SNP marker combination for apple fruit skin color degree marker assisted selection, probe set and application thereof

By developing SNP marker combinations and probe sets for apple fruit coloration marker-assisted selection, the problems of predictive comprehensiveness and limited application effect in existing technologies have been solved, enabling precise breeding of apple fruit coloration and improving breeding efficiency and accuracy.

CN120485422BActive Publication Date: 2026-03-24CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-19
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

The existing SNP marker combinations have limited predictive comprehensiveness and application effectiveness in molecular-assisted breeding of apple fruit coloration, making it difficult to meet the needs of precision breeding.

Method used

A marker-assisted selection (SNP) combination for apple fruit coloration was developed, comprising four SNP markers (SNP1 to SNP4) and corresponding GenoBaits DNA probe sets, for marker-assisted selection in the seedling stage, integrating superior alleles related to coloration from wild and closely related species of the genus Malo.

Benefits of technology

It enables comprehensive and accurate prediction of apple fruit coloration, covering multiple allele loci, improving the precision and efficiency of breeding, and reducing costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485422B_ABST
    Figure CN120485422B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of plant molecular breeding, and particularly relates to a SNP marker combination for marker-assisted selection of apple fruit surface color degree, a probe set and application thereof. The SNP marker combination is composed of four SNP markers; the four SNP markers include SNP1 to SNP4; the nucleotide sequences of the SNP1 to the SNP4 are shown in SEQ ID NO. 1 to SEQ ID NO. 4 in turn. The present application provides a SNP marker combination for marker-assisted selection of apple fruit surface color degree, which can be applied to marker-assisted selection of apple fruit surface color degree traits at the seedling stage of apple hybrid offspring.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant molecular breeding, and particularly relates to a SNP marker combination for marker-assisted selection of apple fruit surface color degree, a probe set and application thereof. BACKGROUND

[0002] Apple fruit surface color degree is an important fruit appearance quality trait, and the red color of the fruit surface is mainly determined by anthocyanin content. Consumers on the market currently prefer red apples, and the methods for increasing apple fruit surface color degree on the production mainly include the following points: increasing light utilization rate through bagging, pruning and leaf picking; laying reflective film; and applying fertilizer during the growth period. However, the existing methods for increasing apple fruit surface color degree have the disadvantages of high cost and unstable effect, and therefore, breeding new varieties with high fruit surface color degree is the best way to improve fruit appearance quality.

[0003] Conventional hybrid breeding is the main way of apple breeding, which relies on phenotypic screening to breed offspring with high fruit surface color degree. Apple fruit surface color degree is a trait controlled by major genes MdMYB1 and multiple genes. Genome-wide association analysis of 160 apple varieties found only one simple sequence repeat significant marker Mdo.chr9.4 related to the depth of fruit surface color, although the SNP marker based on the MdMYB1 gene in the existing research can reach a prediction accuracy of more than 80% for apple fruit surface color degree, the existing marker combination still has significant limitations: the single allele site covered cannot integrate the excellent alleles related to color degree in Malus wild species and close relatives, and cannot comprehensively analyze the genetic mechanism of apple fruit surface color degree. This leads to the limitation of the comprehensive prediction and application effect of the existing SNP marker combination in molecular assisted breeding for fruit surface color degree, and it is difficult to meet the demand for precise breeding. Therefore, the molecular marker of apple fruit surface color degree still needs to be excavated, and further more sufficient basis for apple molecular assisted breeding is provided. SUMMARY

[0004] In order to solve the problem that the comprehensive prediction and application effect of the existing SNP marker combination in molecular assisted breeding for fruit surface color degree are limited, and it is difficult to meet the demand for precise breeding in the prior art, the present application provides a SNP marker combination suitable for marker-assisted selection of apple fruit surface color degree, which realizes marker-assisted selection of apple fruit surface color degree at the seedling stage. In order to achieve the above purpose, the technical scheme adopted by the present application is as follows.

[0005] One of the purposes of the present application is to provide a SNP marker combination for marker-assisted selection of apple fruit surface color degree, which is composed of four SNP markers; the four SNP markers include SNP1 to SNP4.

