Universal primer for detecting mannheimia haemolytica and detection system thereof
By designing a new primer combination based on highly conserved regions, the specificity, sensitivity and universality of the detection of hemolytic Manzili in the prior art was solved, and a more efficient and accurate detection effect was achieved.
Patent Information
- Application Number
- CN202510182912.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-19
- Publication Date
- 2025-04-11
AI Technical Summary
The prior art lacks specific PCR methods for hemolytic Manzili with strong specificity, high sensitivity and better versatility, resulting in limited detection accuracy and coverage.
A new universal primer combination was designed to identify highly conserved regions through extensive sequencing analysis and alignment of bioinformatics tools, and a novel primer combination with high versatility, specificity and sensitivity was designed based on these conserved regions.
The stable and consistent amplification effect of a variety of hemolytic Manzili strains was achieved, which improved the coverage and accuracy of the detection, and enhanced the detection sensitivity of low-concentration template DNA.
Smart Images
Figure CN119799933A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of pathogenic bacteria detection, and in particular to a universal primer for detecting hemolytic Mannheimia and a detection system thereof. Background Art
[0002] Mannheimia haemolytica (Mh) is a conditionally pathogenic bacterium that usually colonizes the upper respiratory tract of ruminants such as cattle and sheep. Under stressful conditions, it can cause a variety of diseases such as bovine respiratory disease syndrome, sheep pneumonia, and acute sepsis in newborn lambs, causing significant economic losses to the breeding industry.
[0003] In order to conduct accurate epidemiological surveys, laboratory diagnosis, and pathogen detection and identification of Mannheimia haemolytica, various PCR methods have been established based on target genes such as lktD, rpt2, phssa, gcp, artJ-lktC, and 16S rRNA at home and abroad, and have been applied in laboratory detection and clinical diagnosis. The three methods based on gcp, phssa, and lktD genes are only specific to the genus Mannheimia, but not specific to Mannheimia haemolytica. In addition, the common PCR methods based on gcp and lktD genes usually have non-specific amplification of Pasteurella multocida, Escherichia coli, etc. Although the three methods of 16Sr RNA-PCR, artJ-lktC-PCR, and rpt2-PCR are specific to Mannheimia haemolytica, they are not very versatile. Therefore, further research and development of a specific PCR method for Mannheimia haemolytica with strong specificity, high sensitivity, and better versatility is needed. Summary of the invention
[0004] The present invention aims to provide a universal primer for detecting Mannheimia haemolytica, so as to solve the technical problem that the prior art lacks a Mannheimia haemolytica-specific PCR method with strong specificity, high sensitivity and better versatility.
[0005] In order to achieve the above object, the present invention adopts the following technical scheme:
[0006] A universal primer for detecting Mannheimia hemolytica comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5, and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.6 or SEQ ID NO.7.
[0007] Further, it includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.6; or includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.4 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.6; or includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.7.
[0008] Furthermore, it is composed of a forward primer having a nucleotide sequence as shown in SEQ ID NO.4 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.6.
[0009] Furthermore, the reaction system is used for gene amplification; the reaction system includes a forward primer, a reverse primer, a DNA template and an rTaq PCR reaction mixture.
[0010] Furthermore, the reaction system consisted of 8.5 μL double distilled water, 0.5 μL forward primer, 0.5 μL reverse primer, 3 μL DNA sample and 12.5 μL rTaq PCR reaction mixture.
[0011] Further, the working procedure of the reaction system is:
[0012] S1 initial denaturation: place the reaction system at 94°C for 3 min;
[0013] S2 cycle stage: the reaction system was subjected to denaturation treatment at 94°C for 30 s, annealing treatment at 55°C for 30 s, and extension treatment at 72°C for 90 s, and the above sequence was cycled 35 times;
[0014] S3 final extension: place the reaction system at 72°C for 5 min.
[0015] In summary, the principle and beneficial effects of this technical solution are:
[0016] When detecting Mannheimia haemolytica (Mh), using conventional universal primers for the Rpt2 gene in the prior art, some strains may be difficult to detect effectively. This phenomenon not only limits the comprehensiveness and accuracy of the detection, but also exposes the limitations of the original primers in terms of universality. In order to meet this challenge, the inventors conducted in-depth research and exploration, aiming to develop a more efficient and reliable detection method.
[0017] In preliminary studies, the inventors noticed that although the existing universal primers for the Rpt2 gene are theoretically suitable for a wide range of Mannheimia hemolytica detection, there are significant differences in actual application. Some strains were not successfully amplified or detected, suggesting that the existing primer design may not fully consider the genetic diversity between different strains. Further analysis showed that the design positions of these primers are located in the region with higher variability of the Rpt2 gene, rather than the conserved region, resulting in lower versatility when facing different strains.
