STS marker related to number of adventitious roots of wheat and application of STS marker

By developing InDel molecular markers and PCR primer pairs, the problem of identifying adventitious root numbers in wheat was solved, enabling rapid and accurate identification of adventitious root numbers and breeding optimization, thereby improving wheat productivity.

CN121992129APending Publication Date: 2026-05-08INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411557282.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-04
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

The difficulty in quickly and accurately identifying the number of adventitious roots in wheat leads to a delay in the optimization of adventitious root configurations, which in turn affects wheat productivity.

Method used

An InDel molecular marker was developed, and a DNA fragment with nucleotide sequence SEQ ID No: 1 from position 112 to 128 was designed for PCR amplification. Combined with DNA sequencing, restriction enzyme fragment length polymorphism and other methods, the adventitious root number of wheat was identified.

Benefits of technology

It enables rapid and accurate identification of adventitious root number in wheat, reduces the impact of environmental and human errors, and improves the accuracy and efficiency of breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention discloses an STS marker related to the number of adventitious roots of wheat and application of the STS marker. The invention provides an application of an InDel molecular marker, the InDel molecular marker is a DNA fragment from the 112th site to the 128 site of which the nucleotide sequence is SEQ ID NO: 1, the application is to identify or assist in identifying the number of adventitious roots of wheat, and the InDel molecular marker can be used for wheat breeding. The STS molecular marker provided by the invention can provide a strong selection site, improve the selection accuracy of a breeding material with a large number of adventitious roots, and realize the target of molecular marker-assisted selection of an excellent root system.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and crop breeding technology, specifically relating to molecular markers related to the number of adventitious roots in wheat and their applications. Background Technology

[0002] Wheat roots consist of primary roots and adventitious roots. Primary roots develop from seed germination to the emergence of the first complete leaf. Adventitious roots, as the main part of the root system, can occur on the main stem and at all tillering nodes, developing from tillering to heading and flowering. They are numerous and develop over a long period, serving as the core tissue for anchoring the aboveground plant and absorbing soil water and nutrients. Therefore, adventitious root architecture is closely related to wheat productivity. However, adventitious roots are hidden in the soil, making phenotypic identification difficult, causing their architecture optimization to lag far behind that of the aboveground plant. Therefore, discovering and utilizing molecular markers related to adventitious root architecture, and accelerating adventitious root architecture improvement through marker-assisted selection, is an urgent need for the sustainable development of wheat production. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to quickly identify the number of adventitious roots in wheat.

[0004] To address the aforementioned problems, this invention first provides an application of the InDel molecular marker, wherein the InDel molecular marker is a DNA fragment with nucleotide sequence SEQ ID No: 1, positions 112-128, and the application is the use of the InDel molecular marker in any of the following: A1) To identify or assist in the identification of the number of adventitious roots in wheat; A2) Preparation of products for identification or auxiliary identification of adventitious root number in wheat; A3) Wheat breeding; A4) Prepare products for wheat breeding.

[0005] This invention also provides an application of a substance for detecting InDel molecular markers, wherein the InDel molecular marker is a DNA fragment with nucleotide sequence SEQ ID No: 1, positions 112-128, and the application is the use of the substance in any of the following: B1) Identification or auxiliary identification of the number of adventitious roots in wheat; B2) Preparation of products for identification or auxiliary identification of adventitious root number in wheat; B3) Wheat breeding; B4) Prepare products for wheat breeding.

[0006] The indicators for wheat breeding mentioned above include the number of adventitious roots in wheat.

[0007] Furthermore, in the aforementioned application, the purpose of wheat breeding includes cultivating wheat with altered adventitious root numbers (either higher or lower than the parent).

[0008] In this application, "parent" refers to two different varieties or strains of plants used for hybridization, such as wheat.

[0009] In the above applications, the substance contains PCR primers for amplifying wheat genomic DNA fragments including the InDel molecular marker.

[0010] The PCR primers are primer pairs, which consist of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream of positions 1-23 of the double-stranded DNA shown in SEQ ID No: 1 of wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of positions 143-167 of the double-stranded DNA shown in SEQ ID No: 1 of wheat genomic DNA.