[0006] The SNP1 is Chr00_8912122, the nucleotide sequence of which is shown as SEQ ID NO. 1, wherein a G to T mutation exists at position 201bp.

[0007] The SNP2 is Chr06_28125821, the nucleotide sequence of which is shown as SEQ ID NO. 2, wherein a A to C mutation exists at position 201878bp.

[0008] The SNP3 is Chr09_34074567, the nucleotide sequence of which is shown as SEQ ID NO. 3, wherein a A to G mutation exists at position 201bp.

[0009] The SNP4 is Chr09_35557774, the nucleotide sequence of which is shown as SEQ ID NO. 4, wherein a A to T mutation exists at position 201bp.

[0010] The SNP marker combination provided by the present application has comprehensive excellent alleles related to color degree in Malus wild species and close species, is accurate in prediction, covers multiple allele sites, can integrate excellent alleles related to color degree in Malus wild species and close species, and can solve the problems that the prediction comprehensiveness and application effect of the existing SNP marker combination in molecular assisted breeding are limited, and it is difficult to meet the demand for precise breeding.

[0011] The second purpose of the present application is to provide a probe set of an SNP marker combination for detecting the apple fruit surface color degree marker assisted selection, comprising GenoBaits DNA probes for detecting the SNP1 to the SNP4.

[0012] The nucleotide sequences of the GenoBaits DNA probes for detecting the SNP1 are shown in SEQ ID NO. 5 in turn.

[0013] The nucleotide sequences of the GenoBaits DNA probes for detecting the SNP2 are shown in SEQ ID NO. 6 in turn.

[0014] The nucleotide sequences of the GenoBaits DNA probes for detecting the SNP3 are shown in SEQ ID NO. 7 in turn.

[0015] The nucleotide sequences of the GenoBaits DNA probes for detecting the SNP4 are shown in SEQ ID NO. 8 in turn.

[0016] The third object of the present application is to use the SNP marker combination for identifying apple germplasm resources and selecting selected parents by using the apple fruit surface color degree marker assisted selection, so as to make full use of excellent allelic variation in apple relatives and wild species.

[0017] The fourth object of the present application is to provide application of the SNP marker combination or the probe set in preparing a kit for determining apple fruit surface color degree.

[0018] Preferably, the kit comprises the probe set.

[0019] The fifth object of the present application is to provide a kit for determining apple fruit surface color degree, which comprises the SNP marker combination or the probe set.

[0020] The sixth object of the present application is to provide application of the SNP marker combination, the probe set or the kit in determining apple fruit surface color degree.

[0021] Preferably, the kit comprises the following steps:

[0022] Genomic DNA of the apple plant to be tested is extracted.

[0023] PCR amplification is performed on the genomic DNA of the apple plant to be tested by using the probe set, so as to obtain a PCR amplification product.

[0024] The PCR amplification product is subjected to typing detection.

[0025] The fruit surface color degree of the apple plant to be tested is determined.

[0026] Preferably, when the genotype at Chr09_34074567 is AA, the fruit surface color degree of the apple plant to be tested is less than 40%, and the apple plant to be tested is marked as Y.

[0027] When the genotype at Chr00_8912122 is AA, the genotype at Chr06_28125821 is CC or the genotype at Chr09_35557774 is AA, the fruit surface color degree of the apple plant to be tested is greater than 70%, and the apple plant to be tested is marked as R.

[0028] When the above two conditions are not met, the fruit surface color degree of the apple plant to be tested with the remaining genotype combination is 40% to 70%, and the apple plant to be tested is marked as M.

[0029] The fruit surface color degree refers to the red coverage area of the apple fruit surface.

