Pork adulteration detection method

Abstract

The invention discloses a pork adulteration detection method which comprises the following steps: step 1, sample preparation: putting a prepared sample into a centrifugal tube filled with 1ml of lysis solution, and manually shaking up to enable the sample to be completely immersed in the solution; putting the test tube into a constant-temperature metal bath at a certain temperature, heating for 10 minutes, cooling to room temperature after heating, centrifuging, taking supernate, and diluting by 50-100 times; the method has the beneficial effects that an isothermal amplification fluorescence detection technology is adopted, and six specific primers are designed for specific DNA of pork to accurately detect the pork, so that the extraction method of nucleic acid is optimized, the sample treatment is simpler, the on-machine detection speed is higher, the detection efficiency is higher, and the detection time is shortened. Reagents used in the whole detection process are free of infectivity and toxicity and do not threaten the human body, the problems that in the current pork detection process, the detection cost is high, the detection time is long, the specificity is not high, and the sensitivity is not high are solved, and the large practical application value is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of food detection, and in particular to a method for detecting adulteration of pork. Background Art

[0002] "Food is the first necessity of the people, and food safety comes first." Due to the rapid changes in food recipes and eating habits, food safety has attracted great attention in today's world, and meat and meat products are favored by consumers. In order to reduce costs, some businesses take shortcuts and maliciously adulterate meat, such as using duck meat, chicken, etc. to impersonate pork or using artificial pork, water-injected pork and other meats as good ones. Meat food fraud is extremely harmful to consumers, causing economic losses to legitimate companies, and undermining consumers' trust in the food supply chain, causing great trouble to the country's food safety issues. Therefore, the development of a detection kit with high sensitivity and good specificity for detecting pork adulteration can bring convenience to adulteration detection and is an important technology for food safety detection.

[0003] Traditional identification methods for meat products mainly rely on sensory judgment and morphological examination. However, sensory judgment and morphological examination have great limitations. With the continuous development of technology, it has become difficult to identify meat adulteration only by sensory organs. Other detection methods for meat adulteration are based on proteins and nucleic acids. The main detection methods for proteins include enzyme-linked immunosorbent assay, spectroscopy, mass spectrometry, chromatography and electrophoresis. Since proteins are unstable and easily denatured during pretreatment or processing, the test results are inaccurate, with poor repeatability and low sensitivity. Nucleic acid amplification is an important tool in molecular biology research. Commonly used nucleic acid-based methods for detecting adulteration mainly include polymerase chain reaction (PCR), real-time fluorescence PCR, cross primer amplification (CPA), loop-mediated isothermal amplification (LAMP) and recombinase amplification (RPA), and digital PCR. PCR is a standard method for identifying meat adulteration.

[0004] At present, the main methods for detecting adulteration of pork are the traditional physical method of distinguishing different animal tissues by observing the particle morphology of meat samples under a microscope. This method has fewer false positives and better thermal stability, but the results of observation under a microscope are more affected by subjective factors, the resolution cannot be guaranteed, and it is impossible to effectively distinguish between animal species; red light illumination: shining red light on the meat makes it impossible to identify the color, which enhances the freshness of the meat and beautifies the appearance. If the meat is not fresh or the meat is injected with water, the color will become very good, and consumers will not be able to identify it at all. This practice is confusing to consumers; real-time fluorescence PCR technology can accurately determine the quality of meat and its products, but there are also many factors that affect its amplification efficiency, which causes the Ct value to change, thereby making the standard Deviations in the calibration curve ultimately lead to experimental errors; the biggest disadvantage of enzyme-linked immunosorbent assay for detecting meat adulteration is that the target protein required denatures during the heating process and cannot be detected by antibodies; recombinant enzyme isothermal amplification mainly uses recombinase polymerase technology in conjunction with fluorescent test strips to detect whether pork is adulterated, but the sample operation is relatively cumbersome and requires RPA reaction before detection; the pre-treatment process of mass spectrometry technology is cumbersome and cannot meet the needs of rapid detection; near-infrared spectroscopy technology has the advantages of high accuracy and fast detection speed, but it needs to establish corresponding models according to different samples, and the data usually obtained is huge, so it is troublesome to reduce the dimension of the data and extract useful information; the electronic nose is used in combination with statistical analysis to conduct qualitative and quantitative research on adulterated pork, but short circuits, line failures, and power outages may occur. Summary of the invention

[0005] The purpose of the present invention is to provide a method for detecting pork adulteration in order to solve the above-mentioned problem.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0007] A method for detecting adulteration of pork comprises the following steps:

