Molecular markers for identifying non-photosensitive eggplant and their applications

Abstract

This invention discloses a molecular marker for identifying non-photosensitive eggplant and its application. The molecular marker is located at -1959bp to -1234bp of the SmMYB113 promoter in eggplant, and its nucleotide sequence is shown in SEQ ID NO:1. This invention discovers that the RU repeat sequence in the SmMYB113 promoter enables light-independent expression of SmMYB113 in non-photosensitive eggplant, thereby enhancing anthocyanin accumulation even in the absence of light, and can serve as a molecular marker for identifying non-photosensitive eggplant. Using the molecular marker of this invention, the accuracy of identification in 264 natural eggplant populations was verified to be 95.8%. This invention accurately locates the key gene regulating non-photosensitive eggplant and develops the corresponding molecular marker, which can provide technical support for marker-assisted selection breeding of eggplant and has significant application value in production.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, and more specifically, this invention relates to a molecular marker for identifying non-photosensitive eggplant and its application. Background Technology

[0002] Eggplant, as an important vegetable crop, has always been an indispensable part of people's dining tables. Its diverse fruit varieties, rich nutritional content, and versatility in preparation methods have made it a favorite among the general public. Eggplant is also a vegetable crop of significant economic value worldwide, ranking alongside tomatoes and peppers as one of the three major vegetables in the Solanaceae family.

[0003] Eggplant cultivation is widespread in my country, with Shandong, Henan, Hebei, Liaoning, Jiangsu, and Sichuan provinces being major production areas. The Central Plains region primarily produces purple-black round eggplants, purple-red round eggplants, and green-skinned oval eggplants from Henan. Other varieties include purple-black long eggplants from Northeast China, purple-red long eggplants from East China, purple-black long eggplants from Central China, and purple-red long eggplants from South China. Consumer demand for eggplant color varies across different regions. Eggplant skin colors are diverse, broadly categorized as white, green, and purple. Research indicates that the main pigments determining eggplant fruit color are chlorophyll and anthocyanins, while the final color is influenced by various environmental factors such as light. Purple eggplants can be further divided into three main categories: purple-red eggplants, photosensitive purple-black eggplants, and non-photosensitive purple-black eggplants. Non-photosensitive purple-black eggplants differ phenotypically from photosensitive purple-black eggplants in that their fruit coloring is not dependent on light during growth and development. This significantly increases the uniformity of coloring, especially under low-light conditions, thus improving commercial quality.

[0004] Eggplant pericarp color diversity is an important breeding goal and research direction. With the development of molecular biology, there have been many reports on the formation mechanism of eggplant pericarp color. For example, YOU et al. showed that SmMYB113 can participate in the regulation of anthocyanin biosynthesis in photosensitive eggplants, but existing research results cannot explain why anthocyanins can still be synthesized in non-photosensitive eggplants under dark conditions. Shi et al. also reported that SmMYB75 can also regulate the synthesis of anthocyanins in eggplant pericarps. However, research on non-photosensitive (NPS) eggplants is rarely reported. Only He et al., by using photosensitive eggplant "LSHX" and non-photosensitive eggplant "145" as parents to construct an F2 population, precisely located the gene controlling the pericarp color of non-photosensitive eggplants: SmFTSH10, and clarified that the difference between photosensitive and non-photosensitive eggplants is caused by the deletion of the "C" base in the sequence of this gene.

[0005] Currently, the differentiation of non-photosensitive eggplants is limited to observing anthocyanin synthesis under the sepals of the fruit, which is time-consuming and labor-intensive, and there are no efficient and usable molecular markers for identification. Therefore, locating the key genes regulating non-photosensitive eggplants and developing corresponding molecular markers can provide technical support for marker-assisted selection breeding of eggplants, and has important application value in production. Summary of the Invention

[0006] Therefore, the purpose of this invention is to provide a molecular marker for identifying non-photosensitive eggplant, and a method for identifying non-photosensitive eggplant.

[0007] The technical solutions for achieving the above-mentioned objectives include the following.

[0008] In a first aspect, the present invention provides a molecular marker closely linked to the non-photosensitive trait of eggplant, the molecular marker being located at -1959bp to -1234bp of the eggplant SmMYB113 promoter, and its nucleotide sequence being shown in SEQ ID NO:1.

[0009] In a second aspect, the present invention provides primers for amplifying the aforementioned molecular markers, including a forward primer as shown in SEQ ID NO:2 and a reverse primer as shown in SEQ ID NO:3, a forward primer as shown in SEQ ID NO:4 and a reverse primer as shown in SEQ ID NO:5, and a forward primer as shown in SEQ ID NO:6 and a reverse primer as shown in SEQ ID NO:7.

[0010] A third aspect of the present invention provides a kit for detecting non-photosensitive eggplant varieties, comprising the primers described above.

[0011] A fourth aspect of the present invention provides the application of the above-mentioned molecular markers, primers or kits in the identification or screening of non-photosensitive eggplant varieties.

[0012] In a fifth aspect, the present invention provides a method for identifying non-photosensitive eggplant varieties, using the DNA of the eggplant to be tested as a template and performing real-time quantitative PCR amplification with the aforementioned primers.

[0013] In a sixth aspect, the present invention provides a method for screening non-photosensitive eggplant varieties, using the DNA of the eggplant to be tested as a template and performing real-time quantitative PCR amplification with the aforementioned primers.