[0030] Compared with the prior art, the present application has the following beneficial effects:

[0031] 1. The application provides a SNP marker combination for marker-assisted selection of apple fruit surface color degree, the SNP marker combination comprises four apple fruit surface color degree related major SNP markers, namely four SNP markers; the four SNP markers comprise SNP1 to SNP4. The nucleotide sequences of the SNP1 to the SNP4 are shown in SEQ ID NO. 1~SEQ ID NO. 4 in turn. The SNP marker combination is suitable for molecular-assisted evaluation, screening and breeding scheme design of Malus germplasm resources. The SNP marker combination provided by the application has comprehensive excellent alleles related to color degree in wild species and close relatives of Malus, is accurate in prediction, covers multiple allele sites, can integrate excellent alleles related to color degree in wild species and close relatives of Malus, and can solve the problems that the prediction comprehensiveness of the existing SNP marker combination for fruit surface color degree in molecular-assisted breeding and application effect are limited, and it is difficult to meet the demand of precise breeding.

[0032] 2. The application focuses on major variation sites for controlling fruit surface color degree other than MYB1, develops SNP markers, and applies the SNP markers to marker-assisted selection of apple fruit surface color degree traits in seedling stage of apple hybrid offspring.

[0033] 3. The application is applied to genotype evaluation of fruit surface red variation sites of Malus germplasm resources, selection of parent matching hybrid combinations, and guidance of apple molecular breeding.

[0034] 4. The application develops four apple fruit surface color degree trait related major SNP markers, has low cost and high selection accuracy. DETAILED DESCRIPTION

[0035] Figure 1 The four apple fruit surface color degree trait related major SNP markers in the application are applied to marker-assisted selection of apple fruit surface color degree. DETAILED DESCRIPTION

[0036] The application will be described in detail below in combination with the drawings and specific embodiments, but should not be understood as limitation of the application. If not specially stated, the technical means used in the following embodiments are conventional means familiar to those skilled in the art, and the materials, reagents and the like used in the following embodiments can be obtained from commercial channels if not specially stated.

[0037] The test materials used in the embodiments of the application are as follows:

[0038] The apple materials used in the embodiments of the application include purple pearl, red Fuji, gold crown and red jade, and the specific sources are apple breeding bases in Beidaihe New Area of Qinhuangdao City, Hebei Province.

[0039] The 361 germplasm resources used in the examples were from the apple breeding base in Xingquangdao, Hebei Province.

[0040] Example 1

[0041] 1. Phenotypic identification of apple fruit skin color

[0042] Using 361 apple germplasm resources and 5560 hybrid progeny lines of three hybrid populations of ‘Zise Mingzhu’ x ‘Red Fuji’, ‘Zise Mingzhu’ x ‘Jinguan’, and ‘Hongyu’ x ‘Jinguan’, the fruit skin color of F1 hybrid seedling trees at the mature stage was investigated by visual inspection for five consecutive years. The ratio of red area to total area of the fruit skin was used as an evaluation index.

[0043] 2. Mining of apple fruit skin color variation sites

[0044] BSA-seq was used to mine QTL sites related to fruit skin color in the hybrid progeny population. Two extreme phenotype pools were constructed from the three hybrid combinations, and the DNA of the samples in the two pools was extracted and mixed in equal amounts. High-throughput sequencing was performed to obtain the genomic data of the extreme phenotype. By aligning the reference genome, the difference in allele frequency of each SNP site in the two pools was calculated, and the sites with significant differences were determined as candidate QTL sites.

[0045] A total of 22 QTLs were detected in 3 hybrid combinations. For Malus germplasm resources, GWAS was used to mine the fruit color trait associated intervals. The Malus germplasm resources and their phenotypic data were collected, the population was SNP typed, and the association between each SNP and the phenotype was analyzed using statistical models. Through significance threshold screening, 15 significant intervals were obtained.57 loci related to fruit skin color were obtained by the two methods, which were Chr00_8912122, Chr00_8912132, Chr00_8912154, Chr00_49172079, Chr00_49448711, Chr01_24056475, Chr01_24598548, Chr02_4194776, Chr02_14658899, Chr03_26163837, Chr04_19998777, Chr05_33334193, Chr05_36563053, Chr05_37652411, Chr05_45823619, Chr05_45825252, Chr06_6190330, Chr06_6396613, Chr06_6948124, Chr06_22672602, Chr06_25973045, Chr06_26704604, Chr06_26733868, Chr06_28125821, Chr06_32273327, Chr08_2089437, Chr08_4081610, Chr08_4870463, Chr08_21075052, Chr09_19032403, Chr09_32264945, Chr09_32573116, Chr09_32717443, Chr09_33001601, Chr09_33305721, Chr09_33801013, Chr09_34071319, Chr09_34074567, Chr09_34269485, Chr09_34594412, Chr09_35135106, Chr09_35486247, Chr09_35557774, Chr09_35867856, Chr09_36364387, Chr10_1527990, Chr10_28655035, Chr11_29379387, Chr11_41526745, Chr12_4644669, Chr12_21214664, Chr13_42366285, Chr14_31245687, Chr15_1934733, Chr15_23183829, Chr15_31183115 and Chr16_40024381.