[0018] To solve the above problems, the inventors conducted extensive sequencing analysis: a large number of Mannheimia haemolytica samples from different sources were collected and sequenced to ensure the representativeness and diversity of the data. Bioinformatics tools were used to compare the obtained sequences in detail to identify highly conserved regions. These conserved regions are ideal targets for primer design because they vary less between different strains and can ensure high versatility. Based on the information of the conserved regions, the inventors designed a series of candidate primers, applied the designed primers to PCR amplification experiments under laboratory conditions, and evaluated their actual performance. Through rigorous experimental verification and multiple rounds of screening, a set of new primer combinations with high versatility, specificity and sensitivity were finally determined.
[0019] The newly developed primer combination has the following significant advantages:
[0020] High versatility: It can achieve stable and consistent amplification effects in a variety of different strains of Mannheimia haemolytica, greatly improving the coverage of detection.
[0021] High specificity: By accurately matching the conserved regions, the mis-amplification of non-target sequences is avoided, ensuring the accuracy of the test results.
[0022] High sensitivity: Even for low concentrations of template DNA, it can provide reliable detection signals, enhancing the sensitivity of detection.
[0023] The universal primer combination of this protocol provides a powerful tool for basic research on Mannheimia hemolytica, which helps to gain a deeper understanding of the genetic characteristics of the pathogen and its pathogenic mechanism. In clinical settings, it can be used to quickly and accurately identify the source of infection, assist doctors in formulating treatment plans, and improve the treatment effect of patients. It can be used for large-scale screening and monitoring, timely grasp the dynamics of the disease, and provide a scientific basis for public health decision-making.
[0024] In summary, through systematic scientific research and technological innovation, the inventors have successfully overcome the limitations of traditional universal primers for the Rpt2 gene and developed a new set of primers with superior performance. This achievement not only improves the technical level of the detection of hemolytic Mannheimia, but also brings new possibilities for research and application in related fields. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 It is the nucleotide sequence of the mod-related region containing the CACAG repeat sequence in the prior art.
[0026] Figure 2 Schematic diagram of three sequencing of the Rpt2 locus sequence in Example 1 (the sequence between the upstream UbiA start codon and the downstream Mod gene stop codon, a total of 3203 bp, was intercepted for sequence design; the sequence comes from the Mh39433 genome, CP017484.1).
[0027] Figure 3 The results of the sequence comparison and analysis of the Rpt2 locus of 16 strains of Mh in Example 1 (the sequence length shown in the figure is 2065 bp, which is from Figure 3 The 3203bp sequence was extracted from the Mh39433 genome).
[0028] Figure 4 Schematic diagram of the binding site distribution of the new primers designed in Example 1 (using the sequence from the Mh39433 genome as a template).
[0029] Figure 5 Schematic diagram of the binding site distribution of the new primers designed in Example 1 (using the sequence from the Mh10208 genome as a template).
[0030] Figure 6 The results of the universality test of the three sets of primers in Example 2 (the lane marker numbers are the numbers of the 16 Mh genome samples preserved in the laboratory).
[0031] Figure 7 The specificity test results of the three groups of primers in Example 2 (A, C, and E are group a tests, and lanes 1-7 represent the amplification results of genomic DNA of Pasteurella multocida, Escherichia coli, Moraxella, Streptococcus, Acronis pyogenes, Staphylococcus aureus, and Mycoplasma pneumoniae in goats, respectively, and lanes 8 and 9 are the positive control and negative control, respectively; Figures B, D, and F are group b tests, and lanes 1-11 represent the amplification results of genomic DNA of 11 strains of Pasteurella multocida in the laboratory).
[0032] Figure 8 This is the sensitivity test result of primer 5F5R in Example 2. DETAILED DESCRIPTION
[0033] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used can be obtained from commercial sources.
[0034] Example 1: Design of new universal primers
[0035] Reggie YCLo et al. reported two loci containing CACAG repeat sequences in the genome of Mannheimia haemolytica (Mh bacteria) A1, and named them Rpt1 and Rpt2 respectively (Reggie YCLo, Characterization of a CACAGpentanucleotide repeat in Pasteurella haemolytica and its possible role inmodulation of a novel type III restriction-modification system. [J]. Nucleic acid research, 1999, 27 (6): 1505-1511.). The study cloned and characterized the locus carrying Rpt2 and found that the CACAG repeat sequence was located at the 5' end of the gene, which had homology with the mod gene of the type III restriction-modification system. Figure 1 As shown, the alternating reading frames are generated due to the change in the number of repeats. Specifically, Figure 1 The nucleotide sequence of the mod-associated region containing the CACAG repeat sequence is shown. The CACAG repeat sequence is underlined and the start codon of Mod is in bold. The first row of amino acid sequence shows the translation of the full-length Mod; -1 and -2 indicate the deletion of one or both copies of the repeat sequence (shaded), resulting in the generation of TAA stop codons at positions 2938 and 2961, respectively.