[0014] This invention uses green eggplant "21E26" and non-photosensitive purple eggplant "21E27" as parents. Through genetic analysis of eggplant fruit color, BSA pooled sequencing, parental resequencing, genotyping of the F2 segregating population, and [further details needed for accurate translation], this invention [further details needed for accurate translation]. 4：5Using techniques such as screening recombinant single plants within a population, the key QTL region associated with the non-photosensitive trait was narrowed down to 33.58 kb, with a genetic distance of 0.1 cM. Within this region, only one gene, SmMYB113, was identified, and sequencing depth differences were observed only in the region from -1959 bp to -1234 bp upstream of the ATG in the non-photosensitive eggplant "21E27". By designing a pre-primer upstream of this region and a post-primer within it, and conducting genetic complementation experiments using tomato as material, it was verified that this region is repetitive only in non-photosensitive eggplant. Therefore, the RU repeat sequence in the SmMYB113 promoter (the region from -1959 bp to -1234 bp upstream of the ATG, as shown in SEQ ID NO:1) enables light-independent expression of SmMYB113 in non-photosensitive eggplant, thereby enhancing anthocyanin accumulation even in the absence of light, and can serve as a molecular marker for identifying non-photosensitive eggplant. According to the molecular marker of the present invention, primers suitable for amplifying the molecular marker (sequences shown in SEQ ID NO:2 to SEQ ID NO:7) were designed, and the accuracy of identifying non-photosensitive eggplants in 264 natural eggplant populations was 95.8%.

[0015] This invention accurately locates the key gene regulating non-photosensitive eggplant and develops corresponding molecular markers, which can provide technical support for molecular marker-assisted selection breeding of eggplant and has important application value in production. Attached Figure Description

[0016] Figure 1 This is for the phenotypic identification and genetic analysis of the parental materials in Example 1 of the invention.

[0017] Figure 2 This is a sequence cloning analysis of the SmFTSH10 gene in different materials in Example 1 of the present invention.

[0018] Figure 3 This is the result of fine localization of the NPS gene and sequence alignment and expression level identification of candidate genes in different materials in Example 1 of the present invention.

[0019] Figure 4 This is an analysis of the amino acid sequence alignment of SmMYB113 in different materials in Example 1 of the present invention.

[0020] Figure 5 This is a sequence alignment of SmMYB113 in 21E26, 21E27E, 22E85, guiqie1, and HQ-1315 in Embodiment 1 of the present invention.

[0021] Figure 6 This study analyzes the promoter sequence of SmMYB113 in different eggplant materials in Example 1 of the present invention and predicts its cis-acting elements.

[0022] Figure 7 These are repeating units in different types of fruit-colored materials in Embodiment 1 of the present invention.

[0023] Figure 8 This is to verify the transgenic complementation of SmMYB113 in Example 1 of the present invention.

[0024] Figure 9 This invention provides molecular marker identification for molecular marker 23QP715 in eggplants of different fruit colors, as described in Example 1 of this invention. Detailed Implementation

[0025] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0026] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0027] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0028] The inventors of this invention measured the anthocyanin content in the peels of two parental populations—bagged and unbagged green eggplant "21E26" and non-photosensitive purple-black eggplant "21E27"—and the F1 segregating population. They found no significant difference in anthocyanin content between the bagged and unbagged peels in 21E27 and F1, indicating that anthocyanin synthesis in these materials occurs in a light-independent manner. In the 21E30 F2 segregating population, peel color conformed to a Mendelian genetic segregation ratio of 3:1, indicating that the non-photosensitive (NPS) trait is controlled by a single dominant gene. Since no mutation of the potential candidate gene SmFTSH10 for the NPS trait in existing studies was found in multiple non-photosensitive eggplant materials or eggplants of other fruit colors, it is speculated that other genes regulate anthocyanin synthesis in non-photosensitive eggplants. Furthermore, BSA pooled sequencing was performed, and the parental green eggplant "21E26" and the non-photosensitive purple eggplant "21E27" were resequencing. Different SNP loci between the two parents were selected for molecular marker development. Using these developed molecular markers, statistical analysis of the genotyping results and phenotypic data of the F2 segregating population was conducted to determine the initial mapping interval of the key QTL, which was located within an 86kb interval with a genetic distance of 0.58cM. Further analysis was conducted on 864 F2 plants... 4：5Eleven recombinant single plants were screened from the population, narrowing the region to 33.58 kb with a genetic distance of 0.1 cM. Within the region, only one gene, SmMYB113, was identified. Expression analysis showed that SmMYB113 was highly expressed in 21E27 regardless of whether the fruit was bagged, but almost not expressed in 21E26. It is speculated that SmMYB113 is a key candidate gene for NPS. Furthermore, no mutations were detected in the SmMYB113 genomic region between photosensitive eggplant (22E85, HQ1315, and guiqie1) and non-photosensitive NPS eggplant 21E27. Only in the non-photosensitive NPS eggplant 21E27 did a sequencing depth difference exist in a region upstream of the ATG, from -1959 bp to -1234 bp. Amplification primers 23QP925 were developed flanking this anomalous region to analyze the sequence within this interval. Gel electrophoresis and Sanger sequencing revealed a 725 bp repeat unit (RU) in 21E27. This repeat unit was repeated four times in the non-photosensitive eggplant 21E27, while only one copy was present in the green eggplant 21E26 and the photosensitive purple-red eggplant 22E85. Further verification of the repeat unit in the SmMYB113 promoter was achieved using a new amplification primer 23QP723 (the front primer is upstream of the RU region, and the reverse primer is located within the RU region). Based on the repeat unit sequence and its flanking sequences, amplification primers 23QP715 were designed, resulting in a total of three primer pairs (23QP715-F1 / R1, 23QP715-F2 / R2, and 23QP715-F3 / R3). Quantitative real-time PCR was used to analyze the relative copy number of RU in 21E26, 21E27, 22E85, and 92 other eggplant varieties. The results showed that the RU copy number in non-photosensitive eggplant was (p = 4.4092). e-22 The anthocyanin content was significantly higher in non-photosensitive eggplant than in photosensitive eggplant. Based on these results, it is inferred that the RU repeat sequence in the SmMYB113 promoter enables SmMYB113 to be expressed in a light-independent manner in non-photosensitive eggplant, thereby enhancing anthocyanin accumulation even in the absence of light. Genetic complementation experiments were conducted using tomatoes as material, verifying that the RU repeat sequence in the SmMYB113 promoter plays a role in regulating anthocyanin synthesis in non-photosensitive eggplant fruit. Therefore, the RU repeat sequence in the SmMYB113 promoter (sequence shown in SEQ ID NO:1) can serve as a molecular marker for identifying non-photosensitive eggplant.

