A molecular marker for polymorphic SNPs in the Yangtze finless porpoise, its development method and application

Abstract

This invention relates to a molecular marker for polymorphic SNPs in the Yangtze finless porpoise, its development method, and its application. Belonging to the field of DNA molecular marker technology, the nucleotide sequences of the polymorphic SNP molecular marker sites in the Yangtze finless porpoise are shown in SEQ ID NO:1-NO.19, and the primers used to amplify the SNP molecular marker sites are shown in Snpp 01-57. The SNP molecular markers provided by this invention are all derived from high-quality chromosome-level genomes of the Yangtze finless porpoise and are screened using resequencing data from three geographical populations. This allows for a more comprehensive detection of polymorphic SNP sites in the Yangtze finless porpoise genome. By utilizing KASP genotyping technology, genotyping of polymorphic SNP sites in the Yangtze finless porpoise can be performed efficiently and accurately, significantly reducing detection costs. This provides effective genetic molecular markers for population genetics studies such as genetic diversity assessment, genetic differentiation analysis, and kinship identification of the Yangtze finless porpoise and its closely related species.

Description

Technical Field

[0001] This invention relates to the field of DNA molecular marker technology, specifically to a polymorphic SNP molecular marker for the Yangtze finless porpoise, its development method, and its application. Background Technology

[0002] The Yangtze finless porpoise (Neophocaena asiaeorientalis) primarily inhabits the main stream of the middle and lower reaches of the Yangtze River, Dongting Lake, Poyang Lake, and the tailwaters of its tributaries. It is currently the only freshwater cetacean living in the Yangtze River, belonging to the suborder Odontoceti, family Phocenidae, and genus Neophocaena. It holds significant conservation and research value. In recent decades, with the rapid economic development of the Yangtze River basin and the surge in human activity, the ecological environment of the Yangtze River basin has continuously deteriorated, and aquatic biological resources have severely declined. As a crucial indicator species for the health of the Yangtze ecosystem, only about a thousand Yangtze finless porpoises remain, making their population critically endangered. Conservation efforts for the Yangtze finless porpoise typically focus on addressing external threats that may limit its population recovery, such as human disturbance and natural climate impacts. However, conducting population genetic research on the Yangtze finless porpoise, analyzing its population genetic diversity and structural characteristics at the molecular level, and subsequently developing scientific conservation and management plans, is of great significance for the protection of the Yangtze finless porpoise's germplasm resources.

[0003] Genetic markers are crucial tools in population genetics research, and have now evolved to the third generation of DNA molecular markers, represented by SNPs (single nucleotide polymorphisms). Compared to second-generation molecular markers such as SSRs (microsatellites) and AFLPs (amplified fragment length polymorphisms), SNPs offer advantages such as uniform distribution across the genome, large numbers, high throughput, rich polymorphism, high accuracy, ease of genotyping, and no need for fragment length detection, making them highly promising for applications in conservation genetics. Currently, population genetics research on the Yangtze finless porpoise mainly relies on molecular markers such as microsatellites. However, this method suffers from drawbacks such as long screening times, susceptibility to genotyping errors, and low throughput. Existing methods for developing SNP molecular markers in finless porpoises, such as genome libraries and CATS (comparative anchored sequence tracing), are often time-consuming, complex, and costly. By utilizing KASP genotyping technology to screen high-quality chromosome-level genome and resequencing data of the Yangtze finless porpoise, efficient screening of polymorphic SNP sites across the entire genome has been achieved. This method outperforms traditional methods in terms of effectiveness, accuracy, and cost-effectiveness.

[0004] Based on the genome and resequencing data of the Yangtze finless porpoise and combined with KASP genotyping technology, this invention developed polymorphic SNP molecular markers for the Yangtze finless porpoise, providing strong technical support for subsequent genetic research on Yangtze finless porpoise conservation, germplasm resource protection, and the formulation of related genetic management measures. Summary of the Invention

[0005] Technical problems solved: In response to the technical problems of long screening time, easy genotyping errors, low throughput, complex operation and high cost in the existing technology, this invention proposes a polymorphic SNP molecular marker for Yangtze finless porpoise and its development method and application, providing 19 polymorphic SNP molecular markers for Yangtze finless porpoise and their corresponding primers, providing effective genetic molecular markers for the study of the genetic diversity of Yangtze finless porpoise populations.

[0006] Technical solution: A polymorphic SNP molecular marker for the Yangtze finless porpoise, comprising 19 SNP molecular markers numbered SNP 01-19, and the nucleotide sequences of the polymorphic SNP molecular marker sites of the Yangtze finless porpoise are shown in SEQ ID NO:1 to SEQ ID NO:19.

[0007] A primer for amplifying polymorphic SNP molecular markers of the Yangtze finless porpoise, comprising a KASP primer combination for 19 SNP sites (SNP01-19), numbered Snpp 01-57. The nucleotide sequences of the two forward and one reverse primers of the KASP primer combination are shown in SEQ ID NO:20 to SEQ ID NO:76. Each KASP primer combination is used to amplify the corresponding SNP molecular marker.

[0008] Preferably, each KASP primer combination consists of two forward primers F1 (FAM) and F2 (VIC) with different terminal bases and a reverse primer R. The 5' ends of the forward primers F1 (FAM) and F2 (VIC) are respectively connected to the universal fluorescent tags FAM:5'-GAAGGTGACCAAGTTCATGCT-3' and VIC:5'-GAAGGTCGGAGTCAACGGATT-3'.

[0009] A method for developing molecular markers for polymorphic SNPs in the Yangtze finless porpoise includes the following steps:

[0010] Step 1: By comparing the Yangtze finless porpoise genome with resequencing data, candidate SNP loci are obtained. The SNP loci must simultaneously meet the following conditions: a) Loci with an average depth greater than or equal to 5 and a maximum depth less than or equal to 500; b) Loci with a Phred-scaled quality score greater than or equal to 30; c) Loci without deletions and with a quality score greater than 1000; d) Loci with no other variations within 100 bp before and after them; e) Loci with low heterozygosity and uniform distribution on the chromosome; f) Loci with a PIC value between 0.2 and 0.5 and exhibiting polymorphism in all individuals.

[0011] Step 2: Use KASP genotyping technology to identify SNP sites that are polymorphic and have accurate genotyping results.

[0012] This application also discloses the application of the above-mentioned molecular markers, primers or molecular markers obtained by the development method of polymorphic SNPs of the Yangtze finless porpoise in the analysis of genetic diversity of the Yangtze finless porpoise.

[0013] Preferably, the specific operation steps of the application are as follows:

[0014] Step 1: Extract genomic DNA from Yangtze finless porpoise samples;

[0015] Step 2: Using the genomic DNA of the Yangtze finless porpoise sample extracted in Step 1 as a template, a PCR amplification reaction system was prepared according to 19 SNP molecular marker sites, and PCR amplification was performed using the corresponding primers of the KASP primer combination.

[0016] Step 3: Perform fluorescence scanning on the PCR amplification products obtained in Step 2, read and analyze the fluorescence signals, and thus obtain the genotyping results of the Yangtze finless porpoise sample at 19 SNP molecular marker sites.

[0017] Step 4: Genetic diversity parameters were calculated using GenAlEx (version: 6.51b2) software based on the genotyping results of the Yangtze finless porpoise samples obtained in Step 3 at 19 SNP molecular marker loci.

[0018] Preferably, 1070 SNP loci were obtained through the screening conditions in step one. Based on the principle of uniform distribution on the chromosome, 50 SNP loci were randomly selected from the 1070 SNP loci for first-generation sequencing verification to exclude false positive loci. Finally, 35 polymorphic SNP loci were initially screened and retained. KASP primers were designed using Primer 3.0 software for the upstream and downstream 150bp sequences of the 35 SNP loci. Each KASP primer combination consists of two forward primers F1 (FAM) and F2 (VIC) with different terminal bases and one reverse primer R. The 5' ends of the forward primers F1 (FAM) and F2 (VIC) are respectively connected to the universal fluorescent tags FAM:5'-GAAGGTGACCAAGTTCATGCT-3' and VIC:5'-GAAGGTCGGAGTCAACGGATT-3'.

