATTAGAGTGATGTCATCTATACACAGACCATTG

[0075] GGATATTCTGTAGAATGTGAGAACGATCATCATGGTCAAGACACTTGAGGACTAGATCCCGAAAGAGTATTACAGTTAACATAACCATGTAAAGGCAAACTGTGCTTGATCT;

[0076] SEQ ID NO:5

[0077] CGCCAGGGTCTTGATTTTCCCATCTAGGTAGGAGAAAAGATTGTCATCTTTGGAGGTCCAGGGCACAG

[0078] AGAGAGCCAAGGCATCTTTCGAGGTTCTGGGGTCAGGGGGAGCGGGTTGTAGAGAAGAGCTGCCTG

[0079] AAGCATTATTGGAGGCTGCTTAGAACACAGGTCTTACTGAGAAGTGGAAGTTGAAATAAAGTGTCCTT

[0080] CAAGACCAGGCAGGTGTTTTTGGTTTGGCATTTTCCCCAGCAGCATTGAGAACCTAGGGAAGAGTGG

[0081] AGATGGTACCTAGTGGGGGCTGACTGAGGGATAGGGTAGCACAGTATCCAAAGACAGCCAGAGACCA

[0082] TGGGAGCCTTGACTGAGGCCATTGGCGATGGAGAGGAGACTGCTGTCACGAGGCTGGGGCTGATCTG

[0083] GTTAGCAGGACTGGCCTCATGGAACCACTGCAGGGGGGGCACATGTGAGTTCATGGAACACAAGCG

[0084] GCTGACTCCTAGGGATGCTGGGGAGTGGAAGAGCAGGGCAAGCATAGAGGTGGTGGAAAAAAACTA

[0085] GACCCATTTGTTGGATGATTCGAAAACCCACTGCCCAGGTCCTAAAGGTTGAACCCTCTGACTCTCCT

[0086] CACATTGATGCATGGGGAGAAGTTTGTCAGAATCACTGTATAGACTTGAGGGATGAGGCAGTCTTTCC

[0087] TCACTGTTCTTTTCTTCCTTTTTATTTTTATTATTCTTCTTGTCAGTATTTAATTGCCACCTTTATTTCCTTT

[0088] GAGAGTCAAGACATCTGCTTTCCTGGTTGAGAGGTACAGTGCATGGAAAAGACAAAGGAAAGAGGA

[0089] ATACGTTTTGCTCCCCCATGAGTCACTTTCTTTCTCCTCCTCCTATCCTCCCTCCTTTTAATTATTCACCA

[0090] CCATCCTTTTTCTTATTCACGTATCCTCTCATCTCCGTGTTCATGTCACATTGTTATTCTTAAATCATAGACATTGGCGGGGAGAGAGGGTTGTCTAAGACCTAAAATATGGAGGTTGACA;

[0091] SEQ ID NO:6

[0092] TGTGCTATTCGTTGGTTGTTTGATTTTAATTATCTTTTATAAGTCTATAAAACAGTGAAACTGCATATCCT

[0093] AAACAAGAATCAAGAACTGGTACCCTGTGGTCCTAAATAAACCCTCAGACATATTTTGTTTGGTAGCT

[0094] CAGTATTGTTATGGTTGTTTTAAGGAAGTGTAATTTGATTAGGCTTAGCATTGATTTTCTAGTTTATGGA

[0095] AGGCCCTGTCATTGCCTATTTTCTTACTCATAGCTTCTTCACACATTTAAATTAGTTGCCTAACCCTTGA

[0096] GGGCATTAGAGTTTGCAATATGGCTTTATTATCAAGACTTCAAATGTTATAATCCTTCCCTTGATATTGC

[0097] ACACTCTTTGAAAGCAACACAGTGTTTTCCTTGATTTCCTAGCACCAATTATCACAGTGTCTTAAATAA

[0098] ATGGACATTTCTTTCATATATTCATCTAATCCACGAATCTTTACTATGCACCTATTCTGTTTTAGACAACA

[0099] TACTAGTCAATGAAGGATAAGGATGTATAAGACAGTTCCAGAACCCATTCTCATAAATCTTGATGGTTA

[0100] AGTGAGGAAGGATTTGTTTACTGATTGATAAACGTGGCTATCTTAAATCCTCTGCTATATAACTTAGG

[0101] AAATAAGGGGTTACTAGCCTCTTCCCAGAAGGAAATATATTAAAATAAGTAAATATGATGAGCTGAA

[0102] TTGTATCTTCTCATAATTCATGTGTTTAAGTTCTAGCCCTCAGTACATTAAGATGTCACTGTATTGGAGA

[0103] CAGAGTCTTTTAGAGAAGTAGTTAAGTTTAAATGAGATCATTAGGGTGGACTCTAATCCAATATGACTGA

[0104] TAACTTTATAAAGAAGGAAATTTGGAAACACACACAGAGGGAAGACCATGTGAAGACACTGGAAG

[0105] AATCTGTATAGCAAGGCTCCCAGAAGAAACCAACCCTGCCGACACCTTCATCTTGGACTTCTAGCCTCAAGAGCTGCAAGGGAATAAATTTTTGTTGTTTA;