[0036] In 2010, A. Deressa et al. designed Mh identification primers for the Rpt2 target site (Forward: GTTTGTAAGATATCCCATTT, SEQ ID NO.1; Reverse: CGTTTTCCACTTGCGTGA, SEQ ID NO.2). They were first used in Ethiopia to detect clinical nasal swabs and lung samples (DERESSA A, ASFAW Y, LUBKE B. Molecular Detection of Pasteurella multocida and Mannheimia haemolytica in Sheep Respiratory Infections in Ethiopia [J]. Intern J Appl Res Vet Med, 2010, 8 (2): 101-108.). Jyoti Kumar et al. established a multiplex PCR method for detecting sheep lung samples. The method is based on the Mh1-specific antigen ssa1 gene, Rpt2 gene and sheep-specific 12S rRNA gene as non-competitive internal amplification controls. The Rpt2 amplification primers were designed based on A. Deressa (KUMAR J, DIXIT SK, KUMAR R. Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture. [J]. Veterinary world, 2015, 8 (9): 1073-1077.). The method was used to detect lung samples of sheep that died of pneumonia in Rajasthan, India, and was reported to have good specificity. Later, the method was reported to be used for the detection of clinical samples of cattle and sheep in Egypt, India, and Ethiopia.
[0037] Guo Juecen et al. first reported the application of Rpt2 primers in clinical testing (Guo Juecen. Comparison of PCR detection methods for hemolytic Mannheimia and investigation of Mannheimia infection in goats in five regions of Sichuan [D]. Southwest University for Nationalities, 2023.). The study pointed out that Rpt2 primers (SEQ ID NO.1 and SEQ ID NO.2) have good specificity and can only amplify hemolytic Mannheimia, but not Mannheimia glucoside, Mannheimia ruminantia, Pasteurella multocida, Mycoplasma ovipneumoniae, Mycoplasma mycoides, Streptococcus, Escherichia coli, Staphylococcus aureus, and Salmonella. However, Rpt2 primers have poor versatility and have no amplification for some Mh strains (4 / 14, 4 of 14 Mh strains tested negative). The document also states that the target gene for the primers designed by this method is Rpt2. Through bioinformatics analysis, it was found that although the primers are highly homologous to the target gene fragment of Mannheimia haemolytica, positive amplification can be achieved. However, since the Rpt2 gene itself is prone to mutation, which manifests as the deletion or insertion of small fragments, it is easy to cause the size of the amplified fragments to be different. This method can only amplify part of Mannheimia haemolytica, and the amplified fragments are inconsistent in size. This may lead to missed detection of Mannheimia haemolytica infection or misjudgment of the test results.
[0038] The inventors used the above Rpt2 primers to amplify Escherichia coli, Cryptococcus pyogenes, Staphylococcus aureus, Pasteurella multocida, and Mycoplasma capricolum, indicating that it has good specificity. In the universal test, the Rpt2 primers did not amplify some Mh strains (2 / 16, 2 of the 16 Mh strains tested negative).
[0039] The inventors characterized the Rpt2 locus in order to find its conserved region and design more universal primers for the detection of clinical samples. Figure 2 ), it clarified the reasons why the original Rpt2 primers (SEQ ID NO.1 and SEQ ID NO.2) had poor universality and different sizes of amplified products. Among them, the first sequencing was for the sequences between the original Rpt2 primers. The first sequencing clarified the reason why the original Rpt2 primers amplified different sizes of bands for different Mh strains: the number of repetitions of the repeating unit "GCACA" was different between strains. The repeated sequence is located at the F end of Rpt2 and has a high degree of variation. Therefore, it is speculated that the variation at the F end affects the universality of the original primer. Next, the F end of Rpt2 was sequenced for the second time. It was found that it was not the variation at the F end that affected the universality of the original primer, and the primer binding site at the F end of the original primer Rpt2 was relatively conservative. Next, the R end of Rpt2 was sequenced for the third time. It is clear that the variation at the R end affects the universality of the original Rpt2 primer, Figure 2The image on the lower left shows the BLSAT sequencing results of "the two strains Mh21 and Mh23 that could not be amplified by the original Rpt2 primer." The evolutionary relationship is clear, that is, the two strains that could not be amplified by the original Rpt2 primer are in the same unique branch as NCTC 10208.
[0040] like Figure 3 As shown in the figure, the Rpt2 primers (SEQ ID NO.1 and SEQ ID NO.2) are located in two variable regions, variable region A and variable region B; specifically, the forward primer of Rpt2 is located on the flank of the repeat unit (GCACA), which is highly conserved; while the reverse primer of Rpt2 is located in the variable region A with a higher degree of variation, and there is no conservative sequence >15bp within the range of about 400bp before and after it. The differences in the sequence of the Rpt2 loci of the Mh21 strain and the Mh23 strain that could not amplify the bands with the Rpt2 primer and the other 14 Mh strains are mainly concentrated in the R end of Rpt2, and the DNA sequences of Mh21 and Mh23 in this region are highly similar, indicating that they have a close evolutionary relationship. Further analysis showed that the Rpt2 loci of Mh21 and Mh23 had a DNA sequence homology of up to 98% with that of Mh NCTC 10208 strain (genebank: CP097335.1), while the homology with the rest of the Mh genome sequences in the NCBI database was only 10-12%, indicating that Mh21, Mh23 and NCTC 10208 belong to the same unique evolutionary branch.