[0011] The forward primer may be a single-stranded DNA with the nucleotide sequence SEQ ID No: 2, and the reverse primer may be a single-stranded DNA with the nucleotide sequence SEQ ID No: 3.

[0012] In the above applications, the substance can be a substance that detects the InDel molecular marker using at least one of the following methods: DNA sequencing, restriction enzyme fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP microarray. The SNP microarray includes microarrays based on nucleic acid hybridization reactions, microarrays based on single-base extension reactions, microarrays based on allele-specific primer extension reactions, microarrays based on one-step reactions, microarrays based on primer ligation reactions, microarrays based on restriction endonuclease reactions, microarrays based on protein-DNA binding reactions, and microarrays based on fluorescent molecule-DNA binding reactions.

[0013] In the above applications, the PCR primers may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without a marker (e.g., direct sequence reading).

[0014] The present invention also provides a method for identifying the number of adventitious roots in wheat, comprising using the genomic DNA of the wheat to be identified as a template, performing PCR amplification with the above-mentioned specific primers to obtain a PCR product, and identifying the number of adventitious roots in wheat based on whether the PCR product contains the InDel molecular marker.

[0015] The present invention also provides a method for assisting in the identification of adventitious roots in wheat, comprising using the genomic DNA of the wheat to be identified as a template, performing PCR amplification with the above-mentioned specific primers to obtain PCR products, and identifying the number of adventitious roots in wheat based on whether the PCR products contain the InDel molecular marker described in claim 1.

[0016] In the above method, the identification of the number of adventitious roots of wheat based on whether the PCR product contains the InDel molecular marker can specifically be that the number of adventitious roots of the wheat to be identified containing the InDel molecular marker is greater than the number of adventitious roots of the wheat to be identified that does not contain the InDel molecular marker.

[0017] In the above method, the wheat can be a wheat inbred line or a pure line, and the wheat can also be a hybrid offspring obtained by crossing at least two of the following wheat varieties (such as F2 generation or higher, such as BC1F1 or higher): Jinmai 54, Zaoyou 504, Luonong 10, Han 4589, Beinong 2, Jimai 29, Huaishu 10, Jimai 41, Jinmai 91, Lumai 23, Lumai 15, Jingdong 8, Yumai 48, Yunhan 102, Shimai 15, Lumai 17, Beijing 8686, Qinmai 7, Zhongyou 9507, Luoyang 8628, Hengyou 18, and Xindong 20.

[0018] The wheat variety can specifically be a hybrid offspring of Jinmai 54 × Zaoyou 504, such as BC1F1, BC2F1, BC3F1, BC3F2, BC3F3, BC3F4, or BC3F5. In the Jinmai 54 × Zaoyou 504 hybrid combination, Jinmai 54 is the female parent and Zaoyou 504 is the male parent.

[0019] The present invention also provides a DNA molecule, wherein the DNA molecule is the InDel molecular marker described above.

[0020] The present invention also provides a specific primer for identifying or assisting in the identification of adventitious root numbers in wheat. The specific primer consists of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream of positions 1-23 of the double-stranded DNA shown in SEQ ID No: 1 of wheat genomic DNA. The reverse primer is a single-stranded DNA that specifically binds to the downstream of positions 143-167 of the double-stranded DNA shown in SEQ ID No: 1 of wheat genomic DNA.

[0021] The forward primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO: 2, and the reverse primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO: 3.

[0022] The present invention also provides a kit for identifying or assisting in the identification of adventitious root numbers in wheat, the kit containing the above-mentioned PCR primers.

[0023] Experiments of this invention demonstrate that the STS marker (PCR primers amplifying wheat genomic DNA fragments including the InDel molecular marker) located on wheat chromosome 4A, developed based on InDel (insertion / deletion) variants, can accurately genotype allelic variants related to the number of adventitious roots and predict the number of adventitious roots in wheat. Using marker-assisted selection breeding technology can effectively avoid the influence of environmental factors and human errors on phenotypic identification. The STS molecular marker of this invention can provide a strong selection signal, improve the accuracy of identifying the number of adventitious roots in wheat, and achieve the goal of marker-assisted selection for the number of adventitious roots. Attached Figure Description

[0024] Figure 1 STS marking gel diagrams with indeterminate root number.

