Molecular marker for detecting functional mutation of wheat stem-lowering gene TaNAC100-2A and application of molecular marker in breeding

By developing the molecular marker NAC-2A_CDS129, which represents a functional mutation in the wheat lodging gene TaNAC100-2A, and utilizing KASP molecular marker technology and a real-time quantitative PCR system, the problem of wheat lodging was solved, and breeding efficiency and yield were improved.

CN120989294APending Publication Date: 2025-11-21HENAN LIFENG AGRI SCI & TECH DEV CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511481954.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Current technologies have not been able to effectively tap into wheat stem-lowering genes, which hinders wheat lodging and mechanized harvesting, affecting wheat yield and safety.

Method used

A molecular marker, NAC-2A_CDS129, was developed to detect functional variations in the wheat dwarf gene TaNAC100-2A. High-throughput detection was performed using KASP molecular marker technology and a real-time quantitative PCR system to screen for superior germplasm with dwarf genotypes.

Benefits of technology

Marker-assisted selection improves wheat breeding efficiency, reduces lodging damage, promotes the breeding process of dwarf wheat, and increases wheat yield and mechanized harvesting efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989294A_ABST
    Figure CN120989294A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker for detecting functional mutation of a wheat stem-lowering gene TaNAC100-2A and application of the molecular marker in breeding, and relates to the technical field of wheat breeding, and the molecular marker can be combined with plant height phenotype to screen out excellent germplasm carrying the stem-lowering gene through marker-assisted selection, so that the molecular marker is used for cultivating lodging-resistant varieties of wheat. According to the application, the breeding efficiency can be effectively improved, the lodging-resistant breeding process of the wheat is accelerated, and important technical support is provided for cultivating high-resistance wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of wheat breeding technology, specifically to a molecular marker for detecting functional abnormalities in the wheat stem-lowering gene TaNAC100-2A and its application in breeding. Background Technology

[0002] Wheat is one of my country's three major grain crops, making a significant contribution to ensuring national food security. Ensuring high and stable wheat yields is crucial for safeguarding national food security. Wheat plant height is a significant factor affecting wheat yield. Under extreme weather conditions, excessively tall plants can lead to lodging, reducing yields and hindering mechanized harvesting, seriously threatening wheat production. Newly developed wheat varieties have shown significantly reduced plant height, but the genes influencing wheat plant height have not yet been fully identified. Identifying wheat lodging-reducing genes / locusts, developing functional markers for rapid, high-throughput detection of these genes / locusts, screening superior germplasm containing these genes / locusts, and breeding and promoting dwarf wheat varieties are effective means to mitigate wheat lodging damage.

[0003] TaNAC100-2A is a gene on wheat chromosome 2A that affects wheat plant height and agronomic traits. Previous reports have shown that transgenic plants homozygous overexpressing the TaNAC100 gene have a plant height that is 4.6-13.0% lower than wild-type plants, confirming that TaNAC100 has a function in regulating wheat plant height. However, there are currently no reports on the development of markers for this gene or its application in wheat dwarfing breeding. Therefore, analyzing the gene structure of TaNAC100 and developing breeding-friendly markers for TaNAC100 for wheat dwarfing breeding is crucial for the application of this gene. To improve the efficiency of TaNAC100 breeding applications, this invention analyzed the structure of three homologous genes of TaNAC100 in the second homologous group of wheat: TaNAC100-2A, TaNAC100-2B, and TaNAC100-2D. One functional variant affecting plant height was screened in the coding region of the TaNAC100-2A gene. Based on this, we will develop molecular markers that can detect functional variations of TaNAC100-2A in high throughput, screen germplasm resources with the TaNAC100-2A dwarf genotype, and improve the process of wheat dwarf breeding. This is of great significance for reducing the damage caused by wheat lodging. Summary of the Invention

[0004] The present invention aims to provide a molecular marker for detecting functional abnormalities in the wheat stem-lowering gene TaNAC100-2A and its application in breeding.

[0005] This invention protects a molecular marker for detecting functional variations in the wheat stem-reducing gene TaNAC100-2A. The molecular marker is named NAC-2A_CDS129, which corresponds to the functional allelic variant SNP129 in the CDS region of the wheat stem-reducing gene TaNAC100-2A. The molecular marker is C or A, corresponding to the complementary strand G or T.