[0008] Step 1: Sample preparation: Place the prepared sample in a centrifuge tube containing 1 ml of lysis solution, and shake it manually to make the sample completely immersed in the solution; place the test tube in a constant temperature metal bath at a certain temperature and heat it for 10 minutes, then cool it to room temperature, centrifuge it to obtain the supernatant, and dilute it 50-100 times to obtain the nucleic acid extract;

[0009] Step 2: Primer set preparation: prepare six specific primers according to the specific DNA in pork and set aside;

[0010] Step 3: Preparation of reaction solution: Prepare a specific amount of reaction solution according to the needs of pork testing and set aside;

[0011] Step 4: Mix the nucleic acid extract, primer set and reaction solution in clean eight-tubes respectively, and place the eight-tubes into the isothermal amplification fluorescence detection system GenieII for real-time amplification and detection. The detection results of pork are judged by observing the amplification curve and melting curve.

[0012] Furthermore, the determination method based on the amplification curve and melting curve test results is as follows: if the amplification curve has an obvious "S"-shaped curve and the melting curve has a single sharp peak, the test is determined to be pork, and the sample purity is highest if the peak time is within 20 minutes; the earlier the peak time, the higher the sample purity, and the later the peak time, the lower the sample purity; if the amplification curve does not have an obvious "S"-shaped curve, it is determined that the test sample is not pork or the pork content is extremely low; the negative control product should have no obvious amplification curve and melting curve, then this experiment is considered valid, otherwise this experiment is invalid.

[0013] Furthermore, when preparing the sample in step 1, a small piece of the sample to be tested is first taken, and a sample (about 3mmX3mm) is taken from the inside of the meat with a disposable blade, and then the sample is placed in a disposable culture dish, and the sample is chopped with a blade to prepare the sample.

[0014] Furthermore, the temperature of the constant temperature water bath in step 1 is 95°C.

[0015] Furthermore, the six specific primers in step 2 are: PG1-F3: ATATCGGAACAGACCTCGT; PG1-B3: CTCCTAGTAGGTCTGGTGAG; PG1-FIP: TAGGAGATGTACGGCTGCGACACACGAT; PG1-BIP: TCTTCGCCTT; PG1-LF: GAAACCGGATCCAACAACCCTGTGTAGT; PG1-LB: ATGGGTGAAATGGAA.

[0016] Furthermore, the reaction solution in step 3 was purchased from Mix reaction solution of Optigene Company, UK.

[0017] Furthermore, in step 4, when mixing the liquids, 15 μl of the reaction solution, 1 μl of each of the six primers, and 4 μl of each of the nucleic acid extracts are first added.

[0018] Furthermore, the amplification parameters in step 4 are: 65°C amplification for 30 minutes; melting curve temperature is 80-98°C; 0.05°C is one cycle.

[0019] Furthermore, the present invention simultaneously detects pork and similar meat sources such as donkey meat, goose meat, duck meat, and dog meat. The results show that only pork is specifically amplified, with the peak time within 20 minutes. Other samples are not amplified until one hour later and there is no specific curve, indicating that the system and primers used in the present invention only perform specific detection on pork.

[0020] The beneficial effects of the present invention are:

[0021] The present invention adopts isothermal amplification fluorescence detection technology and designs six specific primers for the specific DNA of pork to accurately detect pork. It not only optimizes the nucleic acid extraction method, makes sample processing simpler, and makes the machine detection speed faster and the detection efficiency higher, but also the reagents used in the whole detection process are non-infectious and non-toxic and will not pose a threat to the human body. It overcomes the problems of high detection cost, long detection time, low specificity and low sensitivity in the current pork detection process, and has great practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is an "S" type amplification curve diagram of isothermal amplification fluorescence detection in a pork adulteration detection method according to the present invention;

[0023] Figure 2 This is a melting curve diagram of isothermal amplification fluorescence detection in the pork adulteration detection method described in the present invention. DETAILED DESCRIPTION

[0024] A method for detecting adulteration of pork comprises the following steps:

[0025] Step 1: Sample preparation: Place the prepared sample in a centrifuge tube containing 1 ml of lysis solution, and shake it manually to make the sample completely immersed in the solution; place the test tube in a constant temperature metal bath at a certain temperature and heat it for 10 minutes, then cool it to room temperature, centrifuge it to obtain the supernatant, and dilute it 50-100 times to obtain the nucleic acid extract;

[0026] Step 2: Primer set preparation: prepare six specific primers according to the specific DNA in pork and set aside;

[0027] Step 3: Preparation of reaction solution: Prepare a specific amount of reaction solution according to the needs of pork testing and set aside;

[0028] Step 4: Mix the nucleic acid extract, primer set and reaction solution in clean eight-tubes respectively, and place the eight-tubes into the isothermal amplification fluorescence detection system GenieII for real-time amplification and detection. The detection results of pork are judged by observing the amplification curve and melting curve.