[0019] As a preferred option, step two, KASP genotyping, specifically involves amplifying the target sequence using competitive allele-specific PCR, followed by fluorescence genotyping analysis to determine the validity of the SNP site based on the KASP genotyping map.

[0020] Preferably, the PCR amplification reaction system in the second step is 5 μl, specifically including: 1.25 μl of DNA, 2.5 μl of 2xKASP Master mix (LGC Genomics Ltd) and 1.25 μl of KASP primer mixture; the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing at 61-55℃ for 60 s, with the temperature decreasing by 1℃ for each cycle, for 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 60 s, for 27 cycles, and finally reading at 25℃ for 30 s.

[0021] Beneficial effects: Based on high-quality chromosome-level genome and resequencing data of the Yangtze finless porpoise, the detection rate of actual polymorphic SNP molecular markers can be significantly improved by controlling the screening conditions; using KASP genotyping technology, the validity of SNP sites can be directly determined based on the genotyping map; the screening method is simple, does not rely on gel electrophoresis detection, requires no special instruments or equipment, and can realize automated SNP detection; this method can perform rapid and highly accurate genotyping of SNP sites, and does not require the design of target-specific primers or probes, resulting in low development costs and suitability for screening and detection of large-scale samples; the above screening method successfully obtained 19 polymorphic SNP molecular markers of the Yangtze finless porpoise, further enriching the molecular genetic marker library of the Yangtze finless porpoise and providing important genetic resources for its subsequent related research. Attached Figure Description

[0022] Figure 1This is the SNP01 genotyping map for this application;

[0023] Figure 2 This is the SNP02 genotyping map for this application;

[0024] Figure 3 This is the SNP03 locus genotyping diagram for this application;

[0025] Figure 4 This is the SNP04 genotyping map for this application;

[0026] Figure 5 This is the SNP05 genotyping map for this application;

[0027] Figure 6 This is the SNP06 genotyping map for this application;

[0028] Figure 7 This is the SNP07 genotyping map for this application;

[0029] Figure 8 This is the SNP08 genotyping map for this application;

[0030] Figure 9 This is the SNP09 genotyping map for this application;

[0031] Figure 10 This is the SNP10 locus genotyping diagram for this application;

[0032] Figure 11 This is the SNP11 locus genotyping diagram for this application;

[0033] Figure 12 This is a genotyping diagram of the SNP12 loci in this application;

[0034] Figure 13 This is the SNP13 genotyping map for this application;

[0035] Figure 14 This is the SNP14 locus genotyping diagram for this application;

[0036] Figure 15 This is the SNP15 genotyping map for this application;

[0037] Figure 16 This is a genotyping diagram of the SNP16 loci in this application;

[0038] Figure 17 This is the SNP17 genotyping map for this application;

[0039] Figure 18 This is the SNP18 locus genotyping diagram for this application;

[0040] Figure 19 This is the SNP19 genotyping map for this application. Detailed Implementation

[0041] The specific embodiments of this invention illustrate the technical solution in detail, aiming to help those skilled in the art to better understand and implement it. Unless otherwise specified, the chemical reagents and experimental materials used in the embodiments can be obtained through commercial channels.

[0042] This application discloses 19 SNP molecular markers for the polymorphic SNPs of the Yangtze finless porpoise, numbered SNP 01-19. The nucleotide sequences of the polymorphic SNP molecular marker sites of the Yangtze finless porpoise are shown in SEQ ID NO:1 to SEQ ID NO:19.

[0043] SEQ ID NO:1

[0044]

[0045]

[0046] SEQ ID NO:3

[0047] ATTATCGTTGTGTTATGTTGTAAATACCTGGTTAGGTGCCCATTCCCCCTCCCCATTCAGTTGAGCCTGG

[0048] CTGGGGCACAGGTTGGAAATAATCTTCTTCTCACCCCTCCACCCACTACCCCGCCGGCACCTGGCGTG

[0049] GAGTTTGGCACACGGCATGCGCGAACTCTCAATTAATATGGCGAAAAATCACCTGCCTGTAGTCAAGA

[0050] GAGGCAGAAAAATCATGCGTTTAAAAAAATCATATATTCATTTCATTTTGACTTTCACTTAGTCCACTTC

[0051] ATCATTTTTTTAGAATTTACCTACACCAAGGAATTTATTATCAGCATCAAATACATGGTGGTACACATAC

[0052] TTACTTACTTGGATTGATAAACAATGTATGTTTATCAGTGGAAGGATGGAAGGATCCATAAATGTTTGT

[0053] GTTTGCTGTGAATATAAATTAATTTTTTCATACTTATCAGATATGGAATGAGAGAGATATCTTCCACTTAA

[0054] AGCAAACCTTACACAGGGAGCGTTTGTATTTACAGAATAAATTGAAGAGCAAATATTTATTTAGCAAA

[0055] ATTCTTCTTTGCATAAGGTTTCAAGATAGCTGTTTTATGTAACTAGTCACTGAATAAACTTAGATGTGTT

[0056] TCGCACCCAACATCATCAGCCATCCAGCTGGGGTGTCAAAGGGGCTCATTCGTAGAGATATTCTAGGA

[0057] ACAAAGGAGCTAAATATACATTTGACAGAACCGCTAGATAGTAACTTGATCCACTACCAGATTCTAAA

[0058] GTGGTTTGGTGATAGGCTCTCAGACTTAATTTCTAAATCCTCCTACTTAGGGAATTTCTACAGCTGGTA

[0059] CTATGACTTCTGGAGTATTCTAGCAGAAGTTCTCAAGAGAATCCAACCCTACTTCTGTTCAGCTATTGG

[0060] TTTCTGGTCACCCAGATTATAGAATGCTGGAGATGGAAGATTTCCTGGAGATCGAAGATTTCTTAGAGATGGACTCTTTTGCTTCTGAAAGTATGGTTATGGTC;

[0061] SEQ ID NO:4

[0062] ACCCAAACCTCTGTCTCCCAGATTAGATTCTGCAATGGTGTACAGAGGCTGAGATTTCGGCCTCAAGT

[0063] ACCTTATGCAGGGGGTCATTCATTTGTGTTTGTGGGAGAAGTAGAAATAGTTGTACCTTTATCATCATG

[0064] GGAATGGCAAGAGCTATTGCTAAAATCTCTGTGGCTTGGAAGCAAGTGCTAGGGCCAGGGATAAAGG

[0065] TAAAGAGGAGCCACATAAAGATGTGACAGGGCAGCTTGAATTGCAACATGGACCCACTACAGAACAC

[0066] TCTCTTGTACAGGACCACAAGCAAAACGTGCAGCCTCTAAGTCGCAGTTAAAGGTCACAGTAGTATT

[0067] GCCATTTGCTATAAATGTTACCGCCAAAATTTAAAGGGGCTCACATGTGCTATATCTCTTTTGTCATGTA

[0068] GGAGTTGCAAGAGGCAAAATCATATCTATTACTTTCATTTAAAGTAATCTCAATCTTGCCATTACTGAG

[0069] AATAGGGTTGAATACTTCTTTGTCTGGAGGAGGCTTTCTTGTGCATTGCAGCATGTTTAGTTGCTTCC

[0070] ATGGCTTCTATCCACTTTAGCTATTTCCCCGACTTCTACCCCTGATGCCCACTAGATGCTACCCACTCAC

[0071] CTTGATTTTTGAAAAACAAATTGTCTCCAGACACTGCCAAATGTCTCTCGAGGGCAAAAATTTTCCC

[0072] CGGTTGATAACCATTGCTTTAGAGGGAAGGACTCAGTGTGCCCCAGATCACCAGACCCAAAACACAT

[0073] GACTCCTGAATCTTTGTAGGGTCTCTTTCCACTTTCTGGTATATATGTGTCTTACTAAAGTATTGAGAAT

[0074] ACTTGTTCACTCTTGCTTACCAGGCCAATCAGAATGATTAGAGTGATGTCATCTATACACAGACCATTG

[0075] GGATATTCTGTAGAATGTGAGAACGATCATCATGGTCAAGACACTTGAGGACTAGATCCCGAAAGAGTATTACAGTTAACATAACCATGTAAAGGCAAACTGTGCTTGATCT;

