Molecular identification method suitable for amorphophallus konjac and amorphophallus albus hybrid

Abstract

The invention belongs to the technical field of plant molecular biology, and discloses a PCR amplification primer suitable for molecular identification of amorphophallus konjac and amorphophallus albus hybrids, the PCR amplification primer comprises a ZJ20 primer, and the sequence of the ZJ20 primer is F: CAGACCATAATCAGCATG; r is GTCTCCACT GCCGTACCTT, and R is GTCTCCACT The molecular identification method comprises the following steps: step 1, extracting genome DNA of a to-be-detected konjak sample, carrying out amplification by using the PCR primer, then carrying out first-generation DNA sequencing, and if a hybrid genotype A / T is observed at three positions of 170-180bp, 190bp-200bp and 210bp-220bp, determining that a hybrid first filial generation of amorphophallus konjac and amorphophallus albus is obtained, and a reaction system for PCR amplification in the step 2 is as follows: the reaction total volume is 25 microliters, and the reaction time is 30 minutes; a reagent contained in the step 3 is as follows: 12.5 mu L of a 2 * PCR Mix premixed solution, 0.3 mu M of R and F primers and 30 ng of a sample genome DNA solution, finally, sterile ultrapure water is used for complementing the deficient volume, and the amplification process of the PCR reaction in the step 3 is as follows: pre-denaturation at 95 DEG C is performed for 5 minutes, then denaturation at 95 DEG C is performed for 45 seconds, annealing at 56 DEG C is performed for 45 seconds, extension at 72 DEG C is performed for 45 seconds, and 35 amplification cycles are performed in total.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology, and in particular relates to a molecular identification method suitable for hybrids of flower konjac and white konjac. Background Art

[0002] Konjac belongs to the Araceae family, Amorphophallus genus, which includes more than 250 species, mainly distributed in West Africa, Pacific Islands, Southeast Asia and East Asia. Konjac is used as a cash crop in many Asian countries because it is rich in glucomannan, an important food and industrial raw material. In my country, konjac has a cultivation history of nearly 2,000 years, among which flower konjac, Amorphophallus konjac, and white konjac, Amorphophallus albus, are widely planted in the southwest due to their good adaptability and excellent quality.

[0003] The current development of the konjac planting industry is deeply affected by diseases such as soft rot. There is no perfect solution for the prevention and treatment of these diseases, and long-term asexual reproduction has also caused the germplasm of konjac to degenerate. Cultivating excellent disease-resistant varieties through hybrid breeding is an effective method, especially interspecific hybrids can integrate the outstanding traits of different konjac species, give play to hybrid advantages, and have broad development prospects. At present, there have been some attempts at interspecific hybrid breeding of konjac, among which the hybrids between flower konjac and white konjac have excellent traits and have been used in actual production in some areas.

[0004] In view of the large morphological variation of interspecific hybrids, the identification of interspecific hybrids between Amorphophallus konjac and Amorphophallus truncatus by conventional morphological methods has the disadvantages of instability and poor reliability. On the basis of successfully obtaining interspecific hybrids between Amorphophallus konjac and Amorphophallus truncatus. Summary of the invention

[0005] The purpose of the present invention is to provide a method for molecular identification of a hybrid of konjac and white konjac based on SNP primers combined with first-generation sequencing technology. The method performs PCR amplification on konjac, i.e. 40 samples, white konjac, i.e. 40 samples and their first-generation hybrids, i.e. 60 samples, and it is found that the identification effect is very significant. The method has the advantages of being simple and efficient, having reliable results and being capable of large-scale detection.