[0106] SEQ ID NO:7

[0107] TGCTAACCATGCTCCATGCTTTTGGGATGCTTGTTACTCCCAATTCTTACCAGTGGACAGAGGTTGGGAA

[0108] TACATATGTATAGATACACACACACACACACACACACACTTACACACACACACACTGTTCAC

[0109] ATTTACATATATAAAACATGAGGTCCCACCAGTACCTCCAATTCCAATAATGCCATTTCATTTCGT

[0110] TCATTCTATTTTCCTCCTTTCCCTGAAAATGAGAAACTGATTCCCATTATCCTTGATACATATGTACTTA

[0111] ATGTTCAATTCCCCCTATGTAACCAATCTCCCATTGCTGATGCTAGCCCCTCCCCTGTGCAGTTGCCCTC

[0112] TTCATCCCACTTGGTTTCTCACATTTTATACTGGGTCACTCTCCTGAGCAGATGCTCCACCCACTTCAT

[0113] GCAGGTTCCAACCTATGCCAGGCTGCACTCCCACAGGGACACCCAGAAATGGTTGCAATATGCACTC

[0114] ACTTGCTCTCTCATGCTCTTTTCCTTCACCCAGTATGGACACTCTCCTCACCTTGGTTGGGCTCTAACT

[0115] CGTGCCAAACCCACCTAATGGCTCTTGGTCTGAACTATTCAGGATGGGGAAGGGCCAGGATTATTTTT

[0116] TAATAATCATTTAGCTATAGTTTGAAGAATTTATAGTAAGGGAAATAGTAAATAGGAAAACTGGT

[0117] TAGGAGACTATGGCCTAGGTGTTAGGGGATAATGTCTTGAACTAGGGTGCAGTTAGTTCAGATGTAGA

[0118] AAAATGAACAGATTCAAGAAAAAGTGGGAGGTAATATACATAGGATTTGGTGATGAATTGGTCATGG

[0119] CGGGGAAGAGAAAGATATCTGAAGACAGATCTCTACTTCCGATAATTAATGTCCACTTGCTTCAGAGA

[0120] AACCGAAGCCTTGCCAGCTTCAGTACAATAAATCAAAACTTGATAAAATAGCTCCATCATATATGCATGAGATATGTTATAACGAGGGGACTGTTTTGTTTCATT;

[0121] SEQ ID NO:8

[0122] AGGATACTGGCAGAACACTAAGGTGTTTTAGCCTTACTCCAGGAAGTAATTTATGCAACGCATTACCTA

[0123] GCTGGTGAAAATATGTAGTAAAGAAACAACCACGATCAGTAGGAGCTAAGTTTCTCACGCATAATATC

[0124] AGAGTGAATCCATAATAGCTGCGTAAGTGAACCACTGAGTCCTTAGCTCATTGCTTAACCTAGGAAGT

[0125] CACCTGCTGATTTAATGTTAGCTATGGGAGTATCTCCATCACAGCATCCCTACTGCTATATCACATTTAA

[0126] ACTAAGCATTTTTTCTCTTCAGTCTACCTTCTGTTTAAATTACTTCTATTTTGAGCAGTGTGCTTACT

[0127] TTTTCACCTTTTTGTAAGACTTGCATTTTTTAGCTAGAATTCAAATACAGCTAAATGAGGAAAACTCA

[0128] ATAAAGGGACTAAATTTTTTTGCATCCAATAATTTGCTGTGAAATGCCAAGTTGGTGGCTGTGCCT

[0129] GCAGTCATTTTAGTTATCAAGACACATAGTAGGAAACAGTTTTGGGATTTTCAGCCATTAGTTTATAAA

[0130] TTGAATGAGACAGATGTGTTCATTCATATAAAGTAATGTAATTCTTCTTGGGAAAGTTTAATATTATACA

[0131] AATCCATTATATTTACAAATTAATCTTCCCTTAGGAAATAAAGATAGAAGATTTGCAGAAGGGAGGGCT

[0132] TTATTACTTTTAAAACTGAATTGTTAAAGAAAATAAAAGAAAGGAAAATTATATGAACTATAAATGC

[0133] CTTTTTTTTTTTTTTGCAGTACGCGGGCCTCTCACTGTTGTGGCCCCTGCTGCTGTGGAGCACAGGCT

[0134] CTGGACGCACAGGCTCAGCAGCCATGGCCCACGGGCCCAGCCGCCCCACGGCACATGGGATCCTCCC

[0135] GAACCAGGGCACGAACCCGCGTCCCCCGCATCGGCAGGCGGACTCTCAACCACTGCGCCACCAGGGAAGCCCTAAAAAAGGCCTTTTTATGACTAACAGTTTTTTA;

[0136] SEQ ID NO:9

[0137] ATATGTTTGTATGATGGAGATCTTGAATCAGCATTACTTGAAAGGAACCCATTTGGGGAAGAAAAAAG

[0138] AGAAATCCTAAAATAATCTTCTGGTGATATTTATCTTGTAAGTGGATAAGCACACCACATTGAGAGGTA

[0139] TAACCTGTGTAATTCTGGAGCTTACAAAAGACTCAGGTGGCAGACATTAAGTTGCTTCAACGTCACAC

[0140] CCTCAACCTGTCTCCAAGCTTTGTAATATTATACATAGTACTAGGACATCAACTGACGAATCCATTCTGC

[0141] TTCTATGTTGTTCTTTCTATTTTATAAAATGTTTTTCCATTGATTATCTCATTTTGTCCTCACATATGCATAT

[0142] AAAACTAAAGAGCTAATAAAGACAAACTTTAATGATTCTCCATTTAGAGGTGCAGAGGGTTTCAAAGA

[0143] CTTGCTCTGTGTCCCGTAGACAGTAGGTGGCAGAGGTGGGATCATCCATCTTTGTCCTAGGAGGGCAG

[0144] ATCCACTGCTTTCCTGGAGGCCCCCTTGCCTCTCATTGCTGCCCTGCAGTTCCCCTGAGCAACTCTGT

[0145] CCTTGGGTTTTGCCTGTGGTGTACGATAACTTTTCAAAGCTGGCAGGAAAAACATTTGCTTCTCCCCT

[0146] CATCATCTTCTGTGAAGGATGCAGTGTTGGCCACACAGGGGATGGGGAGCTCCCCAGGATGGGGATTT

[0147] TGCTGCTCTATTTTCAGCATTTAATATTTGGCATTGGTAACTAAGTGAAATCTGTTAATGGTGTAAGTAT

[0148] CCTGTTCTTATTAAAAGCTTATAAATTGTTATCTATTCAGAACAAATGAGGACATAATTACTTTTTCTGG

[0149] ATAATCTTAAAGAAGTATTCTAGCGTCTCTCCAACTCTCTTTTCTTTATTCTATTCTGCTATATTAAGTTG

[0150] GCTCTGGGGGAACATCAGACATTTTATGTTCTTTTTCCAAAGGTTTTTAAGGATGAAGGTGTCATTGGATACTTTTCTCAATTCTAATTCCTAACATCTGTAG;