[0076] SEQ ID NO:5

[0077] CGCCAGGGTCTTGATTTTCCCATCTAGGTAGGAGAAAAGATTGTCATCTTTGGAGGTCCAGGGCACAG

[0078] AGAGAGCCAAGGCATCTTTCGAGGTTCTGGGGTCAGGGGGAGCGGGTTGTAGAGAAGAGCTGCCTG

[0079] AAGCATTATTGGAGGCTGCTTAGAACACAGGTCTTACTGAGAAGTGGAAGTTGAAATAAAGTGTCCTT

[0080] CAAGACCAGGCAGGTGTTTTTGGTTTGGCATTTTCCCCAGCAGCATTGAGAACCTAGGGAAGAGTGG

[0081] AGATGGTACCTAGTGGGGGCTGACTGAGGGATAGGGTAGCACAGTATCCAAAGACAGCCAGAGACCA

[0082] TGGGAGCCTTGACTGAGGCCATTGGCGATGGAGAGGAGACTGCTGTCACGAGGCTGGGGCTGATCTG

[0083] GTTAGCAGGACTGGCCTCATGGAACCACTGCAGGGGGGGCACATGTGAGTTCATGGAACACAAGCG

[0084] GCTGACTCCTAGGGATGCTGGGGAGTGGAAGAGCAGGGCAAGCATAGAGGTGGTGGAAAAAAACTA

[0085] GACCCATTTGTTGGATGATTCGAAAACCCACTGCCCAGGTCCTAAAGGTTGAACCCTCTGACTCTCCT

[0086] CACATTGATGCATGGGGAGAAGTTTGTCAGAATCACTGTATAGACTTGAGGGATGAGGCAGTCTTTCC

[0087] TCACTGTTCTTTTCTTCCTTTTTATTTTTATTATTCTTCTTGTCAGTATTTAATTGCCACCTTTATTTCCTTT

[0088] GAGAGTCAAGACATCTGCTTTCCTGGTTGAGAGGTACAGTGCATGGAAAAGACAAAGGAAAGAGGA

[0089] ATACGTTTTGCTCCCCCATGAGTCACTTTCTTTCTCCTCCTCCTATCCTCCCTCCTTTTAATTATTCACCA

[0090] CCATCCTTTTTCTTATTCACGTATCCTCTCATCTCCGTGTTCATGTCACATTGTTATTCTTAAATCATAGACATTGGCGGGGAGAGAGGGTTGTCTAAGACCTAAAATATGGAGGTTGACA;

[0091] SEQ ID NO:6

[0092] TGTGCTATTCGTTGGTTGTTTGATTTTAATTATCTTTTATAAGTCTATAAAACAGTGAAACTGCATATCCT

[0093] AAACAAGAATCAAGAACTGGTACCCTGTGGTCCTAAATAAACCCTCAGACATATTTTGTTTGGTAGCT

[0094] CAGTATTGTTATGGTTGTTTTAAGGAAGTGTAATTTGATTAGGCTTAGCATTGATTTTCTAGTTTATGGA

[0095] AGGCCCTGTCATTGCCTATTTTCTTACTCATAGCTTCTTCACACATTTAAATTAGTTGCCTAACCCTTGA

[0096] GGGCATTAGAGTTTGCAATATGGCTTTATTATCAAGACTTCAAATGTTATAATCCTTCCCTTGATATTGC

[0097] ACACTCTTTGAAAGCAACACAGTGTTTTCCTTGATTTCCTAGCACCAATTATCACAGTGTCTTAAATAA

[0098] ATGGACATTTCTTTCATATATTCATCTAATCCACGAATCTTTACTATGCACCTATTCTGTTTTAGACAACA

[0099] TACTAGTCAATGAAGGATAAGGATGTATAAGACAGTTCCAGAACCCATTCTCATAAATCTTGATGGTTA

[0100] AGTGAGGAAGGATTTGTTTACTGATTGATAAACGTGGCTATCTTAAATCCTCTGCTATATAACTTAGG

[0101] AAATAAGGGGTTACTAGCCTCTTCCCAGAAGGAAATATATTAAAATAAGTAAATATGATGAGCTGAA

[0102] TTGTATCTTCTCATAATTCATGTGTTTAAGTTCTAGCCCTCAGTACATTAAGATGTCACTGTATTGGAGA

[0103] CAGAGTCTTTTAGAGAAGTAGTTAAGTTTAAATGAGATCATTAGGGTGGACTCTAATCCAATATGACTGA

[0104] TAACTTTATAAAGAAGGAAATTTGGAAACACACACAGAGGGAAGACCATGTGAAGACACTGGAAG

[0105] AATCTGTATAGCAAGGCTCCCAGAAGAAACCAACCCTGCCGACACCTTCATCTTGGACTTCTAGCCTCAAGAGCTGCAAGGGAATAAATTTTTGTTGTTTA;

[0106] SEQ ID NO:7

[0107] TGCTAACCATGCTCCATGCTTTTGGGATGCTTGTTACTCCCAATTCTTACCAGTGGACAGAGGTTGGGAA

[0108] TACATATGTATAGATACACACACACACACACACACACACTTACACACACACACACTGTTCAC

[0109] ATTTACATATATAAAACATGAGGTCCCACCAGTACCTCCAATTCCAATAATGCCATTTCATTTCGT

[0110] TCATTCTATTTTCCTCCTTTCCCTGAAAATGAGAAACTGATTCCCATTATCCTTGATACATATGTACTTA

[0111] ATGTTCAATTCCCCCTATGTAACCAATCTCCCATTGCTGATGCTAGCCCCTCCCCTGTGCAGTTGCCCTC

[0112] TTCATCCCACTTGGTTTCTCACATTTTATACTGGGTCACTCTCCTGAGCAGATGCTCCACCCACTTCAT

[0113] GCAGGTTCCAACCTATGCCAGGCTGCACTCCCACAGGGACACCCAGAAATGGTTGCAATATGCACTC

[0114] ACTTGCTCTCTCATGCTCTTTTCCTTCACCCAGTATGGACACTCTCCTCACCTTGGTTGGGCTCTAACT

[0115] CGTGCCAAACCCACCTAATGGCTCTTGGTCTGAACTATTCAGGATGGGGAAGGGCCAGGATTATTTTT

[0116] TAATAATCATTTAGCTATAGTTTGAAGAATTTATAGTAAGGGAAATAGTAAATAGGAAAACTGGT

[0117] TAGGAGACTATGGCCTAGGTGTTAGGGGATAATGTCTTGAACTAGGGTGCAGTTAGTTCAGATGTAGA

[0118] AAAATGAACAGATTCAAGAAAAAGTGGGAGGTAATATACATAGGATTTGGTGATGAATTGGTCATGG

[0119] CGGGGAAGAGAAAGATATCTGAAGACAGATCTCTACTTCCGATAATTAATGTCCACTTGCTTCAGAGA

[0120] AACCGAAGCCTTGCCAGCTTCAGTACAATAAATCAAAACTTGATAAAATAGCTCCATCATATATGCATGAGATATGTTATAACGAGGGGACTGTTTTGTTTCATT;