[0006] To achieve the above object, the present invention provides the following technical solution: a PCR amplification primer suitable for molecular identification of hybrids of flower konjac and white konjac, comprising a ZJ20 primer, the sequence of which is:

[0007] F: CAGACCATAAATCCAGCATG;

[0008] R:GTCTCCACTGCCGTACCTT

[0009] The molecular identification method includes the following steps:

[0010] Step 1: extract the genomic DNA of the konjac sample to be tested, amplify it with the above PCR primers, and then perform first-generation DNA sequencing. If the heterozygous genotype A / T is observed at the three positions of 170-180bp, 190bp-200bp and 210bp-220bp, it is the first-generation hybrid of the flower konjac and the white konjac;

[0011] Step 2: The reaction system for PCR amplification is: the total reaction volume is 25 μL, and the reagents contained therein are: 12.5 μL of 2×PCRMix premix, 0.3 μM of each R and F primer, 30 ng of sample genomic DNA solution, and finally sterile ultrapure water is used to make up the missing volume;

[0012] Step 3: The amplification process of the PCR reaction is: pre-denaturation at 95°C for 5 minutes, then denaturation at 95°C for 45 seconds, annealing at 56°C for 45 seconds, and extension at 72°C for 45 seconds, for a total of 35 amplification cycles; and finally extension at 72°C for 7 minutes.

[0013] Preferably, in step 1, any one of the three heterozygous peaks missing is a pseudo-hybrid.

[0014] Preferably, in step 2, the premix includes PCR reaction solution, dNTP and DNA Taq enzyme.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] 1. The sample of the present invention is a hybrid of flower konjac and white konjac only if the heterozygous genotype A / T is observed at the three positions of 170-180bp, 190bp-200bp and 210bp-220bp. The sample lacking one of the three heterozygous peaks is a false hybrid.

[0017] 2. The present invention screens out a pair of SNP sequencing primers from the konjac genome sequence, and the primers can be stably amplified in konjac, white konjac and hybrid individuals thereof, and the amplified band is clear, meeting the needs of first-generation DNA sequencing. The genotype peak diagram result based on DNA sequencing can distinguish konjac, white konjac and the hybrid of the two, and has important application value in the identification of the hybrids of konjac and white konjac;

[0018] 3. This method can timely, quickly and effectively identify the first generation of hybrids of Amorphophallus konjac and Amorphophallus konjac, and has practical value. The operation method is relatively simple, the data results are intuitive and reliable, the repeatability is good, and the detection cost is low. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1The sequencing maps of the amplified products of the primer ZJ20 of the present invention in the samples of the flower konjac, white konjac and the first generation of their hybrids, H: flower konjac; B: white konjac; HB: the first generation of the hybrid of flower konjac♀×white konjac♂; BH: the first generation of the hybrid of white konjac♀×flower konjac♂. DETAILED DESCRIPTION

[0020] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] Example

[0022] See also Figure 1 , take young leaves or buds of konjac, and use CTAB method to extract genomic DNA of flower konjac, i.e. 40 samples, white konjac, i.e. 40 samples and their hybrid first generation, i.e. 60 samples; take 0.1g leaves and put them in a mortar, add liquid nitrogen to freeze and grind them quickly, transfer the broken samples into 2ml centrifuge tubes, add 1.5ml CTAB extraction solution, and shake to mix; place the samples in a 65℃ water bath for 30min; after the water bath is completed, centrifuge the samples at 12000 rpm for 5min; transfer the supernatant into a new 2ml centrifuge tube, add a chloroform:isoamyl alcohol mixture of the same volume as the supernatant, i.e. 24:1, centrifuge to take the supernatant, and repeat the extraction twice; finally, add anhydrous ethanol twice the volume of the supernatant and 1 / 10 the volume of 3mol / L sodium acetate, and transfer the precipitated flocculent DNA into a new 1.5ml centrifuge tube.

[0023] Dissolve genomic DNA with sterile distilled water, and use the extracted sample DNA of konjac, white konjac and their hybrid first generation as templates to perform PCR reaction; the total reaction volume is 25 μL, and the reagents contained in it are: 2×PCR Mix premix, including PCR reaction solution, dNTP, DNA Taq enzyme, 12.5 μL, R and F primers 0.3 μM each, sample genomic DNA solution 30 ng, and finally use sterile ultrapure water to make up the missing volume; the sequence of the ZJ20 primer used in the reaction is:

[0024] F: CAGACCATAAATCCAGCATG;

[0025] R:GTCTCCACTGCCGTACCTT.