[0029] In this embodiment, the determination method based on the amplification curve and the melting curve test results is as follows: if the amplification curve has an obvious "S"-shaped curve and the melting curve has a single sharp peak, the test is determined to be pork, and the sample purity is the highest if the peak time is within 20 minutes; the earlier the peak time, the higher the sample purity, and the later the peak time, the lower the sample purity; if the amplification curve does not have an obvious "S"-shaped curve, it is determined that the test sample is not pork or the pork content is extremely low; the negative control product should have no obvious amplification curve and melting curve, then this experiment is considered valid, otherwise this experiment is invalid.

[0030] In this embodiment, when preparing the sample in step 1, a small piece of the sample to be tested is first taken, and a sample (about 3mmX3mm) is taken from the inside of the meat with a disposable blade, and then the sample is placed in a disposable culture dish, and the sample is chopped with a blade to prepare the sample.

[0031] In this embodiment, the temperature of the constant temperature water bath in step 1 is 95°C.

[0032] In this embodiment, the six specific primers in step 2 are: PG1-F3: ATATCGGAACAGACCTCGT; PG1-B3: CTCCTAGTAGGTCTGGTGAG; PG1-FIP: TAGGAGATGTACGGCTGCGACACACGAT; PG1-BIP: TCTTCGCCTT; PG1-LF: GAAACCGGATCCAACAACCCTGTGTAGT; PG1-LB: ATGGGTGAAATGGAA.

[0033] In this embodiment, the reaction solution in step 3 was purchased from Mix reaction solution of Optigene Company, UK.

[0034] In this embodiment, when mixing the liquids in step 4, 15 μl of the reaction solution, 1 μl of each of the six primers, and 4 μl of each of the nucleic acid extracts are first added.

[0035] In this embodiment, the amplification parameters in step 4 are: 65°C amplification for 30 minutes; melting curve temperature is 80-98°C; 0.05°C is one cycle.

[0036] In this embodiment, the present invention simultaneously detects pork and similar meat sources such as donkey meat, goose meat, duck meat, and dog meat. The results show that only pork is specifically amplified, with the peak time within 20 minutes. Other samples are not amplified until one hour later and there is no specific curve, indicating that the system and primers used in the present invention only perform specific detection on pork.

[0037] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for detecting adulteration of pork, characterized in that: It includes the following steps: Step 1: Sample preparation: Place the prepared sample in a centrifuge tube containing 1 ml of lysis solution, and shake it manually to make the sample completely immersed in the solution; place the test tube in a constant temperature metal bath at a certain temperature and heat it for 10 minutes, then cool it to room temperature, centrifuge it to obtain the supernatant, and dilute it 50-100 times to obtain the nucleic acid extract; Step 2: Primer set preparation: prepare six specific primers according to the specific DNA in pork and set aside; Step 3: Preparation of reaction solution: Prepare a specific amount of reaction solution according to the needs of pork testing and set aside; Step 4: Mix the nucleic acid extract, primer set and reaction solution in clean eight-tubes respectively, and place the eight-tubes into the isothermal amplification fluorescence detection system GenieII for real-time amplification and detection. The detection results of pork are judged by observing the amplification curve and melting curve.

2. A method for detecting adulteration of pork according to claim 1, characterized in that: When preparing the sample in step 1, a small piece of the sample to be tested is first taken, and a sample (about 3mmX3mm) is taken from the inside of the meat with a disposable blade, and then the sample is placed in a disposable culture dish, and the sample is chopped with a blade to prepare the sample.

3. A method for detecting adulteration of pork according to claim 1, characterized in that: The temperature of the constant temperature water bath in step 1 is 95°C.

4. A method for detecting adulteration of pork according to claim 1, characterized in that: The six specific primers in step 2 are: PG1-F3: ATATCGGAACAGACCTCGT; PG1-B3: CTCCTAGTAGGTCTGGTGAG; PG1-FIP: TAGGAGATGTACGGCTGCGACACACGAT; PG1-BIP: TCTTCGCCTT; PG1-LF: GAAACCGGATCCAACAACCCTGTGTAGT; PG1-LB: ATGGGTGAAATGGAA.

5. A method for detecting adulteration of pork according to claim 1, characterized in that: The reaction solution in step 3 was purchased from Mix reaction solution of Optigene Company, UK.

6. A method for detecting adulteration of pork according to claim 1, characterized in that: In step 4, when mixing the liquids, 15 μl of the reaction solution, 1 μl of each of the six primers, and 4 μl of each of the nucleic acid extracts are first added.

7. A method for detecting adulteration of pork according to claim 1, characterized in that: The amplification parameters in step 4 are: 65° C. amplification for 30 minutes; melting curve temperature of 80-98° C.; 0.05° C. as one cycle.

Images