[0041] According to the sequencing results, primers were designed using Mh NCTC 10208 (NCBI ACCESSION: CP097335) as a template. In order to design more universal primers for the detection of clinical samples, this study designed primers for the relatively conservative region of the Rpt2 locus based on the above Rpt2 locus sequence analysis results, and improved universality by degenerate 5' end bases. Among them, one of the template sequences of the Rpt2 locus used specifically (Mh39433 genome) is shown in SEQ ID NO.8 (3203 bp) (double underlines indicate the binding sites of the newly designed primers, 5R is used to bind to the 384-404 bp region of the sequence, 3R is used to bind to the 1954-1974 bp region of the sequence, 3F is used to bind to the 2263-2283 bp region of the sequence, 5F is used to bind to the 1431-1450 bp region of the sequence, and 7F is used to bind to the 1388-1407 bp region of the sequence; conventional Rpt2 primers in the prior art are represented by single underlines):
[0042] TTAAATCACAAAAAACGTAATGCCGGCATCTTGCATTTGCAATTCGGTGTTTTTCTTCCGGGCATCATTGCCGTTGAATAAACGGTCTAAAGCGATGACTTTTTTCGGTTGTTGAGCGATAACAGTTTGAATAATTTCTTCGTCGGCTGCATTTAACAGCAAGGCGAAAATCAGCCCGTTTTCTTCCACCCAAAACACCTTATTTTCCAACCGCACTTTTGCCGTGAGTTTTAACCCTAAACGCAATAAAAGCTCATATAAAACGGCTTGCGTATCCGCTTTTTCACTAACAGGATCAATAAACATTTCAAGTTGATCGGCTAAATTTTCAGATGTGGGCGATTGCCATTGTTTAAAATGGCTTTCTGTCAGTTTGAAGACTT TAAAACCTACATCAAGCGGTCGGTTTTCGGGGTTATTTTGCAAAATCTGCTTTCCGGCACGGCGAATACGTTCTTTTGAAATTTCAGTTATATATAGTGGTAAATTTTTTCTTTGGCAAAATTGCTTTGCTACTTTTCCATTCTTACTCTTGATATCAATTTCTTCAGGATATTGAACCGCAATAAATTTTCTATTACCCTTATCAATTCTATTACTTTCCAATATTGCGTGTGGAAATGATGAACTGCCAGCAAAGAAATCTAAAGAAATAAAATTTTTATCTTCAAATAGAGTTATTAAATGTCTTAAAAAATTAGGATTTTTAGGTGCAGAGAAAACAGGGAGTTTTGTTTCGAATAATTCTTTTAGCAGTGTTCCTGCCGAAGTTGTCTT AACATCTAGGGTGTAATTGGTTAAATTACCAGCCGAAACTGCTTTATAGTTTTTATTATTCAGTATACTTTTCATTCTTATAGTATCACTAAAGTTTTTTTCATAAATTTTATCTTCTGTGAATTCTAAAGATTCGTCTTCAAATAACTCAAGGAATTTAAATCTTGTGTATGTGTTTTCTACAAATTCATCATCAAAAAACGAAATATATCTTACATACCCTTGATTAATTAAATTTAAATCCTTATCATCAAGAGAATCTTCGAACTTTAAAATAATATCATCATCTAATTTATTAAAATAAACTGAATAGTGTTTATCTGAGGTAAAATCTGTTACAGGCTGATTAAATTTGTTTTCCCCAACTAATACT CGTTTTCCACTTGCGTGA ACATAATGTCCATTTTCATCTTGACACATATCCTTAGCATTTTTAGGAATATTTTCAACAAATTTCCCCATTTCTTTATTTTTAGCATAAATAATACAAATCATTACTTACAGAAATAAATTTAGAATTCTTTCTACCTTTCGGATTATTTTCAACTGATAATATGGCAACAAAATTCTCCTCCCCAAACACTTCATCACAAAGCAATTTCAGCTGTGCCTGTTCGTTATCATCAAT TGAAATAAAAATCACCCCGTCAT CACGCA GTAAATTTTTTGCG