A SNP molecular marker, primer and application related to sperm linear motion after frozen and thawed chicken semen

Abstract

The present invention relates to the field of genetic breeding technology, and specifically discloses a SNP molecular marker, primer, and application related to linear motility of sperm after cryopreservation and thawing of chicken semen. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the 53rd position in the SNP molecular marker is a SNP site, which has a G / A polymorphism. The SNP molecular marker provided by the present invention has a SNP site at position 53, which has a G / A polymorphism. The proportion of linearly motile sperm in semen of individuals with a GA genotype after cryopreservation and thawing of semen is higher than the proportion of linearly motile sperm in semen of individuals with an AA genotype after cryopreservation and thawing of semen.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic breeding, and in particular to a SNP molecular marker, a primer and an application thereof related to the linear motion of sperm after cryopreservation and thawing of chicken semen. Background Art

[0002] Chicken semen is the carrier of genetic material from male chickens. Through artificial insemination or natural mating, sperm enters the reproductive system of a hen and fertilizes the hen's eggs. During this process, the rooster's superior genes, such as those associated with rapid growth, good meat quality, high egg production, and strong disease resistance, are passed on to the next generation. Precise genetic selection is achieved through the use of chicken semen. Therefore, semen quality, morphology, and other related traits directly influence the genetic selection of chickens. The role of chicken semen in breed improvement is crucial. By crossbreeding rooster semen with superior traits with hens, the advantages of both can be combined to create a more competitive new breed. Semen quality influences the reproductive rate of the hybrid.

[0003] Chicken semen cryopreservation is a common practice in breeding and germplasm conservation. Long-term preservation of chicken eggs is difficult in germplasm conservation efforts, but breakthroughs in chicken semen cryopreservation technology provide a crucial safeguard for the long-term safety of chicken germplasm. For rare and endangered chicken breeds, timely collection and cryopreservation of semen can prevent the loss of superior genes due to breed extinction, laying the foundation for subsequent breed restoration and genetic improvement. Semen dilution and storage are crucial steps in artificial insemination for chickens. Cryopreservation of chicken semen increases the time and range of semen use, reduces the number of breeding roosters kept, lowers breeding costs, improves the utilization rate of breeding roosters, and facilitates the sharing of high-quality breeding roosters. Cryopreserved chicken semen can be retrieved and used at any time, without time or space constraints. This provides greater flexibility and choice in poultry breeding. Breeders can select appropriate frozen semen for artificial insemination based on their breeding goals and plans, accelerating the development of superior breeds and improving poultry performance and quality.

[0004] In the practice of artificial insemination of chickens, the quality of semen after cryopreservation and thawing is directly related to reproductive efficiency. Using sperm with good morphology for artificial insemination can reduce the amount of semen required for each insemination. Because these sperm have strong motility and fertilizing ability, they can achieve higher fertilization rates at lower sperm concentrations. This is very important for the efficient use of semen from high-quality breeders, especially for those rare breeds or breeds with high economic value, as it can expand the breeding scale while reducing the cost of semen collection and processing. However, the morphological characteristics of sperm after cryopreservation and thawing directly affect its subsequent reproductive rate, so it is very important to genetically select for relevant traits of chicken semen after cryopreservation and thawing.

[0005] The female reproductive tract of chickens is complex. After natural mating or artificial insemination, sperm must swim within the reproductive tract to reach the fertilization site in the oviduct. If sperm can maintain linear motion after freezing and thawing, they can more effectively traverse the mucus layer and tortuous tubes within the reproductive tract. Sperm moving in a straight line can efficiently advance along the shortest path, increasing their chances of encountering the egg and thus improving the success rate of fertilization. In situations where many sperm compete for fertilization, sperm with linear motion have an advantage. When chicken semen is frozen and thawed, sperm motility and motility decrease overall. However, sperm with linear motion can swim towards the egg in a more direct manner within a limited timeframe. Compared to sperm with chaotic motion, sperm with linear motion are more likely to penetrate the cell layer surrounding the egg, complete fertilization, and improve fertilization rates. Therefore, developing a molecular marker for linear motion in chicken sperm is of great significance for chicken breeding. Summary of the Invention