[0151] SEQ ID NO:10

[0152] GGAATTAGATTCCTTACTGCTCTTCCCTACTCGAGGGGAATGAAGCTGGTACTCCTCTCTTATCTCATG

[0153] GAGAGGACACCTCTGAACTTCTCTGACAATATGTGCCCTGCTAGGGATGTCACAGTCGTTCACCTCTC

[0154] ACCCCAAGAAACCAAACCTGCTCTCAGCCCAGCTCCAGTCCACCCACAGTTCACCACCCACAGGCGC

[0155] CCAATGGAGACCATACCTCCTCCTTAGCGACCGACTCAGAAGTGACAGATCAACACCACCCCTGCCC

[0156] CATCCCCGTGTGCATGCTACCTCTTCAATATGTTATTCCAAGAGAATTTACTGACGCCCATCAGTAAAA

[0157] AGGGCCATCATCCAAAGCCATTTCATAGCATCCCCCTGTATTGGGCCCTAACTCTAGAAGTTGGTCTTT

[0158] ATTTTTCAGATTCTCACCAAAAAAAGGCAGACAACTCATTTGATGTGGCATTCACTGAAATTACGTTTC

[0159] AGCAAAAAGTGAAACTAGACATTCAAAACAGTCTCCAAACTTCTAGATATTGGCTCTCTACTTTTGGG

[0160] GGTGATGATCAAATAAAACCCAATACATCAGATCAGATCAGTGGTCCCCAACCTTCTCCTAACAGAGT

[0161] CCACGTTTTGAAATACATTGTCGACTAAAAAGACTGCATTTATGTTTAATTTCTCCATTTTTATTCACCA

[0162] AGGGCGTAAGCAATGGCCACCAATCTGGTTGATAAGAGATGACTCATATCACCAAGGAGTGCACAGG

[0163] ATTCTAAGCAGAAAAAAGAAACGACGTGAAGCCTGATTCAGAGGCAAATAGGAATTTTCTGGCTTGT

[0164] TTTTCGAAATACTGAAAATCATTCATACATTCCCACTGCTACCTATCACAGCCACTCAGGATCTTTTTTC

[0165] CTGATGAAAATGTACAGTAATAACTCTCAGACTTCAGGGTTATAAATATCAATACCAAAAGCCAAAACACCTGAAATACATCAGGTACCGTACCTTTCATTAGAGGAGAGAACA;

[0166] SEQ ID NO:11

[0167] TCAGGTTAAAGGGTCAGACAGAAAAGCCATTCGCAGTGGTCTTTATTTATGGTTCTCAGAGGTCCAGT

[0168] TGCTGAAGCATCCTGAAGAAGAAGGATGGCTCAGGTGGGATCCCCGTTTCCCCGCCCGGCTGATGAC

[0169] AGACTGAGGGCCTCGCACTTTGTGAAAGGCCGGCTTCTTATGAATGCGTATTAATGTTTGCAGGCACA

[0170] ACACGAGACCCATCCTCTCTGTTACCCCCAGTGCAGAGAGAGCTGTGTGTTTTCCCTCTGTCCTCCCT

[0171] TCTCGGCCACCTGAAAAGATTCCTTCCCACCACCTGTGGTTGGTCTTTGAAGGCCAGATAAGAAGATA

[0172] CGAGCATCCCTGGCTGGCAAGCTTGGCTAGGGGAGAGCCTCACACCCTTCTCAAATGCTTGAAAATC

[0173] AGTGCAGATGTTTTATTCATGCCTTCTCTTGGTGCAATAATAAGCCTCCATTCTTTGAAGAGCTCATCTT

[0174] CCCCAACCAGGAGCAGTGTTTAGGAGAAAATGGCCGGAGAGCAGCAGAGAAGGAAGGAGACCTCT

[0175] CACCTGTTCCTCTGGGCCCCCTCTACCTCCATCTCATCCTTTAACATTCAACTTGGATCCCACTTCCCCC

[0176] CATCTGATTTCCTGGTCCTCTAATCTTTCATGTCCGGCTGACACAGTGAAGTGGCAGACAGAGAATGG

[0177] CCAGGGTGGAGGGGGACAGGGTGGGGCTGAATGTCTTCTTTGCTGACTGAAGGCTGCAGGACCTCA

[0178] AGCTCTGGGAGCTGGATGCATCCTCTGTGAAGTGGGATTGATAATGTTGGGCTCCAAGGCAGTATGGT

[0179] TGAAAACTACCTTTTCCCCAATTCATTGCCTAGCTGTTCCATTCTCATTCTTCAGAGAGGTCTGCCCTT

[0180] CACCTCCCTCCTGACCCACCCCCCGGCCAAAGCGAAGGGACCTCTTCTGTATGGTTCCATGAACCTGGCCCATAGAAGCAGCTCAAAAAATATTTGCTGAATGATGCGGGCTTAGCCAGC;

[0181] SEQ ID NO:12

[0182] AAGGCAATCAAAAAATTGGACCAAAATCCCTCGGTGGATCATCTCCGTTATTAGATCGTTCACAGCCA

[0183] GTGCAAAGGTTTTCACACATTGATCTTGAACCTTGCAATTCCGCTGACATCTCCAATACCTGTGTGCGT

[0184] GTCCATTAGGCTTCCCTACACGCGAAACCACGTCACCTGCAGAGAGAGTGTTGCTCCTTCCTGCCGG

[0185] GTCTGGAGGCCTTTTATTTCCTTTCCTGGCAGTGTCGCTCTGGGCACACCCCGCAGCACCGTGTTGAA

[0186] TACACGTGGCAAGAGCACCCATCCTCGTGGTCTTTCCTCGCTCTCTCCTCTGTTCCTCGTGCTGGATGA

[0187] CCTCAGGGGAGCCGTCCTCAAGTTGCCGATTCACCCTCTGACGGCTCCCTCCACTGCTGAGCTCATTT

[0188] TACTTCAGTTACTAAGCTCTTCAACGGAAAAGGGCTTCCTTTTCATCCCTTTTGATCACTTCCTTGTATTGACATTCGCTATCTCTACTGA[T|G]CCCTTTTCCCTGTATGTGCGCTTTACTGTGCTTCTCTGCACGCCCTGTAATTCCTCCTGAAAACCGGACACTTCAAATAATACAATGCGGCACCTCTGGAAACCAGACCCTCTACCCGCCCCACGCTTTACTGCTGCTGCTGCTGGCTGTGGTTGTCTGCCTGTTTAGCGACTTTTCTGAGTGATTCTGTCCTGTTCGTGTCTTTGTATGGGCACGGGTTCTACTCAGTTTAGCCACAGGAAATACAGATTTACATCACAGTGAGGTACCACTTCACACCGACTAAGTCAGCTGGAAGTCAAAAAGACAGATAAAAACAAGTGTTCGTGAGGACTGTGAAGAAACCAGAACCCTCACACACTGCTGGTGGGAACGTAAAATGCCACAGCCACTGTGGAAAACAGTTTGGCAATCCCTCAAAAAGTACCATATGACCTAGTAATTCCACAGTAGGAATTCCGCTCCCAAGAGAACCAAAAACAAACATATGTCCACACAAA;