[0029] In some embodiments of the present invention, a molecular marker closely linked to the non-photosensitive trait of eggplant is disclosed, the molecular marker being located at -1959bp to -1234bp of the eggplant SmMYB113 promoter, and its nucleotide sequence is shown in SEQ ID NO:1.

[0030] In other embodiments of the present invention, the application of the above-mentioned molecular markers in the identification or screening of non-photosensitive eggplant varieties is disclosed.

[0031] In some other embodiments of the present invention, a primer for amplifying the above-mentioned molecular marker is disclosed, including a forward primer with the sequence shown in SEQ ID NO:2 and a reverse primer with the sequence shown in SEQ ID NO:3, a forward primer with the sequence shown in SEQ ID NO:4 and a reverse primer with the sequence shown in SEQ ID NO:5, and a forward primer with the sequence shown in SEQ ID NO:6 and a reverse primer with the sequence shown in SEQ ID NO:7.

[0032] In other embodiments of the present invention, the application of the above primers in identifying or screening non-photosensitive eggplant varieties is disclosed.

[0033] In other embodiments of the present invention, a kit for detecting non-photosensitive eggplant varieties is disclosed, comprising the primers described above.

[0034] In other embodiments of the present invention, the application of the above-described kit in the identification or screening of non-photosensitive eggplant varieties is disclosed.

[0035] In other embodiments of the present invention, a method for identifying non-photosensitive eggplant varieties is disclosed, which uses the DNA of the eggplant to be tested as a template and performs real-time quantitative PCR with the above-mentioned primers.

[0036] In some embodiments, the method further includes calculating the relative repeat number of the nucleotide sequence as shown in SEQ ID NO:1, where the relative repeat number = 2^(-(Cq) F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 ))), where Cq F1 / R1 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:2 and the reverse primer shown in SEQ ID NO:3. F2 / R2 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:5. F3 / R3 The Cq value is obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO:6 and the reverse primer shown in SEQ ID NO:7.

[0037] In other embodiments of the present invention, a method for screening non-photosensitive eggplant varieties is disclosed, which uses the DNA of the eggplant to be tested as a template and performs real-time quantitative PCR with the above-mentioned primers.

[0038] In some embodiments, the method further includes calculating the relative repeat number of the nucleotide sequence as shown in SEQ ID NO:1, and screening eggplant varieties with a relative repeat number ≥ 2, wherein the relative repeat number = 2^(-(Cq) F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 ), where Cq F1 / R1 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:2 and the reverse primer shown in SEQ ID NO:3. F2 / R2 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:5. F3 / R3 The Cq value is obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO:6 and the reverse primer shown in SEQ ID NO:7.

[0039] In the following embodiments of the present invention, the experimental materials used include: high-generation eggplant inbred lines obtained by South China Agricultural University through conventional breeding. The phenotypes of these inbred lines are as follows: 21E26, 22E81, and 24AE006 are green eggplant fruit materials; 22E82 is a white eggplant fruit material; 22E85 is a photosensitive purple fruit material; and 21E27 and 24AE005 are non-photosensitive (NPS) purplish-black fruit materials. 264 natural eggplant varieties were purchased from the farm of Guangzhou Jiaoyang Agricultural Co., Ltd., Guangdong Province. All 264 varieties were planted in the autumn of 2021, and the commercially mature fruits were used for phenotypic analysis. The population used for gene mapping was crossbred with green eggplant 21E26 and 21E27 non-photosensitive (NPS) purple eggplant as parents. The 21E30 F2 population (21E26 × 21E27) was planted and cultivated at South China Agricultural University in Guangzhou in the autumn of 2020. The F3, F4, and F5 populations of self-crossed offspring, as well as the 24AE009F2 segregating population (24AE005×24AE006), were cultivated at the farm of Guangzhou Jiaoyang Agricultural Co., Ltd., Guangdong Province. Genotypic and phenotypic data for guiqie1 and 67 / 3 eggplants were obtained from the Solanaceae Genome Website (https: / / solgenomics.net / ).

[0040] In the following embodiments of the present invention, the material processing methods are as follows: ① For eggplant material, immediately after pollination, it is bagged with opaque kraft paper and shaded for 14 days to promote fruit growth and development under complete darkness. Subsequently, the lower half of the bag is removed, and after 7 days, eggplant fruit samples are taken for color analysis, anthocyanin quantification, and gene expression studies. ② Tomato material is bagged in the same manner, but for 25 days. Tomato peels under different treatment conditions are collected, rapidly frozen in liquid nitrogen, and stored at -80°C for further analysis.

[0041] In the following embodiments of the present invention, the anthocyanin content of eggplant pericarp was determined by spectrophotometric difference pH method. The specific operation is as follows: 100 mg of eggplant sample was ground into powder in liquid nitrogen; added to 2 mL of working solution (pH=1.0 buffer and pH=4.5 buffer); centrifuged at 14000 rpm for 10 min at 4 °C; the supernatant was taken and measured by a spectrophotometer at a wavelength of 510 nm. The calculation formula is: Total anthocyanins (mg / g FW) = (A1-A2) × 484.8 / 24.825 × dilution factor, where A1 represents the reading of the supernatant in pH 1.0 buffer (50mM KCl and 150mM HCl) at a wavelength of 510nm; A2 represents the reading of the supernatant in pH 4.5 buffer (400mM sodium acetate and 204mM HCl) at a wavelength of 510nm; 484.8 is the molecular weight of cyanidin-3-O-glucoside; and 24.825 is the molar absorbance at a wavelength of 510nm.