AGATGCAAACGAGGCAACATCATATTCAGCCAGTTACTGTGATAATGCCCATTTTCTTTGCTGTTACGAACAAAGGCTCGTTTCAATTTGCCGTGTTCATCAACGTCGCCCACTTTCTCCGCATAATCTGCTTTGGTATCGGCAAAACTGTCGTTATAAATAAAATCGTTGCCTGTATTGTATGGCGGGTCGATATAAATCATTTTGACCGAATTGAAGTAGGATTTTTGCAGGGCTTTTAATACATCTAAATTTTCACCCTCAATAAAGATATTCTGCGTATTTTCAAAATCCACACTCTCTTCCTCGCAAGGAGTGAGCGTTTTGCTGGTTGGGGTTTGTAAGGTTTGATAGGCTGTTGATTTTCCTGCCCAGTTTGAGCATATAGCGGTCAGGTTCGGTGGAAAAATTATCCGAAAAAAGTTGTTGGAATTTGTCGAAGTCGATTTTACCTTCGCTGAAAATTTCAGGTAAAAGGGATTTTAATTGAGAAAGTTGTTGATC TTTAAGCGAAAAGTT GGCAAG GCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTTTGGCATTGTAATGTCCCTTTTTTGAATGTCTACTACA AAATGGGATATTTTACAAAC CGATTGACTAATGAAGCAAGAATATAATTAACTACAACTGGATATATTTTACAAATTTCCCGATAAATTT CACCGCTTGT AGATAAAAACCATAGATAAAAAATAGGAGCTAAACATTTTTAGCCCCTACCGTCATCAGAAATAAATCCCGACTAAAATCGCCACGAACACACCTAAGCCGAAATAGTGGTTATTTAGAAACGCTTTAAAGCATTCGCTACGTTCTCTTTTTTTGGTCAGCCAACATTGGTAGATAAACAGCGTGGCACTTAAGGCTAATACGACAAAATAGCCGATGTGATAATCTTTTACCACGCCCAATAATCCCAATAAAATCAAGGTGATAAACTGTAATAACGCAATAATTTTATTATCGTATTGAGCGAATAAAATTGCAGTGGATTTAACTCCAATTCGTAAATCATCGTCACGATCAACCATTGCATATTGGGTGTCGTAGGCGACTGTCCACGCTAGATTGGCAAAAAACAGCAGCCAGCATTCAAGTGGAAGAGTTTCCGTTACCGCACCAAATGCCATCGGAATCGACCAACCGAATGCCATTCCAAGCACTACTTGTGGCAAGTGGGTAAAACGCTTCATAAAGGGATAAATCACCGCCAGAAAAACTGCCACAAAGGAAAGCAGAAACGCATAGCGGTTTAGCATTAAATCGAGCAGAAAAGCGAACAACAGCAAGATGGCAAAAATGACTTTTGCCTCAGTGGTGGTCACTCTGCCGGTAGCTAATGGGCGTTGAGAGGTGCGTTTAACGTGTCCGTCAATTTCTCTATCGGCATAATCATTAATCACACAACCTGCCGCACGCATAACGATTACCCCAAGGGTAAAAATGGCTAAAATCGCAACAGGCGGCATTCCCTCTGCGGCAATAAATAACGCCCATAGTGTGGGGTGTAATAATAATAACGTGCCGATGGGTTTATCGAAACGCATTAACTGGGCGTAGGCAATCCATTTTTGTTTAGAAAAAAGAGTTTCGTTATTCAT。
[0043] Among them, the second template sequence of the Rpt2 locus used specifically (Mh 10208 genome) is shown in SEQ ID NO.9 (3013 bp) (double underlines indicate the binding sites of the newly designed primers, 5R is used to bind to the 384-404 bp region of the sequence, 3R is used to bind to the 1798-1818 bp region of the sequence, 3F is used to bind to the 2072-2092 bp region of the sequence, 5F is used to bind to the 1275-1294 bp region of the sequence, and 7F is used to bind to the 1232-1251 bp region of the sequence):
[0044] TTAAATCACAAAAAACGTAATGCCGGCATCTTGCATTTGCAATTCGGTGTTTTTCTTCCGGGCATCATTGCCGTTGAATAAACTGTCTAAAGCGATGACTTTTTTCGGTTGTTTTGCGATCACCGTTTCAATCATTTCATCATTAATTTCAGAAAGCATTAAAGCGAAAATCAGCCCGTTTTCTTCCACCC AAAACATCTTATTTTCCAACTGCACTTTTGCCGTGAGTTTTAACCCTAAACGCAATAAAAGCTCGTATAATACAGCTTGTGTATCCGCTTTTTCACTAACAGGATCAATAAACATTTCCAGTTGATCGGCTAAATTTTCCACTGTGGGCGATTGCCATTGTTTAAAATGACTTTCGGTAAGTTTGAAGACTT TAAAACCTACATCAAGCGGTCGATTTTCGGGATTATTTTGCAAAATTTGTTTTCCTGCACGGCGAATGCGTTCTTTGGAAATTTCATGAATATAACGATAGCCAGATCTAAAAGCATCAGATGTTTCCGAAATTTCTTCCGGAAGCTGAACAGTAATATATTTTCTATGTCCATTATCATTAGCATTCATTTCCATTACTGCGTGTGCTGTTGTTCCACTACCACAGAAGAAATCCATTATTAAACTATCTTTCTCTGTAAAATGAAAAATGAGCTTTTGCAATAGCTCTATAGGCTTAATTGTTTCAAAACCATGTTCTTTTTGTAAAAGCTCAAATACCGTTGCTTTACCTAATTCACTTGTGCCTACAGTATCTGAAAAATTAATCCACAATGGATAATGACTGTCATTATTTTCATCTTTTTCATAAATT