[0006] To develop a molecular marker related to the linear motility trait of chicken sperm, the present invention provides a SNP molecular marker, primers, and applications related to the linear motility of sperm in chicken semen after cryopreservation and thawing. The SNP molecular marker provided by the present invention contains a SNP site at position 53, designated as the g.81248596G / A site, which exhibits a G / A polymorphism. The proportion of linearly motile sperm in semen from individuals with the GA genotype after cryopreservation and thawing is higher than that in individuals with the AA genotype after cryopreservation and thawing, indicating that sperm motility in individuals with the GA genotype after cryopreservation and thawing is significantly higher than that in individuals with the AA genotype, which is of great significance for the sub-breeding of Xiaoshan chickens.

[0007] The present invention provides a SNP molecular marker related to the linear motility of sperm after cryopreservation and thawing of chicken semen. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. The 53rd position in the SNP molecular marker is a SNP site, and the site has a G / A polymorphism.

[0008] The SNP molecular marker related to linear motility of sperm after cryopreservation and thawing of chicken semen provided by the present invention has a G / A polymorphism at position 53. The proportion of sperm with linear motility in individuals with the GA genotype after cryopreservation and thawing of semen is higher than that in individuals with the AA genotype after cryopreservation and thawing of semen. The marker can be used to select individuals with high sperm motility after cryopreservation and thawing. The molecular marker is closely related to the freezing resistance of chicken sperm. The sperm functional ability of individuals with the GA genotype after cryopreservation and thawing of semen is significantly higher than that of individuals with the AA genotype, which is of great significance to the sub-breeding of Xiaoshan chickens.

[0009] The present invention also provides a pair of primers, including a forward primer shown in SEQ ID NO.2 and a reverse primer shown in SEQ ID NO.3, which are used to amplify SNP molecular markers related to sperm linear motility after frozen and thawed chicken semen.

[0010] The present invention also provides a kit containing the primer.

[0011] Furthermore, the kit also includes PCR Mix reagent and double-distilled water.

[0012] The present invention also provides an early breeding selection method for sperm after frozen and thawed chicken semen, which performs early breeding based on the genotype of SNP molecular markers related to the linear motion of sperm after frozen and thawed chicken semen, and selects chicken individuals with a genotype of GA at the g.81248596G / A site as individuals for subsequent breeding.

[0013] Furthermore, the chicken breed is Xiaoshan chicken.

[0014] The present invention also provides an application of the SNP molecular marker related to sperm linear motion after frozen and thawed chicken semen or the primer in Xiaoshan chicken genetic breeding.

[0015] Furthermore, genomic DNA from the in vitro venous blood of Xiaoshan chicken was extracted as a template, and PCR amplification was performed using the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3. The amplified products were sequenced and analyzed, and individuals with the GA genotype at the g.81248596G / A site were selected as breeding individuals. Continuous subculture and selection were used to increase the proportion of linear movement of sperm after cryopreservation and thawing of Xiaoshan chicken semen, thereby improving the semen performance of Xiaoshan chicken.

[0016] Furthermore, Xiaoshan chickens were selected at 145 to 155 days of age.