[0042] In the following embodiments of the present invention, the method for determining the chlorophyll content of the pericarp of commercially cooked eggplant is in accordance with the method of Alan et al. (1994). Alan R W. 1994. The Spectral Determination of Chlorophylls a and b, as well as Total Carotenoids, Using Various Solvents with Spectrophotometers of Different Resolution. Journal of Plant Physiology, 144(3): 307-313.

[0043] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0044] Example 1: Discovery of genes regulating anthocyanin synthesis in the pericarp of "non-photosensitive" eggplant

[0045] In this embodiment, green eggplant fruit material 21E26 was used as the male parent and non-photosensitive (NPS) purple-black eggplant fruit material 21E27 was used as the female parent. The F1 and 21E30 F2 populations (21E26×21E27) were used as the research objects to explore the gene that regulates the synthesis of anthocyanins in the pericarp of "non-photosensitive" eggplant.

[0046] I. Inheritance patterns of fruit color in non-photosensitive (NPS) eggplant

[0047] A statistical analysis was conducted on the traits of two parental populations, namely the green eggplant "21E26" and the non-photosensitive purple-black eggplant "21E27," and their F1 segregating populations. The phenotype of 21E26 was characterized by green fruit skin with a high chlorophyll content, while the phenotypes of 21E27 and F1 were characterized by purple-black fruit skin with high anthocyanin and chlorophyll content. Figure 1 a)

[0048] To identify the phenotypes of parental materials, chlorophyll and anthocyanin content in bagged and unbagged fruit peels were measured. Specifically, the fruit was bagged for 14 days after pollination, and then the bags were removed from the lower half of the fruit. Seven days later, the peels of both the continuously bagged and unbagged portions were analyzed. Results showed that the chlorophyll level in the unbagged portions of fruits from varieties 21E26, 21E27, and F1 was significantly higher than that in the bagged portions. Figure 1 (b) However, in 21E27 and F1, no significant difference in anthocyanin content was observed between bagged and unbagged pericarps. Figure 1 c) indicates that anthocyanin synthesis in these materials occurs in a light-independent manner.

[0049] In the segregating population of 175 plants from the 21E30 F2 group, 121 individual plants exhibited a non-photosensitive purple pericarp phenotype (NPS phenotype), and 54 individual plants exhibited a green pericarp phenotype (NPS phenotype). Figure 1 The result (d) conforms to the Mendelian segregation ratio of 3:1 (χ2=1.8867,P=0.157), indicating that the non-photosensitive type (NPS) trait is controlled by a single dominant gene.

[0050] Studies have shown that SmFTSH10 is considered a potential candidate gene for the NPS trait, and the reason for this is attributed to the deletion of the C base. However, the inventors did not find this mutation site in multiple non-photosensitive eggplant materials or eggplants with other fruit colors (see...). Figure 2 It is speculated that other genes (hereinafter referred to as NPS genes) regulate the synthesis of anthocyanins in non-photosensitive eggplant.

[0051] II. Fine mapping of the NPS gene

[0052] 1. BSA mixed-pool sequencing

[0053] Statistical analysis was performed on the fruit color of the F2 population. Based on the fruit color distribution, 20 extreme green eggplant plants and 20 extreme purple-black eggplant plants were selected. The DNA from both populations was mixed in equal amounts to form green and purple-black pools, respectively, for BSA pool sequencing. The parents "Green Eggplant 21E26" and "Non-photosensitive Purple Eggplant 21E27" were resequencing, with a sequencing depth of 20× for the parents and 30× for the green and purple-black pools. Using eggplant HQ-1315 as the reference genome (https: / / solgenomics.net / ), reliable SNP loci were obtained using BWA, SAM, and GATK software. Using parent "21E27" as a reference, the SNP-index of each SNP locus in each pool was calculated. Based on the obtained data, the SNP-index of the green eggplant pool was subtracted from the SNP-index of the purple-black pool to obtain Δ(SNP-index). Distribution maps of SNP-index and Δ(SNP-index) were then plotted using these data. Based on the eggplant reference genome HQ-1315 published in the Sol Genomics Network (SGN) database, the SNP sites of “green eggplant 21E26” and “non-photosensitive purple eggplant 21E27” in the parental resequencing results were compared, and the different SNP sites between the two parents were selected for molecular marker development.

[0054] Eggplant genomic DNA was extracted using a modified CTAB method (2% CTAB reagent, formula as shown in Table 1; prepared CTAB was sterilized in an autoclave at 121°C for 20 minutes; after cooling, 1 / 1000 of β-mercaptoethanol was added in a fume hood).

[0055] Table 1

[0056] reagents Usage Tris 12.12g NaCl 82g EDTA 7.44g PVP 2g CTAB 20g <![CDATA[ddH2O]]> Up to 1000 mL

[0057] The specific operating steps are as follows:

[0058] a. Sampling: Take tender eggplant leaves into a 2mL centrifuge tube;

[0059] b. Freeze-drying: Open the cap of a 2mL centrifuge tube containing the blades and place it in a freeze dryer at -80℃ and 1mbar for 48h.

[0060] c. Tissue disruption: Add 2 steel balls to a 2mL centrifuge tube and grind at 60Hz for 1min in a tissue disruptor. Then centrifuge at 10000rpm for 30s.

[0061] d. Extraction: Add 750 μL of 2% CTAB extraction solution, shake vigorously to allow the sample to react fully, and place the centrifuge tube in a constant temperature metal bath at 65°C for 45 min, shaking once every 20 min during the process.

[0062] e. Phase separation: In a fume hood, add 750 μL of chloroform:isoamyl alcohol (24:1) mixture to a 2 mL centrifuge tube, shake vigorously to mix thoroughly, and then centrifuge at 10,000 rpm for 6 min.

[0063] f. DNA precipitation: After centrifugation, take 375 μL of supernatant into a new 1.5 mL centrifuge tube, add 750 μL of pre-cooled anhydrous ethanol, gently shake to mix, and place in a -20°C freezer for 1 hour.