[0025] Figure 2 The number of adventitious roots for Jinmai 54 and its near-isogenic lines. Detailed Implementation

[0026] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0028] Example 1: Localization, molecular marker, and detection method of InDel sites related to adventitious root number in wheat. A natural population was formed by collecting 323 wheat germplasm accessions from the winter wheat regions of northern China and the Huang-Huai winter wheat region.

[0029] The root phenotype of wheat at the grain-filling stage was identified in the field. Twenty wheat varieties were planted at the Changping Experimental Base of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, in 2022-2023. Each variety was sown in four-row plots, with a row length of 2m, a row spacing of 0.6m, and 20 holes at equal intervals per row, with 3 seeds per hole. Seedlings were thinned to three-leaf stage to ensure one seedling per hole. A triple replicate, randomized block design was used. The experimental plots were sandy loam soil, irrigated before winter, at the jointing stage, and at the flowering stage, with each irrigation volume of 750 m³ / ha. −1 Other management practices are the same as those in conventional field management. Fourteen days after flowering, five plants from the middle section of the plot were selected to identify the number of adventitious roots. Root phenotypic identification was performed using the excavation method, in which the plant roots along with the soil clods were dug out, the sandy loam soil attached to the roots was gently patted off, and the roots were cleaned and soaked with a sprayer, and the number of adventitious roots was counted.

[0030] To facilitate the identification of adventitious root number in wheat candidate materials, DNA was extracted from 20 wheat varieties, and genome resequencing was performed. The genome sequencing results were compared and analyzed to develop the InDel marker. PCR amplification and polypropylene thiocyanate gel electrophoresis were performed using the developed InDel marker, followed by QTL analysis. Based on the analysis results, the molecular marker 4A_InDel-17bp (corresponding to the DNA fragment at positions 112-128 of SEQ ID NO: 1) closely linked to the adventitious root number trait in wheat was obtained. The following STS marker primers were designed, and the primer sequences are shown below: Forward primer F: 5'-AGCAACGCCTCGAAGCTCCTCAC-3' (SEQ ID NO: 2) Reverse primer R: 5'-GTGTGACTAATGCATAACTCACTAA-3' (SEQ ID NO: 3).

[0031] Using the extracted genomic DNA of the wheat variety to be tested as a template, PCR was performed using the aforementioned forward primer F and reverse primer R. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd. After synthesis, the primers were diluted to 100 μM, and the reaction mixture is shown in Table 1 below. Table 1 PCR reaction system

[0032] The PCR amplification conditions were as follows: The reaction program was 95℃ for 5 min; 95℃ for 1 min, 54℃ for 1 min, 60℃ for 30 s (35 cycles); 68℃ for 10 min. The PCR products were detected by electrophoresis on a 4.0% agarose gel. A sequence length of 167 bp (SEQ ID NO: 1) indicates an insertion (In) allelic variant, and a sequence length of 150 bp (SEQ ID NO: 4) indicates a deletion (Del) allelic variant. Figure 1 ).

[0033] The specific sequence of sequence 1 (SEQ ID NO: 1, 167bp) in the sequence listing is as follows: 5'-AGCAACGCCTCGAAGCTCCTCACGAGCCTCCCGGCGACCGACCGCCGTGAGGCTGCGGTCACCATCTCCTACGAGGCACAGCCAGGCAACATGATCCGGTATATGGTTGCGTCGCGCACATATTTGCTCTGCAGCAGCAGGTTAGTGAGTTATGCATTAGTCACAC- 3'; The specific sequence of sequence 4 (SEQ ID NO: 4, 150bp) in the sequence listing is as follows: 5'-AGCAACGCCTCGAAGCTCCTCACGAGCCTCCCGGCGACCGACCGCCGTGAGGCTGCGGTCACCATCTCCTACGAGGCACAGCCAGGCAACATGATCCGGTATATGGTTGCTCTGCAGCAGCAGGTTAGTGAGTTATGCATTAGTCACAC-3'.