TTTTTATAAGGCTTATTTTTTTCTATGAAAATATCTCCAACCTCCACTAATTCATTTGTATTTTGTTCACCAACAGTCCATCTATATCCATCTTTAGGATAAATGCCCAAAATTGGAAATACCATTTTTTCAGAACGTTTAATGCCCGTGTTTTTTCTTTGTTGAATTTCTTCAACTCTATACTTCTGTCCTAAATCAGATATATATGGGTATTCTTTACTTTCCTTTACCTCTAAATTAAAAAGGAGGATGTTCTTGCATAGATACTTTTCCATAAATCAAAATATATTCATCTGATTTTTGTAATTTATATTTAGCAGATCCTGCATTCATTGCTTTAGTTGTTGCATTCCAAACACTCATTCCATAAAAATTCTCTTCCCCAAACACTTCATCACATAATAATTTCAACTGT GCCTGTTCGTTATCGTCAAT AGAGATAAAAATCACACCGTCAT CACGCAGTAA ATTTTTGGCAAGATGCAAACGAGGCAACATCATATTTAGCCAGTTGCTGTGATAATGCCCGTTTTCTTTGCTGTTGCGAACAAAGGCTCGTTTCAATTTGCCGTGTTCATCAACATCGCCCACTTTTTCCGCATAATCCG TTTTACTATCAGCAAAATTATCGTTATAGATAAAATCGTTACCCGTATTGTATGGCGGATCAATATAGATCATTTTGACCGAATTGAAGTAGGATTTTTGCAGGGCTTTTAAAACATCTAAATTTTCACCC TCAATAAAGATATTCTGCGTATTTTCAAAATCCACACTCTTCTTCCTCGCAAGGAGTGAGCGTTTTGGTTGTTGGTGTTTGTAAGGTTTGATAGGCTGTTGATTTTCCTGCCCAGTTGAGCATATAGCGGT CAGGTTCGGTGGAAAAATTATCTGAAAAAAGTTGTTGGAATTTGTCGAAGTCGATTTTTACCTTCGCTGAAAATTTCAGGTAAAAGAGATTTTAATTGCGAAAGTTGTTGATCTTTAGACGAAAAGTTGGCA AG GCTTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTT TGGCATTGTAATGTCCCTTTTTTGAATGTCTACAACAAAATGAGGTATTTTACAAACCGATTGACTAATGAAGCAAGAACATAATCAGCTACAACTGAATATATTTTGCAAATTTCCCGATAAATTT CACCGCTTGTAGATAAAAACCATAGATAAAAAAATAGGGGCTAAATATCTTTAGCCCCTACCGTCATCAGAAATAAATCCCGACTAAAATCGCCACGAACACGCCTAAGCCAAAATAGTGGTTATTTAAAAACGCTTTAAAGCATTCGCTGCGTTCTCTTTTTTTGGTCAGCCAACATTGGTAGATAAACAGTGTGGCACTTAGAGCCAGTACGATAAAATAGCCGATATGATAGCCTTTTACCACACCCAATAATCCCAATAAAATCAAGGTGATAAACTGCAATAACGCAATAATTTTATTATCGTATTGAGCGAATAAAATCGCGGTGGATTTAACTCCAATTCGTAAATCATCGTCACGATCAACCATTGCATATTGGGTGTCGTAGGCGACTGTCCACGCTAGATTGGCAAAAAACAGCAGCCAGCATTCAAGTGGAAGAGTTTCCGTTACCGCACCAAATGCCATCGGAATCGACCAACCGAATGCCATTCCAAGCACTACTTGTGGCAAGTGGGTAAAACGTTTCATAAAGGGGTAAATCACTGCCAGAAAAACTGCCACAAAGGAAAGCATAAACGCATAACGGTTTAACATTAAATCGAGCAGAAAGGCGAACAACAGCAAGATTGCAAAAATCACTTTTGCCTCTGTGGTGGTCACTCTGCCGGTAGCTAATGGACGTTGAGAGGTGCGTTTAACGTGTCCGTCAATTTCTCTATCGGCATAATCATTAATCACACAACCTGCCGCACGCATAACGATTACCCCAAGGGTAAAAATGGCTAAAATCGCAACAGGCGGCATTCCCTCTGCGGCAATAAATAACGCCCATAGTGTGGGGTGTAATAATAATAACGTGCCGATGGGTTTATCGAAACGCATTAACTGGGCGTAGGCAATCCATTTTTGTTTAGAAAAAAGAGTTTCGTTATTCAT。
[0045] When designing the sequence, we first selected the genome sequence of the closest related strain Mh 39433 as the initial reference (template) based on 16s sequencing, and after the third sequencing, we selected the sequence of the unique branch of strain Mh 10208 as the reference (template) for design. After completing the sequence design, we used degenerate bases to cover as many strains of Mannheimia hemolytica as possible, and obtained detection primers with ideal versatility and specificity.