[0189] SEQ ID NO:13

[0190] ACACATGTCTTCTTCTTAGAAGGACATCAGTCATATTGGACTGGAGTCCCCCCAGATGGCCTCATTTTA

[0191] GCTTAATCACCTCTTTAAAGATCTTATCTCCAAATACAGTCACATTCTGAGGTATGGGGGTTAGGACTC

[0192] CCATGTGAATTTTTTTTTTAGAGTGGGATGCAGTTCAGCCCATTACAGGCGCAGAGAGGCTAAGTAGC

[0193] TTGCCTGAGGTCACACAGCTACAGGACTGGAGTTCAGACAGTCTGATGCTAGAAAGCCCTAGTTCCG

[0194] TCCATATAGAAATAAAAAAATGAAGACATGCCAAAGCAGGGTTATGCAAATTGTGGTCTATTTTAAATG

[0195] TTTACCTGAATTCAATAAAGGAGTGCTTTTGAAAAGAAAAAGAAATCAAACACAATATGATCTTGATA

[0196] TTCAAAGGATAATTACTTCATATGTAAACTTAATCCCTAGAGTATTACAGGGGTGAGATCTGGTAACAG

[0197] GATAAAGTCTGAACTTGATAGTGCAATGGTACGTTTTCCCCAACCCATGAGAGTGCATCTCCTTGCAC

[0198] GCGTATATAACGTCCTCAGGGATAGCTTTGAGGTCTACATTCGAGGCCCCCTGTGAACGGAGAGCTTG

[0199] TCTAGTGGCCTTCTGCACCTCCCTGCGTGCTTCGGGCAGCCTTTCTGAAACTTTGTGACTCCCGAGTC

[0200] TCTGGTCTCGAACTGCTGTGCTCTGCTCCCTCCCGAGTCTGGAAACTGGGGTTCTGGTCTCTAACTCT

[0201] GCCGGGAAGCAGCAGTGAGTGACCTTGGGAAGGTCAAATGCCTCCAGCCTACCTTCCCTGTCTGCAA

[0202] ATGGAGGTGTTGGAATAAAAGGTGACCTTTATGGTCTCCGGCAGCTCCAGACATCCCCACGACTCTGA

[0203] TGCTGTGACTAAAGCTCTGTCATTCGATTCTATGGCTGCATATTAAGCAAACTGAATTGCAATGTGTGGAACCCTATTGGGTCATCCTCGATGGCACCCAGAACCCCTGGGTCT:

[0204] SEQ ID NO:14

[0205] AAGGGATAACAAATTACCAATGTCAGAATGAAAATGCAAGCAGATCCTAACTAAAAG

[0206] RELATIONSHIPSTATTGTGAAPATTGTCATACTHELPATTTSTREATHTATTGTGTATTACKSTRUCTURE

[0207] CCTTGAAGACAAACTATCACAGCTCACTAAAGAGAAACAGTTAATCTGAATGAACTACA

[0208] AAATAAACTGAATTTATCAAAATTTCCACAAAAAAAACTCTAGGTCCAGAACTTCACC

[0209] AGTGAATTCTACCAAACCTAAGCAAAATACCCATTGTATATAAACTCTTTCAGAAAATAAAA

[0210] QUICKWINDSTTAAAACTHELPTTATQUCCATTACCCTQUAKAAAAACTACCTATA

[0211] TCACATAAAAACGTTATTAGTATACTTCTCATGATATAGACAAACATCCTTAACAAAAAATTAGTA

[0212] AATTGAATCCAGCACACAAAAAAGGATACTTCCTGATCAACTGGGACTTTTTTTTTTTTAGCA

[0213] ATGCCAGGTTGTTTTAGCATTTGGAAATCAGTCAATATAATTCACTGTATTAACAAACTAAACAAGATA

[0214] AAAAATATAATCATCGCAACAGATACAGAAAGGCACCTGAAAAAATTCAACATCTTTTCATAATAAA

[0215] AAGAAACTCACAAAAAAACTAGAAATAGAAGGGAACTTTCTCAATCTGATACAGTGTTGAGAAAATC

[0216] TAGAGCTAACATCATATTTAATGGTGAAAGACTGAATGTTTTTTCCCTAAGATTCAAAATAATGCAAGG

[0217] ATATCTGCTTTCACCACTTCTATTCAATTTTGTACTGTAAGTTCTAGCCAGTGCAACAAGATAAGAAAA

[0218] AAAGTATACAGATTGTAAACAAAGAAGCCAAAGTATCTTTATTTACATATGACATGATTGTGTTTTATAGAATTCTAGGGATTTTACCAAAAAAATTACTAATACAATAAAT;