[0006] This invention also protects primer pairs for amplifying the above-mentioned molecular marker, which is a high-throughput SNP marker, comprising two forward primers and one reverse primer; the primer sequences are as follows: NAC-2A_CDS129-FAM: 5' GTCATGCACGAGTACCGCC 3', the nucleotide sequence of which is shown in SEQ ID NO.1; NAC-2A_CDS129-HEX: 5' GTCATGCACGAGTACCGCA 3', whose nucleotide sequence is shown in SEQ ID NO.2.

[0007] NAC-2A_CDS129-R: 5' ACAAGCAAAAGCAAGATACATGT 3', whose nucleotide sequence is shown in SEQ ID NO.3.

[0008] This invention also protects a detection kit containing the above primer pairs for identifying KASP molecular markers associated with wheat plant height.

[0009] This invention also protects the application of the above primer pairs or the above detection kit in molecular marker-assisted wheat plant height selection breeding, specifically as follows: Using the DNA of the wheat sample to be tested as a template, PCR amplification was performed on the template using the primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively; Genotyping of amplified PCR products was performed using the Applied Biosystems™ QuantStudio™ 1 Plus real-time quantitative PCR system. The distribution results of SNPs in wheat were collected, and the criteria for determination were the color of the dots and their clustering position on the horizontal or vertical axis. A red signal clustered with the horizontal axis and the dwarf control parent was identified as the dwarf genotype G / G; a blue signal clustered near the vertical axis and with the tall control parent was identified as the tall genotype T / T.

[0010] Using the molecular marker NAC-2A_CDS129 provided by this invention, the functional variant site SNP129, which has a significant impact on wheat plant height, can be correctly distinguished. Based on the results and plant height phenotype, marker-assisted selection can be carried out to screen superior germplasm containing dwarf alleles for wheat breeding, thereby improving breeding efficiency and accelerating the process of wheat dwarfing breeding. Attached Figure Description

[0011] Figure 1 shows the identification of functional allelic variations and amino acid sequence variations in the CDS region of the TaNAC100-2A debulking gene, among which... Figure 1a It is a G / T variant. Figure 1b E / D variant; Figure 2 Genotyping diagram of molecular marker NAC-2A_CDS129 in 160 wheat varieties; Figure 3 The results of NAC-2A_CDS129 detection in 160 wheat varieties. Detailed Implementation

[0012] To facilitate understanding of the present invention, a more comprehensive description will be given below in conjunction with the accompanying drawings and specific embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and complete understanding of the disclosure of the present invention.

[0013] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention. The technical solutions of the present invention will be described more clearly and completely below with reference to specific embodiments and comparative examples.

[0014] Note: The wheat varieties (lines) used in the embodiments of this invention are all parent populations or varieties (lines) constructed from conventional parent varieties, which can be obtained from the market or other public channels.

[0015] I. Extraction of wheat genomic DNA 1) At the three-leaf stage of wheat, select tender wheat leaves, number them, place them in the corresponding 2 mL 96-well plates, dry them using a freeze dryer, and then grind them into powder using a high-throughput tissue grinder. 2) After adding 800 μL of CTAB solution, place in a 65℃ water bath for 60 minutes, gently shaking 3-5 times during the process; 3) Add 800 μL of chloroform-isoamyl alcohol (volume ratio 24:1) and gently shake for 10 minutes (operate in a fume hood). 4) After centrifuging at 12000 rpm for 10 min, take 600 μL of supernatant and place it in a new 96-well plate with the corresponding number. Add an equal volume of isopropanol and 1 / 10 volume of 3M sodium acetate to the supernatant. 5) After centrifuging at 12000 rpm for 10 min, discard the supernatant and wash twice with ice-cold ethanol (70%). 6) After drying until there is no ethanol smell, add 200 μL of double-distilled water, dissolve completely, and store in a -20℃ refrigerator.

[0016] II. Primer Design Using the wheat omics website (http: / / wheatomics.sdau.edu.cn / ), the TaNAC100-2A gene sequences of 20 wheat varieties were downloaded. The CDS and amino acid sequences of TaNAC100-2A were predicted using the ORF finder software provided by the NCBI database. DNAMAN 8.0 was used to compare the CDS and amino acid sequences of the TaNAC100-2A gene, revealing a G / T variation at 129 bp in the CDS sequence. Figure 1a As shown), this SNP leads to an E / D variation in the amino acid sequence ( Figure 1b As shown), KASP tags were designed using Polymarker software: The labeled primers consist of two forward primers and one reverse primer, as shown in SEQ NO.1, SEQ NO.2 and SEQ NO.3, respectively.