[0064] g. Purification: Place the centrifuge tube in a centrifuge and centrifuge at 12000 rpm for 6 min. Discard the supernatant, then add 750 μL of 70% ethanol to rinse twice. Blot the liquid on the surface of the centrifuge tube with a paper towel and place it in a 65℃ oven for 1-2 h to dry.

[0065] h. Dissolution and storage: Add 100 μL of sterile ultrapure water to each centrifuge tube to dissolve, place on a horizontal shaker at 30 rpm for 12 h at room temperature, and finally store in a -20℃ freezer.

[0066] 2. Constructing genetic linkage maps and initial gene localization

[0067] KASP molecular markers were designed and screened within the 95% confidence intervals discovered by BSA-seq, and genotyping was performed in different types of segregating populations. The results were compiled into an Excel spreadsheet. Genotypes identical to the green eggplant parent were replaced with "0", genotypes identical to the purple-black eggplant parent were replaced with "2", heterozygotes were replaced with "1", and undefined or no signal were replaced with "-1". Genetic distances were calculated using the MAP function of QTL Ici Mapping 4.2 to construct a genetic linkage map. The Kosambi mapping function was used to transform recombination frequencies to estimate the mapping distance in cM units. Finally, QTL analysis of eggplant fruit color traits was performed using the BIP function of QTL Ici Mapping, with a LOD value of 2.5 as the threshold for determining the presence of QTLs, to obtain the gene mapping results. Based on the BSA-seq results and the statistical analysis of genotyping and phenotypic data of the F2 segregating population using polymorphic molecular markers developed within the interval, the initial localization interval of the key QTL was determined, which was located within an 86kb interval with a genetic distance of 0.58cM.

[0068] The genotyping methods are as follows:

[0069] (1) Dilute the extracted genomic DNA from the sample to be tested to 50 ng / μL as a template for the amplification reaction, and use the previous primer F P1 (Its 5' end is modified with the FAM fluorescent linker GAGGTGACCAAGTTCATGCT), and the front primer F P2 (Its 5' end is modified with the HEX fluorescent linker GAAGGTCGGAGTCAACGGATT) and the back primer R were used as KASP amplification primers (designed according to the KASP molecular marker using existing conventional methods and synthesized by Shanghai Sangon Biotech Co., Ltd.). PCR amplification was performed using the PCR reaction system in Table 2 (which must be performed on ice, and KASP MIX must be stored in the dark; after the system is prepared, it should be centrifuged at 1200 rpm for 1 min) and the PCR reaction procedure in Table 3.

[0070] Table 2 PCR reaction system

[0071]

[0072]

[0073] Table 3 PCR reaction procedure

[0074] Program number Operating requirements time 1 94℃ 15min 2 94℃ 20s 3 78℃ 10s 4 65℃ (decreasing by 0.5℃ per cycle) 1min 5 Go back to step two, repeat 10 times. 6 94℃ 20s 7 57℃ 1min 8 Go back to step 6, repeat 30 times. 9 Reading board

[0075] (2) Genotyping data analysis

[0076] The SNP genotyping results were obtained by analyzing the final fluorescence signals using the CFX Maestro V4.1 analysis software included with the C1000 Touch. On the X-axis, the yellow circles representing the Allele 1 channel signal in the sample report indicate the alleles connected to the FAM fluorescent adapter; on the Y-axis, the blue squares representing the Allele 2 channel signal in the sample report indicate the alleles connected to the HEX fluorescent adapter; and the green triangles representing the signals clustered above the XY-axis diagonals indicate heterozygous samples of both alleles.

[0077] 3. Precise positioning

[0078] Through 864 F plants 4：5 Eleven recombinant plants were screened from the population (genotyping of individual plants in the segregating population was performed using two markers flanking the gene mapping region; plants with different genotypes detected by the two markers were identified). The NPS gene was further mapped to between 23QP578 and 21QP381, narrowing the interval to 33.58 kb, with a genetic distance of 0.1 cM. Figure 3(b) Within the localization region, only one gene, SmMYB113, was identified. It has been previously reported to encode the R2R3-MYB transcription factor involved in regulating anthocyanin biosynthesis in eggplant. Sequence analysis revealed multiple mutation sites in the SmMYB113 gene in 21E26 compared to 21E27, including a 26 bp deletion (overlapping of the first intron and second exon), two insertion sites (a 56 bp insertion and a 1 bp insertion located in the second intron and third exon, respectively), and 18 SNP sites (9 in introns and 9 in exons). Figure 3 c). The 26bp deletion in the 21E26 material causes selective splicing, resulting in protein truncation ( Figure 4 Expression analysis showed that SmMYB113 was highly expressed in 21E27 (bagged and unbagged peels) regardless of whether the fruit was bagged, but almost not expressed in 21E26. Figure 3 Based on d), it is speculated that SmMYB113 is a key candidate gene for SmNPS10.1.

[0079] III. Identification of the 725bp repeat unit in the SmMYB113 promoter region of non-photosensitive eggplant

[0080] 1. No mutations were detected in the SmMYB113 genomic region (ATG to TAA, including exons and introns) between photosensitive eggplant (22E85, HQ1315, and guiqie1) and non-photosensitive NPS eggplant 21E27 (see [link to relevant documentation]). Figure 5 To this end, we investigated the promoter region sequence information of SmMYB113. Using Integrative Genomics Viewer (IGV), we aligned the reads of the guiqie1, 67 / 3, and HQ1315 reference genomes and found that compared to photosensitive eggplant (22E85, guiqie1, 67 / 3, and HQ1315), only the region from -1959 bp to -1234 bp upstream of the ATG in 21E27 showed a sequencing depth difference; no sequence differences were detected in other regions. Figure 6 (a) In 21E27, the sequencing depth of this region is ~2.92 times that of its surrounding regions. However, in photosensitive eggplants—including 21E26 (~1.03 times), S86 (~0.70 times), 22E81 (~0.91 times), 22E82 (~1.08 times), 22E85 (~1.17 times), and 22E86 (~0.97 times)—the sequencing depth is significantly lower. Figure 6 b) - No such difference was found.