[0034] Based on the root system detection results of 20 wheat varieties (Table 2), it can be seen that the average number of adventitious roots of wheat germplasm with amplification product sequence 1 is greater than that of wheat germplasm with amplification product sequence 4.

[0035] Table 2. STS marker detection results and corresponding indeterminate roots

[0036] Therefore, the adventitious root number of the wheat sample can be detected using forward primer F and reverse primer R, as follows: The wheat samples were subjected to PCR reaction using forward primer F and reverse primer R, and the length of the PCR product sequence was detected. The number of adventitious roots of the wheat sample with a PCR product sequence length of 167 bp (SEQ ID NO: 1) was greater than that of the wheat sample with a PCR product sequence length of 150 bp (SEQ ID NO: 4).

[0037] Example 2: A method for identifying adventitious root numbers in wheat using specific primer pairs for detecting the InDel molecular marker (4A_InDel). This embodiment uses specific primers for detecting the InDel molecular marker (4A_InDel), composed of the forward primer F and the reverse primer R from Example 1, to identify the adventitious root number in wheat. The specific experimental method is as follows: Jinmai 54 was used as the female parent and Zaoyou 504 as the male parent for hybridization to obtain F1 seeds. F1 seeds were planted to obtain F1 individual plants, which were then backcrossed with Jinmai 54 to obtain BC1F1 seeds. BC1F1 seeds were planted at the Changping Experimental Base of the Institute of Crop Science, Chinese Academy of Agricultural Sciences. Rows were 2m long, with a row spacing of 0.6m, and 20 holes were sown at equal intervals per row, with 3 seeds per hole. Seedlings were thinned to three leaves to ensure one seedling per hole. The experimental plot had sandy loam soil and was irrigated before winter, at the jointing stage, and at the flowering stage, with each irrigation using 750 m³ of water. 3 ha −1 Other management practices are the same as routine field management. Before flowering, leaves from 100 individual plants (BC1F1-1 to BC1F1-100) were collected. Using the genomic DNA of these individual plant leaves as templates, and with the forward primer F and reverse primer R from Example 1 as primers, PCR amplification was performed according to the PCR system and PCR amplification reaction conditions of Example 1 to obtain amplification products. The amplification products were detected by gel electrophoresis, and the PCR products were recovered and sequenced. The sequencing results showed that the amplification products of 52 BC1F1 individual plants were DNA fragments with nucleotide sequences of SEQ ID No: 1 in the sequence listing, and their genotypes were named insertion type (In); the amplification products of 48 BC1F1 individual plants were DNA fragments with nucleotide sequences of SEQ ID No. 4 in the sequence listing, and their genotypes were named deletion type (Del).

[0038] Fourteen days after flowering, 100 individual BC1F1 plants (BC1F1-1 to BC1F1-100) were collected to identify the number of adventitious roots. Root phenotypic identification was performed using the excavation method, where the plant roots, along with the soil clod, were dug out, the sandy loam soil attached to the roots was gently patted away, and the roots were cleaned and soaked using a sprayer. The number of adventitious roots was then counted. The results are shown in Table 3.

[0039] Table 3. Genotypes and adventitious roots of 100 BC1F1 individual plants

[0040]

[0041] Data were processed using SPSS 11.5 statistical software, and one-way ANOVA was used to analyze the relationship between the insertion and deletion genotypes and the number of adventitious roots in wheat. The results are shown in Table 4, indicating that the number of adventitious roots in wheat with the insertion genotype was significantly higher than that with the deletion genotype.

[0042] Table 4. Association analysis between wheat InDel molecular marker genotypes and the number of adventitious roots in wheat.

[0043] Note: Different superscript letters indicate significant differences. P <0.01).