[0026] The reaction procedure of the PCR experiment was as follows: pre-denaturation at 95°C for 5 min, followed by denaturation at 95°C for 45 s, annealing at 56°C for 45 s, and extension at 72°C for 45 s, for a total of 35 amplification cycles; and final extension at 72°C for 7 min.

[0027] After the PCR amplification is completed, the amplified product is subjected to first-generation DNA sequencing and compared with the standard map provided by the invention. Only when the heterozygous genotype A / T is observed at the three positions of 170-180bp, 190bp-200bp and 210bp-220bp, is it the first-generation hybrid of the flower konjac and the white konjac? The lack of any of the three heterozygous peaks is a false hybrid.

[0028] The application principle of the primers of this method in identifying the first generation of hybrids between flower konjac and white konjac is as follows:

[0029] Since the amplification products of Amorphophallus konjac and Amorphophallus albus using primer ZJ20 only produce homozygous genotypes at the corresponding sequence positions, the genotypes of Amorphophallus konjac samples at 170-180bp, 190bp-200bp and 210bp-220bp are A, T, T, and the genotypes of Amorphophallus albus samples at 170-180bp, 190bp-200bp and 210bp-220bp are T, A, A; the two konjac species have different alleles at these three positions, which can clearly distinguish the two species.

[0030] The identification method of this SNP marker in the first generation of the hybrid of the flower konjac and the white konjac is: only when the heterozygous genotype A / T is observed at the three positions of 170-180bp, 190bp-200bp and 210bp-220bp, the sample is the first generation of the hybrid of the flower konjac and the white konjac. If one of the three heterozygous peaks is missing, it is a false hybrid.

[0031] The invention screens out a pair of SNP sequencing primers from the konjac genome sequence, and the primers can stably amplify in konjac, white konjac and hybrid individuals thereof, and the amplified bands are clear, meeting the needs of first-generation DNA sequencing. The genotype peak diagram result based on DNA sequencing can distinguish konjac, white konjac and the first-generation hybrid of the two, and has important application value in the identification of hybrids of konjac and white konjac.

[0032] The experimental results show that since the plant morphology of interspecific hybrids of konjac is easily affected by the external environment and produces large morphological variations, the identification of interspecific hybrids only by leaf and petiole morphology is unreliable, unstable, and has a high false positive rate. The method can be used to timely, quickly and effectively identify the first generation of hybrids of flower konjac and white konjac, which has practical value. The operation method is relatively simple, the data results are intuitive and reliable, the repeatability is good, and the detection cost is low.

[0033] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0034] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A PCR amplification primer applicable to molecular identification of flower konjac and white konjac hybrids, comprising a ZJ20 primer, characterized in that: The sequence of the ZJ20 primer is: F: CAGACCATAAATCCAGCATG; R:GTCTCCACTGCCGTACCTT; The molecular identification method includes the following steps: Step 1: extract the genomic DNA of the konjac sample to be tested, amplify it with the above PCR primers, and then perform first-generation DNA sequencing. If the heterozygous genotype A / T is observed at the three positions of 170-180bp, 190bp-200bp and 210bp-220bp, it is the first-generation hybrid of the flower konjac and the white konjac; Step 2: The reaction system for PCR amplification is: the total reaction volume is 25 μL, and the reagents contained therein are: 12.5 μL of 2×PCR Mix premix, 0.3 μM of each R and F primer, 30 ng of sample genomic DNA solution, and finally sterile ultrapure water is used to make up the missing volume; Step 3: The amplification process of the PCR reaction is: pre-denaturation at 95°C for 5 minutes, then denaturation at 95°C for 45 seconds, annealing at 56°C for 45 seconds, and extension at 72°C for 45 seconds, for a total of 35 amplification cycles; and finally extension at 72°C for 7 minutes.

2. a kind of molecular identification method applicable to flower konjac and white konjac hybrid according to claim 1, it is characterized in that: In step 1, any one of the three heterozygous peaks missing is a false hybrid.

3. a kind of molecular identification method applicable to flower konjac and white konjac hybrid according to claim 1, it is characterized in that: In step 2, the premix includes PCR reaction solution, dNTP and DNA Taq enzyme.

Images