[0081] 2. Further, we developed amplification primers 23QP925 (F: TGCTTACCTATACACC CCGTCTA, SEQ ID NO: 8; R: TGCAATGCACAGATCTAAAAGTCA, SEQ ID NO: 9) targeting both sides of this abnormal region to analyze the sequence within this interval. The results showed that the PCR product in 21E27 (PCR reaction system and reaction procedure are shown in Tables 2 and 3) was 748 bp and 2175 bp longer than those in 21E26 and 22E85, respectively. Figure 6 (c) Sanger sequencing analysis revealed a 725 bp repeat unit (RU) in 21E27, which was repeated four times in the non-photosensitive eggplant 21E27, while only one copy was present in the photosensitive eggplant 22E85. Figure 6 (d) Since the analysis using this amplification primer 23QP925 requires the expensive KOD FX PCR enzyme (TOYOBO, KFX-101), and PCR amplification cannot be performed on some eggplant materials (possibly because the RU sequence is too long and complex, resulting in very low amplification efficiency), this amplification primer has no practical application value, and new amplification primers need to be developed.

[0082] 3. To further verify the repeat units in the SmMYB113 promoter, we developed a new amplification primer 23QP723 (F: CCAGGCTATCATCATATAGGGTGTT, SEQ ID NO: 10; R: AAAGTGAAATAATACGAAAAACCCCAT, SEQ ID NO: 11), with the front primer located upstream of the RU region and the reverse primer located within the RU region. Figure 6 (d) Consistent with the sequencing results, four ladder-shaped bands (~400bp, ~1200bp, ~1800bp, ~2500bp) were detected in the PCR product of 21E27, while only one band was detected in 21E26 and 22E85. Figure 6 (d) Because the amplification primer 23QP723 was not stable and had low amplification efficiency in some materials, a new amplification primer 23QP715 was further developed.

[0083] 4. Using the new amplification primer 23QP715, a total of 3 pairs of primers (Table 4), the relative copy number of RU in 21E26, 21E27, 22E85 and 92 other eggplant varieties was analyzed by real-time quantitative PCR. Figure 7 As shown, the RU copy number in non-photosensitive eggplant (p = 4.4092) e-22 The levels were significantly higher than those of photosensitive eggplant.

[0084] The method for real-time quantitative PCR is as follows:

[0085] The genomic DNA extracted from the eggplant sample was diluted to 50 ng / μL and used as a template for the amplification reaction. Real-time quantitative PCR amplification was performed using the three primer pairs shown in Table 4.

[0086] Table 423 QP715 Molecular Marker Sequence Information

[0087]

[0088]

[0089] After real-time quantitative PCR amplification, the relative repeat number (2^(-(Cq)) is calculated using the obtained Cq value. F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 ))).

[0090] IV. Analysis of Cis-Action Elements

[0091] Cis-acting element analysis of the RU region of SmMYB113 revealed a total of 51 cis-acting elements, of which 8 are related to photoresponse, including AE-box, Box4, AT1-motif, TCCC-motif, AAAC-motif, and I-box.

[0092] Based on the above findings, it is speculated that the RU repeat sequence (nucleotide sequence shown in SEQ ID NO:1) in the SmMYB113 promoter enables SmMYB113 to be expressed in non-photosensitive eggplant without light dependence, thereby enhancing anthocyanin accumulation even in the absence of light.

[0093] SEQ ID NO:1

[0094] AGTAAAATATTATTTAATTATATTATTAAAAAATATTGACTTTTAGATCTGTGCATTGCACA

[0095] AAATTATCGTAACTACCAAATTAATTAATGGTACTCTAGTTATGTCATATGCCAATCATTTT

[0096] TTGACTTTTTTAATTTCCTCCATTATTAATATTATCCATGTGGTGGAAAGGGGGTCAAGAA

[0097] ACAATCCTATTTGGTCACTACCAAAACTATTTTTTATTTTTACCAAATTAAATAATGGTACTT

[0098] TAGTTGGGCCATATGTCACTTGTTTTTTGATCATTCGAGTAATTTGCAATTTGCACCCATA

[0099] ATATATGCGTTTTTTTGTAATTTGCCCCTTATTTTATCATTTTTTGTGATTTGCACCTTAATTT

[0100] TTTTATTTCCTTACAAAATTGAGTATAATTTGTGATTTGCACCCCTAATGTATGCCCTTTTTT

[0101] TGTGGCTTGCACCTTATTCTATCATTTTTTGTGATTGGCACCTCAATCTTTTTATTTCATTG

[0102] CAAAATCATAAAAATTTAAAAAAAAAATCCAACAATTTTCAAAGGGTAAACAAGGAAA

[0103] ACAATGAATATTTCTATAAAAAGTATTTTATTCACGAGAAAATTAGGTGGATCCTCTTCTT

[0104] CTATCTTGGCAACATATAAAACAATTTAAAGGAAGCTTAAGTTTTGATTGTAAAATGAA

[0105] ACCCATATTTTTTTTGTGAGCCAAGAAAATGAAGCAGGAGAGGGAGATGAT

[0106] Example 2: Verification of the light-independent regulation of anthocyanin biosynthesis by SmMYB113 in non-photosensitive eggplant fruit

[0107] To verify the role of the RU repeat sequence in the regulation of anthocyanin synthesis in non-photosensitive eggplant fruit by the SmMYB113 gene, this example uses Micro-Tom tomatoes as material to conduct a genetic complementation experiment, obtaining proSmMYB113. 21E26 :SmMYB113 21E26 proSmMYB113 21E27 :SmMYB113wt and proSmMYB113 22E85 :SmMYB113 wt The transgenic strain.

[0108] 1. Cloning and vector construction of the target gene coding region and promoter region.