[0219] SEQ ID NO:15

[0220] ATGACTTTTTTTTTTTTTTTTTTGACCACGCCACGCAGCTTGCGGGATCTTCGTTTCCTGACCAGGAAT

[0221] CGAACCCGTGTCCCCTGCAGTGGAAGCGTGGAGTCCTAACCACTGGACTGCCAGAGAATTCCCTACA

[0222] GCTGGTTTAAAAGTGAACACACCATAAATGTAATTCTCAGGTCAAGAAACAGAATGTCACCTACTTCC

[0223] CAGAAGAAACGCCCCTTACCGCCATGTAGCCACTACCTTCCCACAGGTTAGGCAAATCCTAACTGCTAT

[0224] CATTAGACTAGTATTGCTCATGAACATTACATAAATGGACAATATAGTGTACACTCTTTTGTGATTGACT

[0225] TTTTCTTAATTCAACATTTTATTTGTTATGTAAGTGTGGTTCTAGTACTTTTATGCTCACAGCTGTATAGT

[0226] ATTCTCAATGTGTGAACATACCTCAACTTCTCCGTTCTCCTATTGAAGACATTTGGATAGAAAATATTAT

[0227] ACCTTTTTTATATCGCTTGAGCTCGATCTGCTAATATTTTCTTTAGGACTTTTATATTAAATATTTATAAGAG

[0228] AGATTGGCCTGTAATTTTTGTTTGATGTGATTCTTTTGCTATGTTTGGTATAAAGATTATCCTGGCTTTAA

[0229] AAAATTGCTCAGAAGTGATGTCTCGGTTTCCATTATCTGAAGGATTTGTGTAAAATTAGTATTAGTTCT

[0230] TCCTTGAATTTTTAGAAGAATTAACTGGCAAAGCCTGGAATATCTATTTCTTATTAACCATAAGAGATAA

[0231] TAGGAATTTTTATTCTGTCTCTGAGAGGTGTTTGACTTATATTTTTGTTCTCCTGAATATATAATTAATTGCAAA

[0232] ACTTGACCGATGTCTTCAGGAGGAGACAGGCTCTATGTTTCATGTCCTTTAGTTCTCCAGGTTTGGCAT

[0233] TTCTGTTACTTGCAACTCCCCAGAGCTGTCCTGATTTCTCTGTCCCTCAGTAGGACCTTTCTCAGGACAAGCTCAGTTTTCTCACCTGTAGTGTAT;

[0234] SEQ ID NO:16

[0235] CTAAGAGCAGAAACAGTGTGTTTGCAGAACTGCTGATTTCACTAATACCTGACATCTATGAAAGGGCA

[0236] TGACTGGTATCAGCTGCTTTTTAAAACGAAGCTATATAAGTGATTATGCACATATTAAGAGAATATGAA

[0237] AATATACGTTTAGATGAATATATATTTAGATATTTATATGTATCACCTATGAAACATAAGTATTATTTATAAA

[0238] ATGTAATATGTATATTACATATATACATACGTGTGTGTGTATATATATTTATTTATTTATATTCGTGTGTCTCT

[0239] GTGTATACTGCAGTGGCTTGTGCCTAACTCTGTCTGGGAATGGGTGGGAAAATCAAGAGGTAAGGAA

[0240] GCTGACGAATCAGGGAGGTCCTGGGGTTCCTGGGGCTGCTGATGAGAGATGAGGGCTAAGGAAGAG

[0241] TGGGTTTATTGCCTTGAGTGTCAGCTGGAGTCAAGCTCTGAGTGTTGGAGTCAGTAGGTACCCGGTTT

[0242] ATGAGTTGATTGTCTGAAGAATATAGAACTAGAGGGTTGTTTGCACACTTCTTTTTTTGCAGTACGCGG

[0243] GCCTCTCACTGTTGTGGCCTCTCCCGTTGCAGAGAACAGGCTCCGGACGCGCAGGCTCAGCGGCCAT

[0244] GGCTCACGGGCCCAGCCGCTCCGCGGCATGTGGGATCCTCCCGGACCAGGGCACGAACCCGTGTCCC

[0245] CTGCATCGGCAGGCGGACTCTCAACCACTGCGCCACCAGGGAAGCCCTGTTTGCACACTTTTTACCTT

[0246] GATCAGCTACCAGGGTCCTGCTCATATTGTGGCATGTGGAACATTTGCTAGAGATGGTACACAAAGTA

[0247] GCAGGGAGTCAGTGAGCATCTGGGCTGATTGCCTTTAATAAGCTTCTGTGTTCGATTCCTGAATCTATT

[0248] CCTACGTTTATACTATTTCTGCCTTTTAGGAGCCTCCTGCTAATGCACCAACTACTACTAGATTGTTCCACTCTGACCTCTGAATTGATGTTCAACTTTTTAAAGAAAA;

[0249] SEQ ID NO:17

[0250] TTTTTAAATATTGTATCATTGATATTTTGTGAATTTATCATTTTAAACTGCCTTAAGCACCTTGAAACTGA

[0251] TTGAATCATTTTACAAAGTGTAACTTAAAAGTAGTTTGGATATGGTAATGCACAAATTTTGGTTGCCTTT

[0252] AAGCTTATTAAAATAGATTCTATTTATATAGCTGCCTCAGTTACTCATTTCTGCACAATAAATTACTCCAA

[0253] AATTTAGTGGCTTAAAATGTTTGACTTGCTCACTAGCCTGTCATGTGACGGTTTGGGCTGGCTGTAGCT

[0254] GGGCTGGGTGCCAGCAGGGTCTGTGTTTGTGGTTGGGTTCATTCATTCGTCTGGTGGCAGTTGGCTGG

[0255] CTGTCAGCAGGGGCGATGGAAGAATCTGGGCCAAGTGTCACTCACATTCCAGCAGGCTACCCTGAAC

[0256] TTCTTCACATGGTTGCTGGGTTCCACCAGCAACAAGGGAGAGCAAGTTCCAATGCCTAAGTGCTTTTC

[0257] AAACCTCTGCTTGTGATCGTCTTGCTTATGTCCCATTGGTCAAAGCAAGTCACAGAGTCAATGTGGGA

[0258] GGCCAAGCTCAGAGTCAATGTGTTAAAGAAGTATAGGAAGTCAATGGGTCCAGGGAGGTGTAATTCA

[0259] ATGGGGGCCATTACTATAACTGTAGTTGCTATCATTTCTAAAAATTTCCATTATTTTCTCAAAGCATTGA

[0260] CATTAAACTCAACTCATGCTCAGGCAATTCTGTATACAACTGAGAGCTAATGATGCGTTATAGCTATTG

[0261] GACTCTGATTTAAGGCTTTAGCGCCACTTAATATTATAACGTAAAAAACTAAGACGTCATATCACTGCC

[0262] TTGTTCCAATATTTCCCATGGCTTCTTATTACATTTAGAATAATATTAAAATTCCTTGACACAGACCACA

[0263] GGCCCTCAGCGATTTTGTTTTTATCCACGTTTTCGTGACATCATACTTTACCACTCAGCCCCTAGTTTACAGTCTTTCAGCCATAATGGCTATTTTTCTATTCCT;