[0046] A total of 5 primers were obtained, some of which carried degenerate bases, 5R was located in conserved region A, 7F, 5F, and 3R were located in conserved region B, and 3F was in conserved region C (see Figure 4 or Figure 5 ). Specifically:
[0047] 7F:ATTGAYGATAACGAACAGGC(SEQ ID NO.3);
[0048] 5F: YGCMAAAAATTTACTGCGTG (SEQ ID NO.4);
[0049] 3F: GGTTTTTATCTACAAGCGGTG (SEQ ID NO. 5);
[0050] 5R: TAAAACCTACATCAAGCGGTC (SEQ ID NO. 6);
[0051] 3R:TTTARRCGAAAAGTTGGCAAG (SEQ ID NO. 7).
[0052] Among them, the IUPAC nucleotide code is explained as follows:
[0053] Y indicates that cytosine (C) or thymine (T) is randomly inserted. This means that either C or T can be inserted at this position.
[0054] M indicates random insertion of adenine (A) or cytosine (C). This means that the base at this position can be either A or C.
[0055] R indicates that adenine (A) or guanine (G) is randomly inserted. This means that the nucleotide at this position can be either A or G.
[0056] S indicates random insertion of guanine (G) or cytosine (C). This means that either G or C may be present at this position.
[0057] W indicates that adenine (A) or thymine (T) is randomly inserted. This means that the base at this position can be either A or T.
[0058] K indicates random insertion of guanine (G) or thymine (T). This means that the nucleotide at this position can be either G or T.
[0059] B indicates random insertion of cytosine (C), guanine (G) or thymine (T). This means that it is impossible for adenine (A) to be at this position, but it can be any of C, G or T.
[0060] D indicates random insertion of adenine (A), guanine (G) or thymine (T). This means that cytosine (C) cannot be in this position, but it can be any of A, G or T.
[0061] H indicates that adenine (A), cytosine (C) or thymine (T) is randomly inserted. This means that it is impossible for guanine (G) to be at this position, but it can be any of A, C or T.
[0062] V indicates random insertion of adenine (A), cytosine (C) or guanine (G). This means that thymine (T) cannot be in this position, but it can be any of A, C or G.
[0063] N indicates that adenine (A), cytosine (C), guanine (G) or thymine (T) is randomly inserted. This means that the nucleotide at this position can be any of the four bases.
[0064] The reaction system and procedure for gene amplification using the above primers are detailed in Tables 1 and 2. The reaction system includes forward primer, reverse primer, DNA template and rTaq PCR reaction mixture (2×rTaq PCR Mix, Takara), and double distilled water is used to make up the total reaction volume to 20 μL. The reaction procedure is as follows: S1 initial denaturation: the PCR reaction system is placed in a 94°C environment for 3 minutes; S2 cycle stage: the PCR reaction system is subjected to denaturation treatment at 94°C for 30 seconds, annealing treatment at 55°C for 30 seconds, and extension treatment at 72°C for 90 seconds, and the above sequence is cycled 35 times; S3 final extension: the PCR reaction system is placed in a 72°C environment for 5 minutes.
[0065] Table 1: PCR reaction system
[0066] Components volume Double distilled water 8.5μL Forward primer (10 μM) 0.5μL Reverse primer (10 μM) 0.5μL gDNA samples 3μL rTaq PCR reaction mixture 12.5μL
[0067] Table 2: PCR reaction program
[0068] temperature time Cycle times 94℃ 3min 1 94℃ 30s 35 55℃ 30s 35 72℃ 90s 35 72℃ 5min 1
[0069] Example 2: Testing of new universal primer combinations
[0070] The aforementioned SEQ ID NO.3-SEQ ID NO.7 were used in combination in pairs for detection, and the combination of 5F5R, 7F5R, and 3F3R was used as an example for illustration.
[0071] The tests of the above primers are divided into universality, specificity and sensitivity tests. Specifically, the universality of the primers was tested using the genomic DNA of 16 strains of Mh as templates; the specificity of the primers was tested using Pasteurella multocida, Escherichia coli, Moraxella, Streptococcus, Acronymus pyogenes, Staphylococcus aureus, and Mycoplasma pneumoniae as templates; and the sensitivity was tested using gradient diluted Mh genomic DNA as templates.