[0121] SEQ ID NO:8

[0122] AGGATACTGGCAGAACACTAAGGTGTTTTAGCCTTACTCCAGGAAGTAATTTATGCAACGCATTACCTA

[0123] GCTGGTGAAAATATGTAGTAAAGAAACAACCACGATCAGTAGGAGCTAAGTTTCTCACGCATAATATC

[0124] AGAGTGAATCCATAATAGCTGCGTAAGTGAACCACTGAGTCCTTAGCTCATTGCTTAACCTAGGAAGT

[0125] CACCTGCTGATTTAATGTTAGCTATGGGAGTATCTCCATCACAGCATCCCTACTGCTATATCACATTTAA

[0126] ACTAAGCATTTTTTCTCTTCAGTCTACCTTCTGTTTAAATTACTTCTATTTTGAGCAGTGTGCTTACT

[0127] TTTTCACCTTTTTGTAAGACTTGCATTTTTTAGCTAGAATTCAAATACAGCTAAATGAGGAAAACTCA

[0128] ATAAAGGGACTAAAAATTTTTTTGCATCCAATAATTTGCTGTGAAATGCCAAGTTGGTGGCTGTGCCT

[0129] GCAGTCATTTTAGTTATCAAGACACATAGTAGGAAACAGTTTTGGGATTTTCAGCCATTAGTTTATAAA

[0130] TTGAATGAGACAGATGTGTTCATTCATATAAAGTAATGTAATTCTTCTTGGGAAAGTTTAATATTATACA

[0131] AATCCATTATATTTACAAATTAATCTTCCCTTAGGAAATAAAGATAGAAGATTTGCAGAAGGGAGGGCT

[0132] TTATTACTTTTAAAACTGAATTGTTAAAGAAAATAAAAGAAAGGAAAATTATATGAACTATAAATGC

[0133] CTTTTTTTTTTTTTTGCAGTACGCGGGCCTCTCACTGTTGTGGCCCCTGCTGCTGTGGAGCACAGGCT

[0134] CTGGACGCACAGGCTCAGCAGCCATGGCCCACGGGCCCAGCCGCCCCACGGCACATGGGATCCTCCC

[0135] GAACCAGGGCACGAACCCGCGTCCCCCGCATCGGCAGGCGGACTCTCAACCACTGCGCCACCAGGGAAGCCCTAAAAAAGGCCTTTTTATGACTAACAGTTTTTTA;

[0136] SEQ ID NO:9

[0137] ATATGTTTGTATGATGGAGATCTTGAATCAGCATTACTTGAAAGGAACCCATTTGGGGAAGAAAAAAG

[0138] AGAAATCCTAAAATAATCTTCTGGTGATATTTATCTTGTAAGTGGATAAGCACACCACATTGAGAGGTA

[0139] TAACCTGTGTAATTCTGGAGCTTACAAAAGACTCAGGTGGCAGACATTAAGTTGCTTCAACGTCACAC

[0140] CCTCAACCTGTCTCCAAGCTTTGTAATATTATACATAGTACTAGGACATCAACTGACGAATCCATTCTGC

[0141] TTCTATGTTGTTCTTTCTATTTTATAAAATGTTTTTCCATTGATTATCTCATTTTGTCCTCACATATGCATAT

[0142] AAAACTAAAGAGCTAATAAAGACAAACTTTAATGATTCTCCATTTAGAGGTGCAGAGGGTTTCAAAGA

[0143] CTTGCTCTGTGTCCCGTAGACAGTAGGTGGCAGAGGTGGGATCATCCATCTTTGTCCTAGGAGGGCAG

[0144] ATCCACTGCTTTCCTGGAGGCCCCCTTGCCTCTCATTGCTGCCCTGCAGTTCCCCTGAGCAACTCTGT

[0145] CCTTGGGTTTTGCCTGTGGTGTACGATAACTTTTCAAAGCTGGCAGGAAAAACATTTGCTTCTCCCCT

[0146] CATCATCTTCTGTGAAGGATGCAGTGTTGGCCACACAGGGGATGGGGAGCTCCCCAGGATGGGGATTT

[0147] TGCTGCTCTATTTTCAGCATTTAATATTTGGCATTGGTAACTAAGTGAAATCTGTTAATGGTGTAAGTAT

[0148] CCTGTTCTTATTAAAAGCTTATAAATTGTTATCTATTCAGAACAAATGAGGACATAATTACTTTTTCTGG

[0149] ATAATCTTAAAGAAGTATTCTAGCGTCTCTCCAACTCTCTTTTCTTTATTCTATTCTGCTATATTAAGTTG

[0150] GCTCTGGGGGAACATCAGACATTTTATGTTCTTTTTCCAAAGGTTTTTAAGGATGAAGGTGTCATTGGATACTTTTCTCAATTCTAATTCCTAACATCTGTAG;

[0151] SEQ ID NO:10

[0152] GGAATTAGATTCCTTACTGCTCTTCCCTACTCGAGGGGAATGAAGCTGGTACTCCTCTCTTATCTCATG

[0153] GAGAGGACACCTCTGAACTTCTCTGACAATATGTGCCCTGCTAGGGATGTCACAGTCGTTCACCTCTC

[0154] ACCCCAAGAAACCAAACCTGCTCTCAGCCCAGCTCCAGTCCACCCACAGTTCACCACCCACAGGCGC

[0155] CCAATGGAGACCATACCTCCTCCTTAGCGACCGACTCAGAAGTGACAGATCAACACCACCCCTGCCC

[0156] CATCCCCGTGTGCATGCTACCTCTTCAATATGTTATTCCAAGAGAATTTACTGACGCCCATCAGTAAAA

[0157] AGGGCCATCATCCAAAGCCATTTCATAGCATCCCCCTGTATTGGGCCCTAACTCTAGAAGTTGGTCTTT

[0158] ATTTTTCAGATTCTCACCAAAAAAAGGCAGACAACTCATTTGATGTGGCATTCACTGAAATTACGTTTC

[0159] AGCAAAAAGTGAAACTAGACATTCAAAACAGTCTCCAAACTTCTAGATATTGGCTCTCTACTTTTGGG

[0160] GGTGATGATCAAATAAAACCCAATACATCAGATCAGATCAGTGGTCCCCAACCTTCTCCTAACAGAGT

[0161] CCACGTTTTGAAATACATTGTCGACTAAAAAGACTGCATTTATGTTTAATTTCTCCATTTTTATTCACCA

[0162] AGGGCGTAAGCAATGGCCACCAATCTGGTTGATAAGAGATGACTCATATCACCAAGGAGTGCACAGG

[0163] ATTCTAAGCAGAAAAAAGAAACGACGTGAAGCCTGATTCAGAGGCAAATAGGAATTTTCTGGCTTGT

[0164] TTTTCGAAATACTGAAAATCATTCATACATTCCCACTGCTACCTATCACAGCCACTCAGGATCTTTTTTC

[0165] CTGATGAAAATGTACAGTAATAACTCTCAGACTTCAGGGTTATAAATATCAATACCAAAAGCCAAAACACCTGAAATACATCAGGTACCGTACCTTTCATTAGAGGAGAGAACA;

[0166] SEQ ID NO:11

[0167] TCAGGTTAAAGGGTCAGACAGAAAAGCCATTCGCAGTGGTCTTTATTTATGGTTCTCAGAGGTCCAGT

[0168] TGCTGAAGCATCCTGAAGAAGAAGGATGGCTCAGGTGGGATCCCCGTTTCCCCGCCCGGCTGATGAC

[0169] AGACTGAGGGCCTCGCACTTTGTGAAAGGCCGGCTTCTTATGAATGCGTATTAATGTTTGCAGGCACA

[0170] ACACGAGACCCATCCTCTCTGTTACCCCCAGTGCAGAGAGAGCTGTGTGTTTTCCCTCTGTCCTCCCT

[0171] TCTCGGCCACCTGAAAAGATTCCTTCCCACCACCTGTGGTTGGTCTTTGAAGGCCAGATAAGAAGATA

[0172] CGAGCATCCCTGGCTGGCAAGCTTGGCTAGGGGAGAGCCTCACACCCTTCTCAAATGCTTGAAAATC

[0173] AGTGCAGATGTTTTATTCATGCCTTCTCTTGGTGCAATAATAAGCCTCCATTCTTTGAAGAGCTCATCTT

[0174] CCCCAACCAGGAGCAGTGTTTAGGAGAAAATGGCCGGAGAGCAGCAGAGAAGGAAGGAGACCTCT

[0175] CACCTGTTCCTCTGGGCCCCCTCTACCTCCATCTCATCCTTTAACATTCAACTTGGATCCCACTTCCCCC

[0176] CATCTGATTTCCTGGTCCTCTAATCTTTCATGTCCGGCTGACACAGTGAAGTGGCAGACAGAGAATGG

[0177] CCAGGGTGGAGGGGGACAGGGTGGGGCTGAATGTCTTCTTTGCTGACTGAAGGCTGCAGGACCTCA

[0178] AGCTCTGGGAGCTGGATGCATCCTCTGTGAAGTGGGATTGATAATGTTGGGCTCCAAGGCAGTATGGT

[0179] TGAAAACTACCTTTTCCCCAATTCATTGCCTAGCTGTTCCATTCTCATTCTTCAGAGAGGTCTGCCCTT

[0180] CACCTCCCTCCTGACCCACCCCCCGGCCAAAGCGAAGGGACCTCTTCTGTATGGTTCCATGAACCTGGCCCATAGAAGCAGCTCAAAAAATATTTGCTGAATGATGCGGGCTTAGCCAGC;