[0264] SEQ ID NO:18

[0265] ATCATTTCCTGGTTTTTGCTTTTGAAAACTTCCACTAGAGGAAATAATGGGCACCGTAAATTTAAAATT

[0266] AATATGTTTTGGATTCATCCATGTCTAAAGGCTACATGTCATCTTGGAAAGATACTGATTTAATTTATAA

[0267] CTCTGCCTTCCCCAGCATTTTAAGTTTTCACTAACTTATTTTCTCTTTTCTCCTATTTTTTCAAAGGTAAA

[0268] CTTCTAAACATTCATGTTTACTATTTTCTACTATTGTAGAAACACTGAAGAACTTGAAGCTTTTTTTTC

[0269] CTCCCCCCAAAACAGGCATCAACATTACCTATTACCTTTCACCCTGCTCTAAGCTAAATTGTTAGTG

[0270] GCAGTGACTTTATAATGGTGTCTGTAACGTATTAAAAGAGTCACGTTTCCAATTTTCCTTTGAGGGGTGA

[0271] ATTTAGACTGTTGGATGCATATCCTCATGAAAGGATAAATTATGGTAAAGGGGTTTCTAGATAAGC

[0272] CAAGAGGCTTCTTCTAACCTGGAACATTGTTAAAATCCTCCACATTCGTAATGAAAAGCATTGGAAAG

[0273] TCATATTTTCATAATACCATTAAATAAAACAGAAAAATAAACTATCTTATTTATCTTCAATGGTGATACT

[0274] TAAGGAAAAAACGTTTAAATTAGAGGAAAATGAAGAGTAGCTACAGAGACCTGATAAAGATCACC

[0275] TAAGGCAACATTAATTGACCTGTAAATGGGAACACTGATTGAGCACCTAATATACGCCAGTTTCTTTTAT

[0276] AAATGTTCTCCCTTTAATTTTAAAGACAAGACTGAAAACAAGTGATATTATCCCCATTTTATAGATAGTGA

[0277] AATTGAGGTTTAGAGGAATTAAGGAACTTCCCCAATGTCACAGAGATATAAAATAGCAAAACCATGGG

[0278] AACCCATTTTTTATGCTAAAATCCATTCTGACTATGAAATATAGCAGGTACATGATCCCTCTGAGAACAAAAAGGAGGTGGTAAGAACGAGTTGTCCAGT;

[0279] SEQ ID NO:19

[0280]

[0281] The SNP01 site is marked as C / T and is located at position 3578746 of the Yangtze River finless porpoise chromosome 2 genome sequence;

[0282] The SNP02 site is labeled A / G and is located at position 90116171 of the Yangtze River finless porpoise chromosome 2 genome sequence;

[0283] The SNP03 site is marked as A / G and is located at position 6297226 of the chromosome 4 genome sequence of the Yangtze River finless porpoise;

[0284] The SNP04 site is marked as T / C and is located at position 71791661 in the genome sequence of chromosome 4 of the Yangtze River finless porpoise;

[0285] The SNP05 site is marked as A / G and is located at position 84395785 of the genome sequence of chromosome 4 of the Yangtze River finless porpoise;

[0286] The SNP06 site is marked as G / A and is located at position 106682173 of the genome sequence of chromosome 4 of the Yangtze River finless porpoise;

[0287] The SNP07 site is marked as G / C and is located at position 50780006 of the genome sequence of chromosome 7 of the Yangtze River finless porpoise;

[0288] The SNP08 locus is marked as C / A and is located at position 85509514 of the genome sequence of chromosome 7 of the Yangtze River finless porpoise;

[0289] The SNP09 site is marked as G / A and is located at position 27764344 of the genome sequence of chromosome 11 of the Yangtze River finless porpoise;

[0290] The SNP10 site is marked as T / C and is located at position 83891362 of the genome sequence of chromosome 13 of the Yangtze River finless porpoise;

[0291] The SNP11 site is labeled A / G and is located at position 13332465 of the genome sequence of chromosome 14 of the Yangtze River finless porpoise;

[0292] The SNP12 site is marked as T / G and is located at position 1462494 of the genome sequence of chromosome 15 of the Yangtze River finless porpoise;

[0293] The SNP13 site is marked as G / A and is located at position 55868804 of the genome sequence of chromosome 16 of the Yangtze River finless porpoise;

[0294] The SNP14 locus is labeled A / C and is located at position 23473466 of the genome sequence of chromosome 17 of the Yangtze River finless porpoise;

[0295] The SNP15 site is marked as T / G and is located at position 66317367 of the genome sequence of chromosome 17 of the Yangtze River finless porpoise;

[0296] The SNP16 site is marked as G / A and is located at position 33806104 of the genome sequence of chromosome 18 of the Yangtze River finless porpoise;

[0297] The SNP17 site is marked as T / C and is located at position 31038355 of the X chromosome genome sequence of the Yangtze River finless porpoise;

[0298] The SNP18 locus is marked as C / T and is located at position 33057094 of the X chromosome genome sequence of the Yangtze River finless porpoise;

[0299] The SNP19 site is marked as G / T and is located at position 37770280 of the X chromosome genome sequence of the Yangtze River finless porpoise.

[0300] The competitive allele-specific PCR amplification reaction system in the present application is 5 μl, specifically including: 1.25 μl of DNA, 2.5 μl of 2xKASP Master mix (LGC genomics Ltd) and 1.25 μl of KASP primer mixture;

[0301] The competitive allele-specific PCR amplification program is as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing at 61-55°C for 60 s, the temperature is reduced by 1°C each time, and the reaction is carried out for 10 cycles; denaturation at 95°C for 20 s, annealing at 55°C for 60 s, and the reaction is carried out for 27 cycles, and finally reading at 25°C for 30 s. The PCR amplification reaction conditions are shown in Table 1:

[0302] Table 1 Competitive allele-specific PCR amplification reaction conditions

[0303]

[0304] The primers used to amplify the above-mentioned Yangtze River porpoise SNP molecular markers are: No. Snpp01-03, No. Snpp04-06, No. Snpp07-09, No. Snpp10-12, No. Snpp13-15, No. Snpp16-18, No. Snpp19-21, No. Snpp22-24, No. Snpp25-27, No. Snpp28-30, No. Snpp31-33, No. Snpp34-36, No. Snpp37-39, No. Snpp40-42, No. Snpp43-45, No. Snpp46-48, No. Snpp49-51, No. Snpp52-54, No. Snpp55-57, and each KASP primer combination is used to amplify the corresponding SNP molecular marker (Table 2).