[0109] Using DNA from eggplant 21E27 as a template, and primers F:CCATGATTACGAATTCCCTCGGGTCTCTTTCTA (SEQ ID NO:12) and R:ATGGTCTAGAGGATCCATCAAGTAGATTCCATAAATCAAT (SEQ ID NO:13), the target gene (SmMYB113) and promoter region were cloned using PCR enzyme KOD FX (purchased from Toyobo (Shanghai) Biotechnology Co., Ltd.). The reaction system is shown in Table 5. The amplification program is shown in Table 6.

[0110] Table 5 KOD FX Amplification Reaction System

[0111] Composition Usage / uL 2xPCR buffer for KODFX 10 2mMdNTPs 4 F / R 1 Template DNA 1 KODFX 0.5 <![CDATA[ddH2O]]> 3.5

[0112] Table 6 KOD FX Reaction Amplification Program

[0113] Program number Operating requirements time 1 95℃ 2min 2 95℃ 10s 3 55℃ 20s 4 68℃ 3min 5 Go back to step 2, repeat 10 times. 6 95℃ 10s 7 68℃ 3min 8 68℃ 1min 9 Return to step 6, 24 cycles. 10 12℃ ∞

[0114] After purification (PCR products were recovered using the DNA gel recovery kit from Qingke Biotechnology Co., Ltd.), the cloned products were ligated into the binary expression vector pCAMBIA2300 using a one-step cloning method (HieffClone Plus one step cloning kit from Yisheng Biotechnology Co., Ltd.). The resulting cells were then transformed into Agrobacterium GV3101 via heat shock at -80℃, and the glycerol culture was retained for later use. The one-step cloning reaction system is shown in Table 7.

[0115] Table 7 One-step cloning reaction system

[0116] Components Recombination reaction Linearized carrier 5μL Insert fragment 3μL 2xHieffCloneEnzymePremix 10μL <![CDATA[ddH2O]]> Up to 20μL

[0117] 2. Genetic transformation of tomatoes

[0118] The experimental procedure is as follows:

[0119] (1) Explant preparation: Take clean tomato seeds, disinfect with 70% alcohol for 45 seconds, and rinse 3 times with sterile water; on a clean bench, treat with 10% sodium hypochlorite for 30 minutes, shaking continuously during the process, and rinse 5-6 times with sterile water to completely remove residual sodium hypochlorite; transfer the sterilized seeds to 1 / 2 MS medium for germination, place them in a 4℃ refrigerator for 3-4 days, and then place them in a light incubator at 28℃ / 16h, 20℃ / 8h for cultivation (treatment under dark conditions before germination can increase the uniformity of germination); after 7-9 days (preferably before the true leaves have emerged), collect the cotyledons in a moist petri dish; after all the cotyledons have been collected, transfer them to a pre-medium and pre-culture at 28℃ under dark conditions for 2 days.

[0120] (2) Agrobacterium preparation: 4-5 days in advance, streak plates (YEB solid medium, 25 mg / L rifampin, 50 mg / L kanamycin), incubate at 28℃ for 2 days to obtain well-isolated single colonies; select single colonies to YEB liquid medium (containing 25 mg / L rifampin, 50 mg / L kanamycin), and shake at 28℃ and 200 rpm until OD. 600 =0.5-0.8 (approximately 30-48h); after centrifugation at 4℃ and 6000rpm for 5min, collect the bacterial cells on a clean bench, suspend the bacterial cells in MSO liquid medium (containing 100ug / L acetylsyl syringone) for transformation.

[0121] (3) Co-culture: Immerse the explants in Agrobacterium suspension for 10-15 min, then blot off any remaining Agrobacterium liquid on the explants with sterile filter paper, transfer them to pre-culture medium (cotyledon upper surface facing up), and incubate at 28°C in the dark for 2-3 days. During the procedure, avoid damaging the explants with instruments as much as possible.

[0122] (4) Selective regeneration culture: After 2-3 days of co-culture, transfer the cotyledons to a selection medium with the upper surface of the cotyledons facing upwards. Transfer to a new selection medium every 2 weeks thereafter; after 3-4 weeks, promptly cut the callus with bud primordia into small pieces and transfer to a bud elongation medium for further culture; after 2-3 weeks of culture on the bud elongation medium, transfer the compact green callus (with or without green buds, small clusters of buds) to a new selection medium for continued culture; transfer small buds of about 1 cm to a new bud elongation medium; discard black / brown callus and loose or white callus. Transfer every two weeks, or more frequently if necessary; when the stem reaches 3-5 cm in length, separate the buds from the callus and transfer to a rooting medium. Do not retain any callus on the stem. After about 2-3 weeks, the seedlings should have a good root system; if not, re-sever the stem and transfer to a fresh rooting medium; seedlings of about 5-7 cm in length can be transplanted into sterile soil.

[0123] 3. Anthocyanin extraction from transgenic tomato lines

[0124] (1) Preparation of extraction solution (as shown in Table 8)

[0125] Table 8

[0126] reagents Usage Anhydrous methanol 32ml concentrated HCl 1ml <![CDATA[ddH2O]]> 66ml

[0127] (2) Take 1g of fresh sample into a mortar and grind it with liquid nitrogen;

[0128] (3) Transfer 0.5g of sample powder to a 10ml centrifuge tube, add 5ml of extraction solution and mix well;

[0129] (4) Wrap in aluminum foil (to protect from light) and refrigerate overnight at 4°C;

[0130] (5) Take out the centrifuge tube containing the sample and centrifuge at 5000 rpm and 4℃ for 6-10 min.

[0131] (6) Carefully aspirate (5ml syringe) the supernatant, filter through a 0.45μm filter, and dispense 3-4ml;

[0132] (7) The absorbance values ​​of A535 and A650 were determined by ultraviolet spectrophotometry.