[0181] SEQ ID NO:12

[0182] AAGGCAATCAAAAAATTGGACCAAAATCCCTCGGTGGATCATCTCCGTTATTAGATCGTTCACAGCCA

[0183] GTGCAAAGGTTTTCACACATTGATCTTGAACCTTGCAATTCCGCTGACATCTCCAATACCTGTGTGCGT

[0184] GTCCATTAGGCTTCCCTACACGCGAAACCACGTCACCTGCAGAGAGAGTGTTGCTCCTTCCTGCCGG

[0185] GTCTGGAGGCCTTTTATTTCCTTTCCTGGCAGTGTCGCTCTGGGCACACCCCGCAGCACCGTGTTGAA

[0186] TACACGTGGCAAGAGCACCCATCCTCGTGGTCTTTCCTCGCTCTCTCCTCTGTTCCTCGTGCTGGATGA

[0187] CCTCAGGGGAGCCGTCCTCAAGTTGCCGATTCACCCTCTGACGGCTCCCTCCACTGCTGAGCTCATTT

[0188] TACTTCAGTTACTAAGCTCTTCAACGGAAAAGGGCTTCCTTTTCATCCCTTTTGATCACTTCCTTGTATTGACATTCGCTATCTCTACTGA[T|G]CCCTTTTCCCTGTATGTGCGCTTTACTGTGCTTCTCTGCACGCCCTGTAATTCCTCCTGAAAACCGGACACTTCAAATAATACAATGCGGCACCTCTGGAAACCAGACCCTCTACCCGCCCCACGCTTTACTGCTGCTGCTGCTGGCTGTGGTTGTCTGCCTGTTTAGCGACTTTTCTGAGTGATTCTGTCCTGTTCGTGTCTTTGTATGGGCACGGGTTCTACTCAGTTTAGCCACAGGAAATACAGATTTACATCACAGTGAGGTACCACTTCACACCGACTAAGTCAGCTGGAAGTCAAAAAGACAGATAAAAACAAGTGTTCGTGAGGACTGTGAAGAAACCAGAACCCTCACACACTGCTGGTGGGAACGTAAAATGCCACAGCCACTGTGGAAAACAGTTTGGCAATCCCTCAAAAAGTACCATATGACCTAGTAATTCCACAGTAGGAATTCCGCTCCCAAGAGAACCAAAAACAAACATATGTCCACACAAA;

[0189] SEQ ID NO:13

[0190] ACACATGTCTTCTTCTTAGAAGGACATCAGTCATATTGGACTGGAGTCCCCCCAGATGGCCTCATTTTA

[0191] GCTTAATCACCTCTTTAAAGATCTTATCTCCAAATACAGTCACATTCTGAGGTATGGGGGTTAGGACTC

[0192] CCATGTGAATTTTTTTTTTAGAGTGGGATGCAGTTCAGCCCATTACAGGCGCAGAGAGGCTAAGTAGC

[0193] TTGCCTGAGGTCACACAGCTACAGGACTGGAGTTCAGACAGTCTGATGCTAGAAAGCCCTAGTTCCG

[0194] TCCATATAGAAATAAAAAAATGAAGACATGCCAAAGCAGGGTTATGCAAATTGTGGTCTATTTTAAATG

[0195] TTTACCTGAATTCAATAAAGGAGTGCTTTTGAAAAGAAAAAGAAATCAAACACAATATGATCTTGATA

[0196] TTCAAAGGATAATTACTTCATATGTAAACTTAATCCCTAGAGTATTACAGGGGTGAGATCTGGTAACAG

[0197] GATAAAGTCTGAACTTGATAGTGCAATGGTACGTTTTCCCCAACCCATGAGAGTGCATCTCCTTGCAC

[0198] GCGTATATAACGTCCTCAGGGATAGCTTTGAGGTCTACATTCGAGGCCCCCTGTGAACGGAGAGCTTG

[0199] TCTAGTGGCCTTCTGCACCTCCCTGCGTGCTTCGGGCAGCCTTTCTGAAACTTTGTGACTCCCGAGTC

[0200] TCTGGTCTCGAACTGCTGTGCTCTGCTCCCTCCCGAGTCTGGAAACTGGGGTTCTGGTCTCTAACTCT

[0201] GCCGGGAAGCAGCAGTGAGTGACCTTGGGAAGGTCAAATGCCTCCAGCCTACCTTCCCTGTCTGCAA

[0202] ATGGAGGTGTTGGAATAAAAGGTGACCTTTATGGTCTCCGGCAGCTCCAGACATCCCCACGACTCTGA

[0203] TGCTGTGACTAAAGCTCTGTCATTCGATTCTATGGCTGCATATTAAGCAAACTGAATTGCAATGTGTGGAACCCTATTGGGTCATCCTCGATGGCACCCAGAACCCCTGGGTCT:

[0204] SEQ ID NO:14

[0205] AAGGGATAACAAATTACCAATGTCAGAATGAAAATGCAAGCAGATCCTAACTAAAAG

[0206] RELATIONSHIPSTATTGTGAAPATTGTCATACTHELPATTTSTREATHTATTGTGTATTACKSTRUCTURE

[0207] CCTTGAAGACAAACTATCACAGCTCACTAAAGAGAAACAGTTAATCTGAATGAACTACA

[0208] AAATAAACTGAATTTATCAAAATTTCCACAAAAAAAACTCTAGGTCCAGAACTTCACC

[0209] AGTGAATTCTACCAAACCTAAGCAAAATACCCATTGTATATAAACTCTTTCAGAAAATAAAA

[0210] QUICKWINDSTTAAAACTHELPTTATQUCCATTACCCTQUAKAAAAACTACCTATA

[0211] TCACATAAAAACGTTATTAGTATACTTCTCATGATATAGACAAACATCCTTAACAAAAAATTAGTA

[0212] AATTGAATCCAGCACACAAAAAAGGATACTTCCTGATCAACTGGGACTTTTTTTTTTTTAGCA

[0213] ATGCCAGGTTGTTTTAGCATTTGGAAATCAGTCAATATAATTCACTGTATTAACAAACTAAACAAGATA

[0214] AAAAATATAATCATCGCAACAGATACAGAAAGGCACCTGAAAAAATTCAACATCTTTTCATAATAAA

[0215] AAGAAACTCACAAAAAAACTAGAAATAGAAGGGAACTTTCTCAATCTGATACAGTGTTGAGAAAATC

[0216] TAGAGCTAACATCATATTTAATGGTGAAAGACTGAATGTTTTTTCCCTAAGATTCAAAATAATGCAAGG

[0217] ATATCTGCTTTCACCACTTCTATTCAATTTTGTACTGTAAGTTCTAGCCAGTGCAACAAGATAAGAAAA

[0218] AAAGTATACAGATTGTAAACAAAGAAGCCAAAGTATCTTTATTTACATATGACATGATTGTGTTTTATAGAATTCTAGGGATTTTACCAAAAAAATTACTAATAATACAATAAAT;