[0305] Table 2 KASP primer combination sequence information corresponding to SNP sites SNP01 to SNP19

[0306]

[0307]

[0308]

[0309] The PCR amplification products were subjected to fluorescence scanning and the PCR results were scanned and analyzed using a fluorescence quantitative PCR instrument (CFX Connectiom Fluorescence Quantitative PCR Detection System, Bio-Rad, USA), and the genotyping results and the original data of the genotyping diagram were obtained.

[0310] Example 1

[0311] The method for developing polymorphic SNP molecular markers for Yangtze River finless porpoises includes the following steps:

[0312] 1. Acquisition of SNP molecular markers for Yangtze River porpoise

[0313] The present invention obtains a large number of SNP markers through the high-quality chromosome-level genome of Yangtze River finless porpoise and resequencing data of three geographical groups. The specific screening steps include: using the lobstr_index.py script to construct a LobSTR reference index based on the Yangtze River finless porpoise genome data; after comparing the resequencing with the genome data, the output BAM file is sorted using the SAMtools software; using the VCFtools (0.1.16) software to detect base variations and obtain possible SNP sites, and at the same time find SNP sites that meet the following conditions: a. retain sites with an average depth greater than or equal to 5 and a maximum depth less than or equal to 500; b. retain sites with a quality score Phred-scaled quality score greater than or equal to 30; c. retain sites with no deletions and a quality value greater than 1000; d. retain sites with no other variations 100bp before and after the site; e. retain sites with low heterozygosity and uniform distribution on the chromosome; f. retain sites with a PIC value between 0.2-0.5 and polymorphic in all individuals; a total of 1070 SNP site data were obtained through the above screening conditions.

[0314] 2. Extraction of Yangtze River Porpoise Genomic DNA

[0315] The genomic DNA of Yangtze finless porpoise samples was extracted using QIAGEN DNeasy Blood&Tissue kit.

[0316] 3. Screening of polymorphic SNP molecular markers

[0317] According to the principle of uniform distribution on chromosomes, 50 SNP sites were randomly selected from 1070 for first-generation sequencing verification to exclude false positive sites, and finally 35 polymorphic SNP sites were preliminarily screened and retained. KASP primers were designed using Primer 3.0 software for the 150bp interval sequence upstream and downstream of these 35 SNP sites. Each KASP primer combination consists of two forward primers F1 (FAM) and F2 (VIC) with different terminal bases and a reverse primer R. The 5' ends of the forward primers F1 (FAM) and F2 (VIC) of the primer combination are connected to the universal fluorescent labels FAM: 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQID NO: 77) and VIC: 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO: 78). The genomic DNA of 28 Yangtze River finless porpoise samples was extracted as a template, and PCR amplification was performed using 35 pairs of KASP primers. The amplification steps are as follows:

[0318] (1): Construction of competitive allele-specific PCR amplification system

[0319] All synthesized KASP primers were diluted to a concentration of 10 μM using TE buffer (pH 8.0); upstream typing primer F1, upstream typing primer F2 and downstream universal primer R were mixed in a ratio of 1:1:3 and loaded onto the machine, with 1.25 μl of primer mixture added to every 5 μl reaction system; according to the standard for the lowest concentration sample, the DNA sample was diluted to a single-digit concentration, and the entire batch of samples was diluted to ensure that each 5 μl reaction system contained 1.2 μl of diluted DNA sample.

[0320] The total PCR reaction system was 5 μl, including 1.25 μl DNA, 2.5 μl 2x KASP Master mix (LGCgenomics Ltd) and 1.25 μl KASP primer mixture (Nanjing Jisi Huiyuan Biotechnology Co., Ltd.). The PCR reaction plate was sealed, oscillated and centrifuged to ensure that the reaction system was evenly mixed (sealing film, Shanghai Sangon Biotechnology Co., Ltd., F600418-0001).

[0321] (2): After centrifugation, competitive allele-specific PCR amplification was performed, and touch-down PCR (61°C-55°C) was performed using a universal fluorescent probe to achieve SNP bi-allelic typing. The reaction conditions are shown in Table 1:

[0322] (3): The PCR results were detected using a fluorescence quantitative PCR instrument (CFX Connectiom fluorescence quantitative PCR detection system, Bio-Rad, USA) to obtain the original data such as genotyping results and typing diagrams. The specific genotypes of the genotyping diagram are as follows: the samples clustered close to the X-axis are alleles carrying the FAM fluorescent label (red) sequence, and the samples clustered close to the Y-axis are alleles carrying the VIC fluorescent label (blue) sequence; the green circular scattered points located at 45 degrees represent the heterozygous genotype (FAM / VIC), and the black squares close to the origin are the control (NTC). Finally, 19 well-typed polymorphic SNP sites were screened out. These SNP sites and their corresponding primers, as well as the allele typing results in 28 Yangtze River porpoise samples are shown in Tables 3 and 4.

[0323] Table 3 Location information of SNP 01-19 sites on the genome and corresponding primer sequences

[0324]

[0325]

[0326]

[0327] Table 4 KASP typing results of 19 SNP loci in 28 Yangtze finless porpoise samples

[0328]

[0329]

[0330] 4. Genetic diversity analysis based on the development of SNP molecular markers

[0331] Based on the whole genome resequencing data of 125 samples of the natural population of Yangtze River finless porpoise, the present invention uses the HaplotypeCalle module in the GATK7 software to detect variations in each sample; then, the generated gvcf files are merged using the CombineGVCFs tool, and the combined genotyping is performed by the GenotypeGVCFs tool to finally generate a vcf file. According to the position ID of the 19 polymorphic SNP sites on the chromosome, the genotype corresponding to each sample is determined; then, the SNP typing data of all samples are converted to the GenAlEx format, and the GenAlEx (version: 6.51b2) software is used to calculate genetic diversity indicators such as the number of alleles (Na), effective alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), and polymorphic information content (PIC).