[0017] Furthermore, the PCR amplification program is: pre-denaturation at 97.5°C to 98.5°C for 2 minutes to 2.5 minutes; denaturation at 97.5°C to 98.5°C for 10 seconds to 12 seconds; annealing at 59.5°C to 60.5°C for 30 seconds to 31 seconds; extension at 72°C to 72.5°C for 1 minute to 1.5 minutes; 33 cycles; then extension at 72°C to 72.5°C for 5 minutes to 5.5 minutes; and storage at 4°C to 6°C.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The SNP molecular marker provided by the present invention has a SNP site at position 53, which is recorded as the g.81248596G / A site. There is a G / A polymorphism at the site. The proportion of linear motion sperm in individuals with the GA genotype after semen cryopreservation and thawing is higher than that in individuals with the AA genotype after semen cryopreservation and thawing. Through analysis, it was found that in the purebred Xiaoshan chicken population, the proportion of linear motion sperm in individuals with the GA genotype at the g.81248596G / A site was increased by an average of 13.21% compared with individuals with the AA genotype after semen cryopreservation and thawing. In Xiaoshan chickens, successive breeding of the GA genotype at the g.81248596G / A site can gradually increase the proportion of linear motion sperm in Xiaoshan chicken semen after cryopreservation and thawing, thereby achieving the purpose of improving the semen performance of Xiaoshan chickens. It is of great significance to the successive breeding of Xiaoshan chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 The distribution of significance thresholds for genome-wide association analysis of sperm linear motility traits in Xiaoshan chicken semen after cryopreservation and thawing. Blue dots indicate that the significance thresholds exceeded.

[0022] Figure 2 This is the electrophoresis diagram of the amplified products of the Xiaoshan chicken population.

[0023] Figure 3 This is the peak diagram of DNA sequencing results for different genotypes at the g.81248596G / A site. DETAILED DESCRIPTION

[0024] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0025] Example 1: Development of a SNP molecular marker related to sperm linear motility after cryopreservation and thawing of semen.

[0026] 1. Source of experimental animals and blood collection

[0027] The study involved 102 180-day-old Xiaoshan chickens from the Xiaoshan Chicken Breeding Resource Farm in Zhejiang Province. Roosters were housed in three-tiered cages with air conditioning, independent ventilation, and nipple-based watering. Feed was provided daily between 8:00 and 9:00 AM. At approximately 150 days of age, 5 mL of blood was collected from the subwing vein of the roosters using EDTA-anticoagulant tubes for DNA extraction.

[0028] 2. Extraction of Xiaoshan chicken genomic DNA

[0029] Extract DNA using the high salt method:

[0030] (1) Digestion: 30 μL of anticoagulated blood was added to a 2 mL centrifuge tube, and 600 μL of lysis buffer was added and mixed. The lysis buffer was a mixture of 50 mM Tris-Cl and 10 mM EDTA, pH 8.0. Then, 30 μL of 10 μg / μL proteinase K was added and mixed. The tube was placed in a 56°C water bath for digestion for 12 hours.

[0031] (2) Salting out: Add 600 μL of 6 M saturated sodium chloride and 600 μL of chloroform to the above mixture, shake thoroughly for 10 minutes, and centrifuge at 12,000 rpm for 5 minutes.

[0032] (3) Ice precipitation: Take the supernatant and place it in a new 2 mL centrifuge tube. Add 600 μL of 90% ethanol that has been pre-cooled on ice, mix well, and shake gently to separate the white precipitate.

[0033] (4) Use a sterile pipette tip to pick up the white precipitate, add 600 μL of 70% ethanol to wash, pour off the ethanol, and let it dry naturally.

[0034] (5) After the ethanol has completely evaporated, add 500 μl of ddH20.

[0035] (6) Cover the tube and store at 56°C for 2 hours. Then, store the DNA in a -4°C refrigerator.

[0036] 3. Semen collection and characterization

[0037] Semen was collected from roosters at 180 days of age using abdominal massage. Semen was collected in sterile cryotubes, diluted with diluent and preservative, and stored in liquid nitrogen. After 7 days of cryopreservation, the semen was thawed at 4°C and sperm motility was measured using a sperm analyzer.

[0038] 4. Chicken whole genome SNP genotype detection

[0039] The DNA of the above individuals was genotyped using the chicken genome GRCg6a version "Jingxin No. 1" 55K chip on the Illumina sequencing platform according to the company's standard process. The chip genotype data were quality controlled using Plink (V1.90b) software, using the --geno 0.1 --maf 0.01 --mind 0.1 parameters for quality control. 45,262 SNPs were obtained. A genome-wide association analysis of sperm linear motility traits after semen cryopreservation and thawing was performed using a single-trait mixed linear model (LMM) using GEMMA (V0.98.5) software (https: / / github.com / genetics-statistics / GEMMA / releases). In this model, SNPs were used as fixed factors and additive effects as random effects. The chromosome-level significance threshold was 2.21×10 -5 (1 / 45262).