[0219] SEQ ID NO:15

[0220] ATGACTTTTTTTTTTTTTTTTTTGACCACGCCACGCAGCTTGCGGGATCTTCGTTTCCTGACCAGGAAT

[0221] CGAACCCGTGTCCCCTGCAGTGGAAGCGTGGAGTCCTAACCACTGGACTGCCAGAGAATTCCCTACA

[0222] GCTGGTTTAAAAGTGAACACACCATAAATGTAATTCTCAGGTCAAGAAACAGAATGTCACCTACTTCC

[0223] CAGAAGAAACGCCCCTTACCGCCATGTAGCCACTACCTTCCCACAGGTTAGGCAAATCCTAACTGCTAT

[0224] CATTAGACTAGTATTGCTCATGAACATTACATAAATGGACAATATAGTGTACACTCTTTTGTGATTGACT

[0225] TTTTCTTAATTCAACATTTTATTTGTTATGTAAGTGTGGTTCTAGTACTTTTATGCTCACAGCTGTATAGT

[0226] ATTCTCAATGTGTGAACATACCTCAACTTCTCCGTTCTCCTATTGAAGACATTTGGATAGAAAATATTAT

[0227] ACCTTTTTTATATCGCTTGAGCTCGATCTGCTAATATTTTCTTTAGGACTTTTATATTAAATATTTATAAGAG

[0228] AGATTGGCCTGTAATTTTTGTTTGATGTGATTCTTTTGCTATGTTTGGTATAAAGATTATCCTGGCTTTAA

[0229] AAAATTGCTCAGAAGTGATGTCTCGGTTTCCATTATCTGAAGGATTTGTGTAAAATTAGTATTAGTTCT

[0230] TCCTTGAATTTTTAGAAGAATTAACTGGCAAAGCCTGGAATATCTATTTCTTATTAACCATAAGAGATAA

[0231] TAGGAATTTTTATTCTGTCTCTGAGAGGTGTTTGACTTATATTTTTGTTCTCCTGAATATATAATTAATTGCAAA

[0232] ACTTGACCGATGTCTTCAGGAGGAGACAGGCTCTATGTTTCATGTCCTTTAGTTCTCCAGGTTTGGCAT

[0233] TTCTGTTACTTGCAACTCCCCAGAGCTGTCCTGATTTCTCTGTCCCTCAGTAGGACCTTTCTCAGGACAAGCTCAGTTTTCTCACCTGTAGTGTAT;

[0234] SEQ ID NO:16

[0235] CTAAGAGCAGAAACAGTGTGTTTGCAGAACTGCTGATTTCACTAATACCTGACATCTATGAAAGGGCA

[0236] TGACTGGTATCAGCTGCTTTTTAAAACGAAGCTATATAAGTGATTATGCACATATTAAGAGAATATGAA

[0237] AATATACGTTTAGATGAATATATATTTAGATATTTATATGTATCACCTATGAAACATAAGTATTATTTATAAA

[0238] ATGTAATATGTATATTACATATATACATACGTGTGTGTGTATATATATTTATTTATTTATATTCGTGTGTCTCT

[0239] GTGTATACTGCAGTGGCTTGTGCCTAACTCTGTCTGGGAATGGGTGGGAAAATCAAGAGGTAAGGAA

[0240] GCTGACGAATCAGGGAGGTCCTGGGGTTCCTGGGGCTGCTGATGAGAGATGAGGGCTAAGGAAGAG

[0241] TGGGTTTATTGCCTTGAGTGTCAGCTGGAGTCAAGCTCTGAGTGTTGGAGTCAGTAGGTACCCGGTTT

[0242] ATGAGTTGATTGTCTGAAGAATATAGAACTAGAGGGTTGTTTGCACACTTCTTTTTTTGCAGTACGCGG

[0243] GCCTCTCACTGTTGTGGCCTCTCCCGTTGCAGAGAACAGGCTCCGGACGCGCAGGCTCAGCGGCCAT

[0244] GGCTCACGGGCCCAGCCGCTCCGCGGCATGTGGGATCCTCCCGGACCAGGGCACGAACCCGTGTCCC

[0245] CTGCATCGGCAGGCGGACTCTCAACCACTGCGCCACCAGGGAAGCCCTGTTTGCACACTTTTTACCTT

[0246] GATCAGCTACCAGGGTCCTGCTCATATTGTGGCATGTGGAACATTTGCTAGAGATGGTACACAAAGTA

[0247] GCAGGGAGTCAGTGAGCATCTGGGCTGATTGCCTTTAATAAGCTTCTGTGTTCGATTCCTGAATCTATT

[0248] CCTACGTTTATACTATTTCTGCCTTTTAGGAGCCTCCTGCTAATGCACCAACTACTACTAGATTGTTCCACTCTGACCTCTGAATTGATGTTCAACTTTTTAAAGAAAA;

[0249] SEQ ID NO:17

[0250] TTTTTAAATATTGTATCATTGATATTTTGTGAATTTATCATTTTAAACTGCCTTAAGCACCTTGAAACTGA

[0251] TTGAATCATTTTACAAAGTGTAACTTAAAAGTAGTTTGGATATGGTAATGCACAAATTTTGGTTGCCTTT

[0252] AAGCTTATTAAAATAGATTCTATTTATATAGCTGCCTCAGTTACTCATTTCTGCACAATAAATTACTCCAA

[0253] AATTTAGTGGCTTAAAATGTTTGACTTGCTCACTAGCCTGTCATGTGACGGTTTGGGCTGGCTGTAGCT

[0254] GGGCTGGGTGCCAGCAGGGTCTGTGTTTGTGGTTGGGTTCATTCATTCGTCTGGTGGCAGTTGGCTGG

[0255] CTGTCAGCAGGGGCGATGGAAGAATCTGGGCCAAGTGTCACTCACATTCCAGCAGGCTACCCTGAAC

[0256] TTCTTCACATGGTTGCTGGGTTCCACCAGCAACAAGGGAGAGCAAGTTCCAATGCCTAAGTGCTTTTC

[0257] AAACCTCTGCTTGTGATCGTCTTGCTTATGTCCCATTGGTCAAAGCAAGTCACAGAGTCAATGTGGGA

[0258] GGCCAAGCTCAGAGTCAATGTGTTAAAGAAGTATAGGAAGTCAATGGGTCCAGGGAGGTGTAATTCA

[0259] ATGGGGGCCATTACTATAACTGTAGTTGCTATCATTTCTAAAAATTTCCATTATTTTCTCAAAGCATTGA

[0260] CATTAAACTCAACTCATGCTCAGGCAATTCTGTATACAACTGAGAGCTAATGATGCGTTATAGCTATTG

[0261] GACTCTGATTTAAGGCTTTAGCGCCACTTAATATTATAACGTAAAAAACTAAGACGTCATATCACTGCC

[0262] TTGTTCCAATATTTCCCATGGCTTCTTATTACATTTAGAATAATATTAAAATTCCTTGACACAGACCACA

[0263] GGCCCTCAGCGATTTTGTTTTTATCCACGTTTTCGTGACATCATACTTTACCACTCAGCCCCTAGTTTACAGTCTTTCAGCCATAATGGCTATTTTTCTATTCCT;