[0133] The anthocyanin content C (mg / 100g) = (A*MW*DF*V)*100 / (ε*L*Wt), where A: absorbance; ε: extinction coefficient of cyanidin-3-glucoside; DF: dilution factor; MW: 449.2% of the anthocyanin-3-glucoside concentration; V: final volume (ml); L: optical path (1cm); Wt: sample mass.

[0134] 4. Phenotypic analysis of transgenic lines

[0135] The results are as follows Figure 8 As shown, from Figure 8 It can be seen that in proSmMYB113 21E27 :SmMYB113 wt and proSmMYB113 22E85 :SmMYB113 wt Anthocyanin accumulation was detected in unbagged fruit peels, in proSmMYB113 21E26 :SmMYB113 21E26 No anthocyanin accumulation was detected in the sample. Figure 8 (a) and (b) in the data verify that the mutation of SmMYB113 in 21E26 leads to loss of function. Furthermore, compared with proSmMYB113... 22E85 :SmMYB113 wt Compared to bagged tomatoes, proSmMYB113 21E27:SmMYB113 wt The bagged fruit exhibited a deeper purple color and higher anthocyanin content. Figure 8 (a and b in the text). Furthermore, the transcriptional level of SmMYB113 was identified in different materials. The results showed that, in both bagged and unbagged tomato fruits, SmMYB113 was present in proSmMYB113. 21E27 :SmMYB113 wt The expression of anthocyanins was high in the pericarp of all strains, consistent with the anthocyanin content. Figure 8 (c)

[0136] The results of this embodiment show that in non-photosensitive eggplant 21E27, the RU repeat sequence in the SmMYB113 promoter enables it to be transcribed and activate anthocyanin synthesis independently of light induction.

[0137] Based on the results of Examples 1 and 2, the RU repeat sequence (nucleotide sequence as shown in SEQ ID NO:1) in the SmMYB113 promoter is a molecular marker closely linked to the non-photosensitive trait of eggplant. The primers for amplifying this molecular marker (named 23QP715) include three pairs of primers, as shown in Table 4.

[0138] DNA was collected from the eggplant sample to be tested, and real-time quantitative PCR was performed using the primers listed in Table 4. The relative repeat number of the target fragment (2^(-(Cq)) was calculated based on the obtained Cq value. F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 If the relative repetition number is 2^(-(Cq) F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 If ))≥2, then the eggplant material to be tested is a non-photosensitive eggplant variety.

[0139] Example 3: Validation of molecular marker 23QP715 in natural eggplant populations

[0140] Using 264 eggplant varieties showcased at the 20th Guangdong Seed Industry Expo (2021) as materials, DNA was extracted from each variety. Real-time quantitative PCR was performed using primer 23QP715 to verify the accuracy of the molecular markers used in this invention. The results are shown in Table 9. Figure 9 As shown.

[0141] Table 9264 Information on Natural Populations of Eggplant

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149] From Table 9 and Figure 9 The results showed that, in 264 natural populations, the accuracy of the molecular markers of this invention was 95.8% (253 / 264) using primer 23QP715. Therefore, the molecular markers of this invention can be used to identify non-photosensitive eggplants.

[0150] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A primer combination for amplifying molecular markers tightly linked to non-photosensitive traits in eggplant, characterized in that, The molecular marker is composed of a forward primer as shown in SEQ ID NO:2 and a reverse primer as shown in SEQ ID NO:3, a forward primer as shown in SEQ ID NO:4 and a reverse primer as shown in SEQ ID NO:5, and a forward primer as shown in SEQ ID NO:6 and a reverse primer as shown in SEQ ID NO:7; the molecular marker is located in the eggplant. SmMYB113 The nucleotide sequence of the gene promoter, located at -1959 bp to -1234 bp, is shown in SEQ ID NO:

1.

2. A kit for detecting non-photosensitive eggplant varieties, characterized in that, Includes the primer combination described in claim 1.

3. The application of the primer combination of claim 1 or the kit of claim 2 in the identification or screening of non-photosensitive eggplant varieties, the application comprising: Using the DNA of the eggplant to be tested as a template, real-time quantitative PCR amplification was performed using the primer combination described in claim 1. The relative repeat number of the nucleotide sequence in the region shown in SEQ ID NO:1 was then calculated, where the relative repeat number = 2^(-(Cq)). F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 ))), where Cq F1 / R1 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:2 and the reverse primer shown in SEQ ID NO:

3. F2 / R2 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:

5. F3 / R3 The Cq value is obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO:6 and the reverse primer shown in SEQ ID NO:7; if the relative repeat number is ≥2, the eggplant to be tested is a non-photosensitive eggplant variety.

4. A method for identifying non-photosensitive eggplant varieties, characterized in that, Using the DNA of the eggplant to be tested as a template, real-time quantitative PCR amplification was performed using the primer combination described in claim 1. The relative repeat number of the nucleotide sequence in the region shown in SEQ ID NO:1 was then calculated, where the relative repeat number = 2^(-(Cq)). F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 ))), where Cq F1 / R1 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:2 and the reverse primer shown in SEQ ID NO:

3. F2 / R2 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:

5. F3 / R3 The Cq value is obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO:6 and the reverse primer shown in SEQ ID NO:7; if the relative repeat number is ≥2, the eggplant to be tested is a non-photosensitive eggplant variety.

5. A method for screening non-photosensitive eggplant varieties, characterized in that, Using the DNA of the eggplant to be tested as a template, real-time quantitative PCR amplification was performed using the primer combination described in claim 1. The relative repeat number of the nucleotide sequence as shown in SEQ ID NO:1 was then calculated, and eggplant varieties with a relative repeat number ≥ 2 were screened. The relative repeat number = 2^(-(Cq) F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 ))), where Cq F1 / R1 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:2 and the reverse primer shown in SEQ ID NO:

3. F2 / R2 Cq is the Cq value obtained by amplifying eggplant DNA using the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:

5. F3 / R3 The Cq value is obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO:6 and the reverse primer shown in SEQ ID NO:7.

Images