[0040] Finally, we obtained 2 SNPs that were significantly correlated with the linear motility of sperm after cryopreservation and thawing. Figure 1 The P value of the g.81248596G / A site at position 81248596 on chromosome Z of the chicken reference genome GRCg6a was 8.75×10 -6 The SNP GA genotype showed an average linear motility ratio of 23.77±14.24% in sperm frozen and thawed, while the AA genotype showed an average linear motility ratio of only 10.56±6.31%.

[0041] Example 2: SNP site verification and application.

[0042] The above g.81248596G / A site was verified in the Xiaoshan chicken population.

[0043] 1. Extraction of Xiaoshan Chicken Genomic DNA

[0044] Subwing venous blood samples were collected from 96 purebred Xiaoshan chickens to accurately measure sperm motility phenotypes after cryopreserved and thawed semen. Blood samples were collected in EDTA anticoagulant tubes and stored at 4°C until use. Genomic DNA from the blood was extracted using the above method, tested for quality and concentration, and diluted to 30 ng / μL before being stored at -20°C until use.

[0045] 2. PCR amplification and sequencing of target fragments

[0046] The following primers were designed using NCBI Primer-BLAST using the reference sequence of 81248296 bp to 81248896 bp of the chicken GRCg6a reference genome chromosome Z as a template.

[0047] Forward primer (5'-3'): ATGATTCTGTGGAGTGTACCCAAGC (SEQ ID NO. 2).

[0048] Reverse primer (5'-3'): GGGCTGCAAGTTGTGATGCATAG (SEQ ID NO. 3).

[0049] Using the extracted DNA as a template, PCR amplification was performed according to the designed primers. A 20uL PCR reaction system was used: 1μL DNA template, 0.8μL each of forward primer and reverse primer, 10μL PCR Mix reagent, and 7.4μL double-distilled water. The PCR Mix reagent was produced by Servicebio, the product name is 2×Fast Pfus PCR Master Mix, item number: G3305-05. The PCR amplification program was: pre-denaturation at 98℃ for 2min; denaturation at 98℃ for 10s; annealing at 60℃ for 30s; extension at 72℃ for 1min; 33 cycles; then extension at 72℃ for 5min; storage at 4℃. The PCR product was detected by electrophoresis in a 1.2% agarose gel. The size of the amplified target fragment was 203bp. The target fragment sequence is shown in SEQ ID NO.1. The electrophoresis diagram is shown in Figure 2 .

[0050] SEQ ID NO.1:

[0051]

[0052] The double underline in SEQ ID NO.1 is the g.81248596G / A site, which has G / A polymorphism. The proportion of linear motile sperm in semen of individuals with GA genotype after cryopreservation and thawing is higher than that in individuals with AA genotype after cryopreservation and thawing.

[0053] The remaining amplified products were sequenced and the sequencing results were compared and analyzed with the relevant chicken gene fragment sequences in GenBank using SnapGene software. The g.81248596G / A site was located at position 53 of the sequence and there was a G / A polymorphism at this site. The genotype of the g.81248596G / A site was determined ( Figure 3 ) were then used to analyze the effect of genotype on phenotype using R (version 4.3.1). The analytical model was Y = μ + P + G + e; where Y represents the linear motility phenotype of Xiaoshan chicken semen after cryopreservation and thawing; G represents the genotype fixed effect of the SNP; P represents the random effect of pen position; and e represents the residual error. Significant P values were corrected for 10,000 random sampling errors.