[0264] SEQ ID NO:18

[0265] ATCATTTCCTGGTTTTTGCTTTTGAAAACTTCCACTAGAGGAAATAATGGGCACCGTAAATTTAAAATT

[0266] AATATGTTTTGGATTCATCCATGTCTAAAGGCTACATGTCATCTTGGAAAGATACTGATTTAATTTATAA

[0267] CTCTGCCTTCCCCAGCATTTTAAGTTTTCACTAACTTATTTTCTCTTTTCTCCTATTTTTTCAAAGGTAAA

[0268] CTTCTAAACATTCATGTTTACTATTTTCTACTATTGTAGAAACACTGAAGAACTTGAAGCTTTTTTTTC

[0269] CTCCCCCCAAAACAGGCATCAACATTACCTATTACCTTTCACCCTGCTCTAAGCTAAATTGTTAGTG

[0270] GCAGTGACTTTATAATGGTGTCTGTAACGTATTAAAAGAGTCACGTTTCCAATTTTCCTTTGAGGGGTGA

[0271] ATTTAGACTGTTGGATGCATATCCTCATGAAAGGATAAATTATGGTAAAGGGGTTTCTAGATAAGC

[0272] CAAGAGGCTTCTTCTAACCTGGAACATTGTTAAAATCCTCCACATTCGTAATGAAAAGCATTGGAAAG

[0273] TCATATTTTCATAATACCATTAAATAAAACAGAAAAATAAACTATCTTATTTATCTTCAATGGTGATACT

[0274] TAAGGAAAAAACGTTTAAATTAGAGGAAAATGAAGAGTAGCTACAGAGACCTGATAAAGATCACC

[0275] TAAGGCAACATTAATTGACCTGTAAATGGGAACACTGATTGAGCACCTAATATACGCCAGTTTCTTTTAT

[0276] AAATGTTCTCCCTTTAATTTTAAAGACAAGACTGAAAACAAGTGATATTATCCCCATTTTATAGATAGTGA

[0277] AATTGAGGTTTAGAGGAATTAAGGAACTTCCCCAATGTCACAGAGATATAAAATAGCAAAACCATGGG

[0278] AACCCATTTTTTATGCTAAAATCCATTCTGACTATGAAATATAGCAGGTACATGATCCCTCTGAGAACAAAAAGGAGGTGGTAAGAACGAGTTGTCCAGT;

[0279] SEQ ID NO:19

[0280]

[0281] The SNP01 site is labeled C / T and is located at position 3578746 of the genome sequence of chromosome 2 of the Yangtze finless porpoise.

[0282] The SNP02 site is labeled A / G and is located at position 90116171 of the genome sequence of chromosome 2 of the Yangtze finless porpoise.

[0283] The SNP03 site is labeled A / G and is located at position 6297226 of the genome sequence of chromosome 4 of the Yangtze finless porpoise.

[0284] The SNP04 site is labeled T / C and is located at position 71791661 of the genome sequence of chromosome 4 of the Yangtze finless porpoise.

[0285] The SNP05 site is labeled A / G and is located at position 84395785 of the genome sequence of chromosome 4 of the Yangtze finless porpoise.

[0286] The SNP06 site is labeled G / A and is located at position 106682173 of the genome sequence of chromosome 4 of the Yangtze finless porpoise.

[0287] The SNP07 site is labeled G / C and is located at position 50780006 of the genome sequence of chromosome 7 of the Yangtze finless porpoise.

[0288] The SNP08 site is labeled C / A and is located at position 85509514 of the genome sequence of chromosome 7 of the Yangtze finless porpoise.

[0289] The SNP09 site is labeled G / A and is located at position 27,764,344 of the genome sequence of chromosome 11 of the Yangtze finless porpoise.

[0290] The SNP10 site is labeled as T / C and is located at position 83891362 of the genome sequence of chromosome 13 of the Yangtze finless porpoise.

[0291] The SNP11 site is labeled A / G and is located at position 13332465 of the genome sequence of chromosome 14 of the Yangtze finless porpoise.

[0292] The SNP12 site is labeled as T / G and is located at position 1462494 of the genome sequence of chromosome 15 of the Yangtze finless porpoise.

[0293] The SNP13 site is labeled G / A and is located at position 55868804 of the genome sequence of chromosome 16 of the Yangtze finless porpoise.

[0294] The SNP14 site is labeled A / C and is located at position 23473466 of the genome sequence of chromosome 17 of the Yangtze finless porpoise.

[0295] The SNP15 site is labeled T / G and is located at position 66317367 of the genome sequence of chromosome 17 of the Yangtze finless porpoise.

[0296] The SNP16 site is labeled as G / A and is located at position 33806104 of the genome sequence of chromosome 18 of the Yangtze finless porpoise.

[0297] The SNP17 site is labeled T / C and is located at position 31038355 of the X chromosome genome sequence of the Yangtze finless porpoise.

[0298] The SNP18 site is labeled C / T and is located at position 33057094 of the X chromosome genome sequence of the Yangtze finless porpoise.

[0299] The SNP19 site is labeled G / T and is located at position 37770280 of the X chromosome genome sequence of the Yangtze finless porpoise.

[0300] The competitive allele-specific PCR amplification reaction system in this application is 5 μl, specifically including: 1.25 μl of DNA, 2.5 μl of 2xKASP Master mix (LGC Genomics Ltd) and 1.25 μl of KASP primer mixture;

[0301] The above competitive allele-specific PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing at 61-55℃ for 60 s, with the temperature decreasing by 1℃ per cycle, for 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 60 s, for 27 cycles, with a final reading at 25℃ for 30 s. The PCR amplification reaction conditions are shown in Table 1.

[0302] Table 1. Conditions for competitive allele-specific PCR amplification reaction

[0303]

[0304] The primers used to amplify the above-mentioned SNP molecular markers of the Yangtze finless porpoise are as follows: Snpp01-03, Snpp04-06, Snpp07-09, Snpp10-12, Snpp13-15, Snpp16-18, Snpp19-21, Snpp22-24, Snpp25-27, Snpp28-30, Snpp31-33, Snpp34-36, Snpp37-39, Snpp40-42, Snpp43-45, Snpp46-48, Snpp49-51, Snpp52-54, and Snpp55-57. Each KASP primer combination is used to amplify the corresponding SNP molecular marker (Table 2).

[0305] Table 2. KASP primer combination sequence information for SNP sites SNP01~SNP19.

[0306]

[0307]

[0308]

[0309] The PCR amplification products were scanned using a fluorescence quantitative PCR instrument (CFX Connectiom fluorescence quantitative PCR detection system, Bio-Rad, USA) to analyze the PCR results and obtain the genotyping results and raw data of the genotyping map.

[0310] Example 1

[0311] The method for developing molecular markers for polymorphic SNPs in the Yangtze finless porpoise includes the following steps:

[0312] 1. Obtaining SNP molecular markers for Yangtze finless porpoises

[0313] This invention obtained a large number of SNP markers using high-quality chromosome-level genome data of the Yangtze finless porpoise and resequencing data from three geographical populations. The specific screening steps included: constructing a LobSTR reference index based on the Yangtze finless porpoise genome data using the lobstr_index.py script; aligning the resequencing data with the genome data and sorting the output BAM files using SAMtools software; using VCFtools (0.1.16) software to detect base variations and obtain potential SNP sites, while simultaneously identifying SNP sites that met the following criteria: a) sites with an average depth greater than or equal to 5 and a maximum depth less than or equal to 500; b) sites with a Phred-scaled quality score greater than or equal to 30; c) sites without deletions and with a quality value greater than 1000; d) sites with no other variations within 100 bp before and after the site; e) sites with low heterozygosity and uniform distribution on the chromosome; f) sites with a PIC value between 0.2 and 0.5 and exhibiting polymorphism in all individuals. A total of 1070 SNP sites were obtained through these screening criteria.

[0314] 2. Extraction of genomic DNA from the Yangtze finless porpoise

[0315] Genomic DNA was extracted from Yangtze finless porpoise samples using the QIAGEN DNeasy Blood & Tissue kit.

[0316] 3. Screening of polymorphic SNP molecular markers

[0317] Based on the principle of uniform distribution on chromosomes, 50 SNP sites were randomly selected from 1070 sites for first-generation sequencing verification to exclude false positive sites. Ultimately, 35 polymorphic SNP sites were preliminarily screened and retained. KASP primers were designed using Primer 3.0 software for the 150 bp upstream and downstream sequences of these 35 SNP sites. Each KASP primer combination consisted of two forward primers F1 (FAM) and F2 (VIC) with different terminal bases, and one reverse primer R. The 5' ends of the forward primers F1 (FAM) and F2 (VIC) were respectively linked to the universal fluorescent tags FAM:5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO:77) and VIC:5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO:78). Genomic DNA was extracted from 28 Yangtze finless porpoise samples as templates, and PCR amplification was performed using 35 pairs of KASP primers. The amplification steps are as follows:

[0318] (1): Construction of a competitive allele-specific PCR amplification system

[0319] All synthesized KASP primers were diluted to 10 μM using TE buffer (pH 8.0). The upstream genotyping primer F1, upstream genotyping primer F2, and downstream universal primer R were mixed in a 1:1:3 ratio and added to the instrument. 1.25 μL of primer mixture was added to every 5 μL of reaction system. The DNA samples were diluted to single digits according to the standard for the lowest concentration sample, and the entire batch of samples was diluted to ensure that each 5 μL of reaction system contained 1.2 μL of diluted DNA sample.