[0044] Example 3: Application of STS markers in assisted selection of multi-adventitious-root wheat germplasm Three near-isogenic lines (NILs) of Jinmai 54 (recipient parent) were screened from the backcross population of (Jinmai 54 × Zaoyou 504) × Jinmai 54 (BC3F5) as follows: NIL1 In NIL2 In and NIL3 In Jinmai 54 was used as the female parent and Zaoyou 504 was used as the male parent to cross and obtain F1 seeds. F1 seeds were planted to obtain F1 individual plants. F1 individual plants were backcrossed with Jinmai 54 to obtain BC1F1 seeds.

[0045] BC1F1 seeds were planted to obtain BC1F1 generation single plants. Using the genomic DNA from the leaves of these single plants as templates, and using the forward primer F and reverse primer R from Example 1 as primers, PCR amplification was performed according to the PCR system and PCR amplification reaction conditions of Example 1 to obtain the amplification product. The amplification product was detected by gel electrophoresis. The BC1F1 generation single plant with a PCR product of 167 bp was selected and backcrossed with Jinmai 54 to obtain BC2F1 seeds.

[0046] BC2F1 seeds were planted to obtain BC2F1 generation single plants. Using the genomic DNA from the leaves of these single plants as templates, and using the forward primer F and reverse primer R from Example 1 as primers, PCR amplification was performed according to the PCR system and PCR amplification reaction conditions of Example 1 to obtain the amplification product. The amplification product was detected by gel electrophoresis. BC2F1 generation single plants with a PCR product of 167 bp were selected and backcrossed with Jinmai 54 to obtain BC3F1 seeds.

[0047] Plant BC3F1 seeds to obtain BC3F1 generation single plants. Select BC3F1 generation single plants with PCR product of 167bp according to the above method for self-pollination to obtain BC3F2 seeds.

[0048] Plant BC3F2 seeds to obtain BC4F2 generation single plants. Select BC3F2 generation single plants with PCR product of 167bp according to the above method for self-pollination to obtain BC3F3 seeds.

[0049] Plant BC3F3 seeds to obtain BC3F3 generation single plants. Select BC3F3 generation single plants with PCR product of 167bp according to the above method for self-pollination to obtain BC3F4 seeds.

[0050] BC3F4 seeds were planted to obtain BC3F4 generation single plants. Following the method described above, BC3F4 generation single plants with a PCR product of 167 bp were selected for self-pollination to obtain BC3F5 seeds. Three near-isogenic lines (NILs) were obtained: NIL1 In NIL2 In and NIL3 In .

[0051] NIL1 In NIL2 In and NIL3 In BC3F5 seeds were planted at the Changping Experimental Base of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, in 2023-2024. Each material was sown in four plots, with a row length of 2m, a row spacing of 0.6m, and 20 holes at equal intervals per row, with 3 seeds per hole. Seedlings were thinned to three-leaf stage to ensure one seedling per hole. A triple replicate, randomized block design was used. The experimental plots were sandy loam soil, irrigated before winter, at the jointing stage, and at the flowering stage, with each irrigation using 750 m³ / ha. −1Other management practices are the same as routine field management. Fourteen days after flowering, five plants from the middle section of the plot were selected. The number of adventitious roots was identified using the method described above, and leaves were taken. Using the genomic DNA from these leaves as a template, and with the forward primer F and reverse primer R from Example 1 as primers, PCR amplification was performed according to the PCR system and PCR amplification conditions of Example 1 to obtain the amplified products. The amplified products were detected by gel electrophoresis, and the PCR products were recovered and sequenced. The sequencing results showed NIL1... In NIL2 In and NIL3 In The amplification products of each of the five individual plants were all DNA fragments with nucleotide sequences of SEQ ID No: 1 in the sequence listing, and their genotypes were insertion type (In); the amplification products of the five individual plants of Jinmai 54 were all DNA fragments with nucleotide sequences of SEQ ID No. 4 in the sequence listing, and their genotypes were deletion type (Del).

[0052] II. Identification of adventitious root number by field excavation method The method was the same as in Example 1. The number of adventitious roots of the recipient parent Jinmai 54 and three near-isogenic lines was identified, and the results are shown in Table 5 below.