[0017] III. Primer dilution and test primer mixing The three primers were diluted to 10 μM with ultrapure water and then mixed in a volume ratio of FAM: HEX: R: ultrapure water = 6:9:15:20. The mixed primers were stored at -20°C for later use.

[0018] IV. PCR Amplification The PCR amplification system was prepared in the following proportions: 3 μL DNA template, 3 μL 2× Master Mix (LGC group UK) and 0.08 μL KASP primer mixture (synthesized by Shanghai Sangon Biotech Co., Ltd.).

[0019] The KASP-labeled PCR amplification procedure is as follows: 1) 94℃ for 15 min; 2) 94℃ for 20 seconds; 3) 65℃-57℃ for 1 min; Steps 2) to 3) 10 cycles, each cycle -0.8℃; 4) 94℃ for 20 seconds; 5) 57℃ for 1 min s, steps 4) to 5) 38 cycles; 6) Store at 4℃.

[0020] V. Results Analysis Genotyping of amplified PCR products was performed using the Applied Biosystems™ QuantStudio™ 1 Plus real-time quantitative PCR system, and the distribution results of SNPs in wheat were collected (e.g., Figure 2 The criteria for determination are the color of the points and their position on the horizontal or vertical axis: a red signal clustered with the horizontal axis and the dwarf control parent indicates a dwarf genotype G / G; a blue signal clustered near the vertical axis and with the tall control parent indicates a tall genotype T / T.

[0021] VI. Validation of the effect of the stem-reducing gene TaNAC100-2A molecular marker NAC-2A_CDS129 in wheat stem-reducing breeding Using the molecular markers provided in this invention, 160 wheat varieties were analyzed, resulting in 31 dwarf genotype wheat varieties (genotype G / G) and 129 tall genotype wheat varieties (genotype T / T). The plant height of wheat varieties containing the dwarf genotype was significantly lower than that of wheat varieties containing the tall genotype, indicating that the functional variant SNP129 in the CDS region of the dwarfing gene TaNAC100-2A has a significant impact on wheat plant height (see [link to invention]). Figure 3 Based on the results and plant height phenotype, marker-assisted selection was conducted to screen for superior germplasm containing the barium-lowering gene for wheat breeding, thereby improving breeding efficiency and accelerating the process of wheat lodging resistance breeding.

[0022] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A molecular marker for detecting functional abnormalities in the wheat stem cell reduction gene TaNAC100-2A, characterized in that, The molecular marker is named NAC-2A_CDS129, which corresponds to the functional allelic variant SNP129 at 129 bp in the CDS region of the wheat stem-lowering gene TaNAC100-2A. The molecular marker is C or A, corresponding to the complementary strand G or T.

2. The primer pair for amplifying the molecular marker of claim 1, characterized in that, This is a high-throughput SNP marker, consisting of two forward primers and one reverse primer; the primer sequences are as follows: NAC-2A_CDS129-FAM: 5' GTCATGCACGAGTACCGCC 3', the nucleotide sequence of which is shown in SEQ ID NO.1; NAC-2A_CDS129-HEX: 5' GTCATGCACGAGTACCGCA 3', its nucleotide sequence is shown in SEQ ID NO.

2. NAC-2A_CDS129-R: 5' ACAAGCAAAAGCAAGATACATGT 3', whose nucleotide sequence is shown in SEQ ID NO.

3.

3. A detection kit containing the primer pair of claim 2 for identifying molecular markers associated with wheat plant height.

4. The application of the primer pair of claim 2 or the detection kit of claim 3 in molecular marker-assisted wheat plant height selection breeding.

5. The application according to claim 4, characterized in that, The specific steps are as follows: Using the DNA of the wheat sample to be tested as a template, PCR amplification was performed on the template using the primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively; Genotyping of amplified PCR products was performed using the Applied Biosystems™ QuantStudio™ 1 Plus real-time quantitative PCR system. The distribution results of SNPs in wheat were collected. The criteria for determination were the color of the dots and their position on the horizontal or vertical axis. The signal was red, and if the dots clustered together with the horizontal axis and the dwarf control parent, they were determined to be the dwarf genotype G / G. If the signal is blue and clusters near the vertical axis and together with the tall control parent, it is determined to be the tall genotype T / T.