[0332] The results of genetic diversity detection of 125 Yangtze finless porpoise samples are shown in Table 5. The average effective number of alleles of the 19 loci was 1.811, the average observed heterozygosity was 0.375, the average expected heterozygosity was 0.441, and the average polymorphic information content was 0.343, indicating that the 19 SNP loci developed had a moderate degree of genetic polymorphism.

[0333] Table 5 Statistics of genetic parameters of 19 SNP loci in 125 Yangtze finless porpoise samples

[0334]

[0335]

[0336] Finally, it should be noted that the above implementation modes are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned implementation modes, a person of ordinary skill in the art should understand that the technical solutions described in the aforementioned implementation modes can still be modified, or some or all of the technical features therein can be replaced by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the implementation modes of the present invention.

Claims

1. A Yangtze River finless porpoise polymorphic SNP molecular marker, characterized by: The Yangtze River finless porpoise polymorphic SNP molecular markers include 19 SNP molecular markers, which are numbered as SNP 01-19. The nucleotide sequences of the Yangtze River finless porpoise polymorphic SNP molecular marker sites are shown in SEQ ID NO: 1 to SEQ ID NO:

19.

2. A primer for amplifying the polymorphic SNP molecular marker of the Yangtze River finless porpoise according to claim 1, characterized in that: The primers include KASP primer combinations for 19 SNP sites SNP01-19, which are numbered Snpp 01-57. The nucleotide sequences of two forward primers and one reverse primer of the KASP primer combination are shown in SEQ ID NO:20 to SEQ ID NO:

76. Each KASP primer combination is used to amplify the corresponding SNP molecular marker.

3. The primer according to claim 2, characterized in that Each KASP primer combination consists of two forward primers F1 (FAM) and F2 (VIC) with different terminal bases and a reverse primer R. The 5' ends of the forward primers F1 (FAM) and F2 (VIC) of the primer combination are connected to the universal fluorescent labels FAM: 5'-GAAGGTGACCAAGTTCATGCT-3' and VIC: 5'-GAAGGTCGGAGTCAACGGATT-3', respectively.

4. A method for developing a polymorphic SNP molecular marker for Yangtze River finless porpoise according to claim 1, characterized in that: The steps include: Step 1: Obtain candidate SNP sites by comparing the Yangtze River porpoise genome and resequencing data; wherein the SNP sites must meet the following conditions at the same time: a. Keep sites with an average depth greater than or equal to 5 and a maximum depth less than or equal to 500; b. Retain sites with a Phred-scaled quality score greater than or equal to 30; c. Retain sites with no deletions and a quality value greater than 1000; d. The sites with no other mutations within 100 bp before and after the retention site; e. Retain loci with low heterozygosity and evenly distributed on chromosomes; f. Retain sites with PIC values ​​between 0.2 and 0.5 and that are polymorphic in all individuals; Step 2: Use KASP genotyping technology to determine the SNP sites that are polymorphic and accurately genotyped.

5. Use of the polymorphic SNP molecular marker of Yangtze finless porpoise according to claim 1, the primer according to claim 2 or 3, or the molecular marker obtained by the development method according to claim 4 in the analysis of genetic diversity of Yangtze finless porpoise.

6. The use according to claim 5, characterized in that The specific steps are: Step 1: Extract genomic DNA from Yangtze River porpoise samples; Step 2: Using the genomic DNA of the Yangtze River finless porpoise sample extracted in the first step as a template, a PCR amplification reaction system was prepared according to the 19 SNP molecular marker sites, and PCR amplification was performed using the corresponding primers of the KASP primer combination; Step 3: Perform fluorescence scanning on the PCR amplification product obtained in the second step, read and analyze the fluorescence signal, and thus obtain the genotyping results of the Yangtze River finless porpoise sample at the 19 SNP molecular marker sites; Step 4: Based on the genotyping results of the Yangtze River finless porpoise samples obtained in the third step at 19 SNP molecular marker sites, the genetic diversity parameters were calculated using GenAlEx (version: 6.51b2) software.

7. The method for developing polymorphic SNP molecular markers for Yangtze River finless porpoises according to claim 4, characterized in that: A total of 1070 SNP site data were obtained through the screening conditions in step 1. Based on the principle of uniform distribution on chromosomes, 50 SNP sites were randomly selected from the 1070 SNP sites for first-generation sequencing verification to exclude false positive sites. Finally, 35 polymorphic SNP sites were preliminarily screened and retained; KASP primers were designed using Primer 3.0 software for the 150 bp interval sequences upstream and downstream of the 35 SNP sites; each KASP primer combination consists of two forward primers F1 (FAM) and F2 (VIC) with different terminal bases and a reverse primer R, and the 5' ends of the forward primers F1 (FAM) and F2 (VIC) of the primer combination are connected to FAM: 5'-GAAGGTGACCAAGTTCATGCT-3' and VIC: 5'-GAAGGTCGGAGTCAACGGATT-3' universal fluorescent labels, respectively.

8. The method for developing polymorphic SNP molecular markers for Yangtze River finless porpoises according to claim 4, characterized in that: Step 2 KASP genotyping technology specifically uses competitive allele-specific PCR technology to amplify the target sequence, and then uses fluorescence typing analysis to determine the validity of the SNP site based on the KASP typing diagram.

9. The use according to claim 6, characterized in that: In the second step, the PCR amplification reaction system was 5 μl, including: 1.25 μl DNA, 2.5 μl 2x KASP Master mix (LGC genomics Ltd) and 1.25 μl KASP primer mixture; the PCR amplification program was: 95°C pre-denaturation for 10 min; 95°C denaturation for 20 s, 61-55°C annealing for 60 s, the temperature was reduced by 1°C each time, and the reaction was carried out for 10 cycles; 95°C denaturation for 20 s, 55°C annealing for 60 s, the reaction was carried out for 27 cycles, and finally 25°C reading for 30 s.

Images