[0053] The adventitious root count results of the inserted (In) Jinmai 54 and its three near-isogenic lines are as follows: Figure 2 As shown in the figure, the number of adventitious roots of Jinmai 54 and the three near-isogenic lines showed highly significant differences through analysis of variance. P <0.01), the number of adventitious roots of Jinmai 54, with an amplified product sequence length of 150 bp, was 53, while the number of adventitious roots of the near-isogenic line NIL1, with an amplified product sequence length of 167 bp, was 53. In NIL2 In NIL3 In The indefinite roots are 61, 63.3, and 67.3 respectively. Figure 2 ).

[0054] This shows that wheat with the 4A_InDel-17bp genome has a significantly higher number of adventitious roots than wheat without it. This indicates that the number of adventitious roots in wheat can be predicted by detecting the presence of the 4A_InDel-17bp sequence in the wheat genome. Therefore, detecting the presence of the 4A_InDel-17bp sequence in the wheat genome can quickly and accurately identify the number of adventitious roots in wheat.

[0055] In the breeding of wheat varieties with excellent root traits, it is best to select wheat with the genotype of insertion containing 4A_InDel-17bp as the parent for breeding.

[0056] Three BC4F5 generation single plants with genotype Y were selected as near-isogenic lines, and the results were shown in Table 5 along with Jinmai 54: The PCR product sequence length using the genomic DNA of the parent Jinmai 54 as a template was 150 bp, and the PCR product sequence length using the genomic DNA of near-isogenic line materials as a template was 167 bp.

[0057] Table 5. Marker detection results and root system results

[0058] The STS molecular markers of this invention have clearly defined sequences and primers, and through case studies, they can be directly used for marker-assisted selection breeding.

[0059] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

[0060] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of InDel molecular markers, characterized by: The InDel molecular marker is a DNA fragment with nucleotide sequence SEQ ID NO: 1, positions 112-128, and the application is the application of the InDel molecular marker in any of the following: A1) To identify or assist in the identification of the number of adventitious roots in wheat; A2) Preparation of products for identification or auxiliary identification of adventitious root number in wheat; A3) Wheat breeding; A4) Prepare products for wheat breeding.

2. The application of detecting InDel-labeled substances, characterized in that: The InDel molecular marker is a DNA fragment with nucleotide sequence SEQ ID NO: 1, positions 112-128, and the application is the use of the substance in any of the following: B1) Identification or auxiliary identification of the number of adventitious roots in wheat; B2) Preparation of products for identification or auxiliary identification of adventitious root number in wheat; B3) Wheat breeding; B4) Prepare products for wheat breeding.

3. The application according to claim 1, characterized in that, The substance contains PCR primers for amplifying wheat genomic DNA fragments including the InDel molecular marker.

4. The application according to claim 2, characterized in that, The PCR primers are primer pairs, which consist of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream of positions 1-23 of the double-stranded DNA shown in SEQ ID NO: 1 of wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of positions 143-167 of the double-stranded DNA shown in SEQ ID NO: 1 of wheat genomic DNA.

5. The application according to claim 4, characterized in that, The forward primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO: 2, and the reverse primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO:

3.

6. A method for identifying or assisting in the identification of adventitious root numbers in wheat, comprising using the genomic DNA of the wheat to be identified as a template, performing PCR amplification with the PCR primers described in claims 3, 4 or 5 to obtain PCR products, and identifying the adventitious root numbers of wheat based on whether the PCR products contain the InDel molecular marker described in claim 1.

7. A DNA molecule, characterized by, The DNA molecule is the InDel molecular marker as described in claim 1.

8. Specific primers for identifying or assisting in the identification of adventitious root numbers in wheat, characterized in that: The specific primer consists of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream of positions 1-23 of the double-stranded DNA shown in SEQ ID No: 1 of wheat genomic DNA. The reverse primer is a single-stranded DNA that specifically binds to the downstream of positions 143-167 of the double-stranded DNA shown in SEQ ID No: 1 of wheat genomic DNA.

9. The specific primer according to claim 8, characterized in that, The forward primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO: 2, and the reverse primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO:

3.

10. A kit for identifying or assisting in the identification of adventitious root number in wheat, characterized in that: The kit contains the PCR primers as described in claim 3, 4 or 5.