[0054] Table 1 shows the effect of the g.81248596G / A mutation on the linear motility phenotype of sperm after cryopreserved and thawed semen in a purebred Xiaoshan chicken population. As shown in Table 1, individuals with the GA genotype at the g.81248596G / A locus in the purebred Xiaoshan chicken population had an average 13.21% higher proportion of linearly motile sperm after cryopreserved and thawed semen compared to individuals with the AA genotype. This suggests that successive breeding of the GA genotype at the g.81248596G / A locus in Xiaoshan chickens can gradually increase the proportion of linearly motile sperm after cryopreserved and thawed semen, thereby improving semen performance in Xiaoshan chickens.

[0055] Table 1g. Correlation analysis between the 81248596G / A locus and the linear motility phenotype of sperm after cryopreservation and thawing of Xiaoshan chicken semen

[0056]

[0057] In summary, the SNP molecular markers provided by the present invention can be used to select sperm with a high proportion of linear motility sperm after cryopreservation and thawing of Xiaoshan chicken semen, thereby improving breeding efficiency.

[0058] Although preferred embodiments of the present invention have been described, additional changes and modifications to these embodiments may occur to those skilled in the art once the basic inventive concepts become known.

[0059] Obviously, those skilled in the art may make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if such modifications and variations fall within the scope of the claims and their equivalents, the present invention is intended to include such modifications and variations.

Claims

1. The use of a reagent for detecting SNP molecular markers in detecting the linear motion of sperm after cryopreservation and thawing of chicken semen, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The 53rd position in the SNP molecular marker is a SNP site, which has a G / A polymorphism. The chicken reference genome is version GRCg6a.

2. The use of the reagent for detecting SNP molecular markers according to claim 1 in detecting the linear motion of sperm after cryopreservation and thawing of chicken semen, characterized in that: The reagents include a forward primer shown in SEQ ID NO.2 and a reverse primer shown in SEQ ID NO.

3.

3. A primer pair, characterized in that: It comprises a forward primer shown in SEQ ID NO. 2 and a reverse primer shown in SEQ ID NO. 3, and the primer pair is used to amplify the SNP molecular marker described in claim 1.

4. A detection kit comprising the primer according to claim 3, characterized in that: Also includes PCR Mix reagents and double-distilled water.

5. A method for early breeding selection of sperm after cryopreservation and thawing of chicken semen, characterized in that: Based on the genotype of the SNP molecular marker related to sperm linear motion after the frozen and thawed chicken semen according to claim 1, early breeding is performed, and chicken individuals with a genotype of GA at the g.81248596G / A locus are selected as succession breeding individuals; The chicken reference genome is version GRCg6a.

6. The method for early breeding and selection of sperm after cryopreservation and thawing of chicken semen according to claim 5, characterized in that: The chicken breed is Xiaoshan chicken.

7. Application of a reagent for detecting SNP molecular markers in genetic breeding of Xiaoshan chicken, characterized in that: The detection reagents are the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3; The chicken reference genome is version GRCg6a.

8. The use according to claim 7, characterized in that Genomic DNA was extracted from the in vitro venous blood of Xiaoshan chickens and used as a template. PCR amplification was performed using the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.

3. The amplified products were sequenced and analyzed. Individuals with the GA genotype at the g.81248596G / A locus were selected as breeding individuals. Continuous subgeneration and selection were performed to increase the proportion of linear motile sperm in Xiaoshan chicken semen after cryopreservation and thawing, thereby improving the semen performance of Xiaoshan chickens.

9. The use according to claim 8, characterized in that Xiaoshan chickens are selected at 145 to 155 days of age.

10. The use according to claim 8, characterized in that The PCR amplification program was as follows: pre-denaturation at 97.5°C–98.5°C for 2–2.5 min; denaturation at 97.5°C–98.5°C for 10–12 s; annealing at 59.5°C–60.5°C for 30–31 s; extension at 72°C–72.5°C for 1–1.5 min; 33 cycles; then extension at 72°C–72.5°C for 5–5.5 min; and storage at 4–6°C.

Images