[0320] The total PCR reaction volume was 5 μl, specifically including: 1.25 μl of DNA, 2.5 μl of 2x KASPMaster mix (LGCgenomics Ltd), and 1.25 μl of KASP primer mixture (Nanjing Jisi Huiyuan Biotechnology Co., Ltd.). The PCR reaction plate was sealed, shaken, and centrifuged to ensure that the reaction system was mixed evenly (sealing film, Shanghai Sangon Biotech Co., Ltd., F600418-0001).

[0321] (2): After centrifugation, competitive allele-specific PCR amplification was performed. Touch-down PCR (61℃-55℃) using a universal fluorescent probe was used to achieve SNP biallelic genotyping. The reaction conditions are shown in Table 1.

[0322] (3): The PCR results were detected using a quantitative real-time PCR instrument (CFX Connectiom quantitative real-time PCR detection system, Bio-Rad, USA) to obtain raw data such as genotyping results and genotyping maps. The specific genotypes in the genotyping map are as follows: samples clustered near the X-axis represent alleles carrying the FAM fluorescent tag (red) sequence, samples clustered near the Y-axis represent alleles carrying the VIC fluorescent tag (blue) sequence; green circular dots at 45 degrees represent heterozygous genotypes (FAM / VIC), and black squares near the origin represent controls (NTC). Finally, 19 well-generated polymorphic SNP loci were screened out. These SNP loci and their corresponding primers, as well as the allele genotyping results in 28 Yangtze finless porpoise samples, are shown in Tables 3 and 4.

[0323] Table 3. Genomic location information and corresponding primer sequences of SNPs 01-19

[0324]

[0325]

[0326]

[0327] Table 4. KASP genotyping results of 19 SNP loci in 28 Yangtze finless porpoise samples.

[0328]

[0329]

[0330] 4. Genetic diversity analysis based on the development of SNP molecular markers

[0331] Based on whole-genome resequencing data from 125 samples of a natural population of Yangtze finless porpoises, this invention uses the HaplotypeCalle module in GATK7 software to detect variations in each sample. Subsequently, the generated gvcf files are merged using the CombineGVCFs tool, and combined genotyping is performed using the GenotypeGVCFs tool to finally generate vcf files. The genotype of each sample is determined based on the chromosomal location IDs of 19 polymorphic SNP loci. Then, the SNP genotyping data of all samples are converted to GenAlEx format, and genetic diversity indicators such as allele count (Na), effective allele count (Ne), observed heterozygosity (Ho), expected heterozygosity (He), and polymorphic information content (PIC) are calculated using GenAlEx software (version: 6.51b2).

[0332] The genetic diversity results of 125 Yangtze finless porpoise samples are shown in Table 5. The average effective allele count of the 19 loci was 1.811, the average observed heterozygosity was 0.375, the average expected heterozygosity was 0.441, and the average polymorphism information content was 0.343, indicating that the 19 SNP loci developed have a moderate degree of genetic polymorphism.

[0333] Table 5. Statistical analysis of genetic parameters of 19 SNP loci in 125 Yangtze finless porpoise samples.

[0334]

[0335]

[0336] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker for polymorphic SNPs in the Yangtze finless porpoise, characterized in that: The polymorphic SNP molecular markers of the Yangtze finless porpoise contain 19 SNP molecular markers, which include 19 SNP sites numbered SNP 01-19. The nucleotide sequences of the polymorphic SNP molecular markers of the Yangtze finless porpoise are shown in SEQ ID NO:1~SEQ ID NO:

19. The SNP01 site is labeled C / T and is located at position 501 of the SEQ ID NO:1 sequence; The SNP02 site is labeled A / G and is located at position 501 of the SEQ ID NO:2 sequence; The SNP03 site is labeled A / G and is located at position 501 of the SEQ ID NO:3 sequence; The SNP04 site is labeled T / C and is located at position 501 of the SEQ ID NO:4 sequence; The SNP05 site is labeled A / G and is located at position 501 of the SEQ ID NO:5 sequence; The SNP06 site is labeled G / A and is located at position 501 of the SEQ ID NO:6 sequence; The SNP07 site is labeled G / C and is located at position 501 of the SEQ ID NO:7 sequence; The SNP08 site is labeled C / A and is located at position 501 of the SEQ ID NO:8 sequence; The SNP09 site is labeled G / A and is located at position 501 of the SEQ ID NO:9 sequence; The SNP10 site is labeled T / C and is located at position 501 of the SEQ ID NO:10 sequence; The SNP11 site is labeled A / G and is located at position 501 of the SEQ ID NO:11 sequence; The SNP12 site is labeled T / G and is located at position 501 of the SEQ ID NO:12 sequence; The SNP13 site is labeled G / A and is located at position 501 of the SEQ ID NO:13 sequence; The SNP14 site is labeled A / C and is located at position 501 of the SEQ ID NO:14 sequence; The SNP15 site is labeled T / G and is located at position 501 of the SEQ ID NO:15 sequence; The SNP16 site is labeled G / A and is located at position 501 of the SEQ ID NO:16 sequence; The SNP17 site is labeled T / C and is located at position 501 of the SEQ ID NO:17 sequence; The SNP18 site is labeled C / T and is located at position 501 of the SEQ ID NO:18 sequence; The SNP19 site is labeled G / T and is located at position 501 of the SEQ ID NO:19 sequence.

2. A primer for amplifying the polymorphic SNP molecular marker of the Yangtze finless porpoise as described in claim 1, characterized in that, The primers include KASP primer combinations for 19 SNP sites, SNP01-19, numbered Snp 01-57. The nucleotide sequences of the two forward and one reverse primers of the KASP primer combination are shown in SEQ ID NO:20~SEQ ID NO:

76. Each KASP primer combination is used to amplify the corresponding SNP molecular marker.

3. The primer according to claim 2, characterized in that, Each KASP primer combination consists of two forward primers F1 and F2 with different terminal bases and one reverse primer R. The 5' ends of the forward primers F1 and F2 are respectively connected to the universal fluorescent tags FAM:5'-GAAGGTGACCAAGTTCATGCT-3' and VIC:5'-GAAGGTCGGAGTCAACGGATT-3'.

4. The application of the polymorphic SNP molecular marker of the Yangtze finless porpoise as described in claim 1, and the primer as described in claim 2 or 3, in the analysis of genetic diversity of the Yangtze finless porpoise.

5. The application according to claim 4, characterized in that, The specific operating steps are as follows: Step 1: Extract genomic DNA from Yangtze finless porpoise samples; Step 2: Using the genomic DNA of the Yangtze finless porpoise sample extracted in Step 1 as a template, a PCR amplification reaction system was prepared according to 19 SNP molecular markers, and PCR amplification was performed using the corresponding primers of the KASP primer combination. Step 3: Perform fluorescence scanning on the PCR amplification products obtained in Step 2, read and analyze the fluorescence signals, and thus obtain the genotyping results of the Yangtze finless porpoise sample at 19 SNP sites. Step 4: Genetic diversity parameters were calculated using GenAlEx software (version 6.51b2) based on the genotyping results of the Yangtze finless porpoise samples obtained in Step 3 at 19 SNP loci.

6. The application according to claim 5, characterized in that: The second step involves a 5 μl PCR amplification reaction system, specifically comprising: 1.25 μl of DNA, 2.5 μl of 2 x KASP Master mix, and 1.25 μl of KASP primer mixture. The PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing at 61-55℃ for 60 s, with the temperature decreasing by 1℃ per cycle, for a total of 10 cycles; 95℃ denaturation for 20 s, annealing at 55℃ for 60 s, for a total of 27 cycles, and finally reading at 25℃ for 30 s.

Images