[0072] The experimental results of the universality test are as follows Figure 6 As shown, the three groups of primers can amplify bands for the 16 Mh genomes preserved in the laboratory, and the product size is in line with expectations. Specifically, 3F3R has non-specific amplification for some strains (significant diffuse bands can be seen, and tailing occurs). The non-specific amplification phenomenon of the strains numbered "1", "3-1" and "6747" is more obvious, and its main band is darker and the non-specific amplification is more obvious. In addition, 3F3R also amplifies bands of different sizes for different strains (in different strains, the molecular weight of the main band with the strongest signal is different). The reason for the amplification of bands of different sizes is analyzed by the inventor as follows: the amplified product of 3F3R contains the repetitive sequence in the Rpt2 locus, and because the number of repetitions in the genomes of different strains is different, the size of the amplified product is different, and the theoretical size range is about 100-400bp.
[0073] Both 5F5R and 7F5R amplified a single bright band without mixed bands, with less primer dimers, and the molecular weight of the amplified products of Mh21 and Mh23 (strains labeled "21" and "23") was significantly smaller than that of other strains, which was in line with expectations. Figure 3 The conserved region A shown in the figure has theoretical amplification products of 1067 bp and 1024 bp for most Mh genomes, while for NCTC 10208 and strains of the same evolutionary branch (such as Mh21 and Mh23 preserved in this laboratory), the theoretical amplification products are 911 bp and 868 bp, respectively. In summary, all three primer sets have certain versatility and good amplification effect, but 3F3R has a general amplification effect due to non-specific amplification, and is not suitable as a universal primer for Mh strain testing compared to 5F5R and 7F5R.
[0074] The experimental results of specificity test are as follows Figure 7As shown, in the two groups of tests, 5F5R has better specificity, followed by 7F5R, and 3F3R has poorer specificity. Specifically, 3F3R has non-specific amplification of Pasteurella multocida, Moraxella, Streptococcus, and Cryptobacterium pyogenes, among which the amplified product of Pasteurella multocida is about 200bp. The universal test results show that using 3F3R as a primer to amplify the genome of the Mh strain, a band of 100-400bp can be obtained. Therefore, the amplification of 3F3R on Pasteurella multocida, the amplified band is in the range of 100-400bp, which will easily lead to false positive results. Therefore, the specificity test of 3F3R failed.
[0075] 5F5R and 7F5R amplified Moraxella and Streptococcus, but the amplified products were different from the positive control in band pattern and could be distinguished by extending the electrophoresis time. In the group b test, 7F5R had nonspecific amplification of Pasteurella multocida and produced significant amplification bands that may be similar to the amplification results of Mh strains, which can easily lead to false positive results. In summary, 5F5R has good specificity and can be used for further testing. 7F5R and 3F3R failed the specificity test and were discarded.
[0076] The experimental results of sensitivity test are as follows Figure 8 As shown in the figure, when using Mh genomic DNA as template for amplification, primer 5F5R can amplify the concentration of 1×10 -3 ng / μL of samples produced obvious amplification, indicating that the primer pair had good sensitivity and no nonspecific amplification for samples of each concentration gradient.
[0077] The inventors have discovered the location of the conserved region on Rpt2 through extensive research and designed corresponding primers. Although the candidate primers of this scheme are all designed by selecting the conserved region sequence on Rpt2 as a template, there are significant differences in the amplification effects of different primer pairs. Although some primer pairs should be universal in theory, the amplification results have problems such as non-specific amplification and specificity. In the end, only one pair of primers 5F5R with the most ideal effect was obtained.
[0078] The above is only an embodiment of the present invention, and the common knowledge such as the known specific technical solutions and / or characteristics in the solution is not described in detail here. It should be pointed out that for those skilled in the art, without departing from the technical solution of the present invention, several modifications and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.
Claims
1. A universal primer for detecting Mannheimia hemolytica, characterized in that: It comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5, and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.6 or SEQ ID NO.
7.
2. A universal primer for detecting Mannheimia hemolytica according to claim 1, characterized in that: It includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.6; or includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.4 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.6; or includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.
7.
3. A universal primer for detecting Mannheimia hemolytica according to claim 2, characterized in that: It consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.4 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.
6.
4. A detection system comprising a universal primer for detecting Mannheimia haemolytica according to any one of claims 1 to 3, characterized in that: It includes forward primer, reverse primer, DNA template and rTaq PCR reaction mixture.
5. The detection system according to claim 4, characterized in that: It consisted of 8.5 μL double distilled water, 0.5 μL forward primer, 0.5 μL reverse primer, 3 μL DNA sample and 12.5 μL rTaq PCR reaction mixture.
6. The detection system according to claim 5, characterized in that: The working procedure of the reaction system is: S1 initial denaturation: place the reaction system at 94°C for 3 min; S2 cycle stage: the reaction system was subjected to denaturation treatment at 94°C for 30 s, annealing treatment at 55°C for 30 s, and extension treatment at 72°C for 90 s, and the above sequence was cycled 35 times; S3 final extension: place the reaction system at 72°C for 5 min.