[0046] 3. Development of molecular markers of apple fruit skin color variation loci

[0047] According to the variation type, gene expression quantity and functional annotation, the variation sites of candidate genes in each QTL site and GWAS interval related to the color degree of apple fruit surface were selected. The specific implementation method is as follows:

[0048] Take the leaf of the material to be tested, extract the genomic DNA, accurately quantify the genome with Qubit® dsDNA HS Assay Kit, use GenoBaits® DNA Library Prep Kit for ILM for enzyme cutting and DNA library construction, and use GenoBaits® Barcode for ILM Kits kit to add adapters. Then use the corresponding GenoBaits DNA probe of the main effective SNP marker of the apple fruit color degree, use GenoBaits® DNA Hybridization kit for ILM kit for molecular hybridization and capture of target sites. The target library after capture is sequenced and analyzed by using PE150 strategy on Illumina sequencer, and the sequencing depth is 1000x~1200x. The reads obtained by sequencing are used for data analysis and genotype determination using GDDH13.1 reference genome.57 SNP variation sites were developed and co-selected, specifically Chr00_8912122, Chr00_8912132, Chr00_8912154, Chr00_49172079, Chr00_49448711, Chr01_24056475, Chr01_24598548, Chr02_4194776, Chr02_14658899, Chr03_26163837, Chr04_19998777, Chr05_33334193, Chr05_36563053, Chr05_37652411, Chr05_45823619, Chr05_45825252, Chr06_6190330, Chr06_6396613, Chr06_6948124, Chr06_22672602, Chr06_25973045, Chr06_26704604, Chr06_26733868, Chr06_28125821, Chr06_32273327, Chr08_2089437, Chr08_4081610, Chr08_4870463, Chr08_21075052, Chr09_19032403, Chr09_32264945, Chr09_32573116, Chr09_32717443, Chr09_33001601, Chr09_33305721, Chr09_33801013, Chr09_34071319, Chr09_34074567, Chr09_34269485, Chr09_34594412, Chr09_35135106, Chr09_35486247, Chr09_35557774, Chr09_35867856, Chr09_36364387, Chr10_1527990, Chr10_28655035, Chr11_29379387, Chr11_41526745, Chr12_4644669, Chr12_21214664, Chr13_42366285, Chr14_31245687, Chr15_1934733, Chr15_23183829, Chr15_31183115, Chr16_40024381.

[0049] 4. Estimation of genotype effect value of apple fruit surface coloration marker and screening of major effect marker

[0050] The training population is constructed using the hybrid population and germplasm resources described above, and contains 1777 strains. Using the GenoBaits strategy, 100 ng of apple hybrid progeny and germplasm resource DNA is added to a 0.2 μL PCR tube, GenoBaits End Repair Buffer 4 μL, GenoBaits End repair Enzyme 3.1 μL, and water is added to make up to 20 μL; the reaction tube is placed in a PCR instrument, 37°C for 20 min, 72°C for 20 min. Then add GenoBaits Ultra DNA ligase 2 μL, GenoBaits Ultra DNA Ligase Buffer 8 μL, GenoBaits Adapter 2 μL, Nuclease-free water 8 μL, and place in a PCR instrument at 22°C for 60 min. Add 1.2 times GenoPrep DNA Clean Beads, mix well, place in a magnetic stand, stand for 3 min, remove the supernatant. Add 100 μL of freshly prepared 80vol% ethanol. Incubate at room temperature for 30 seconds, remove the supernatant. Air dry until the ethanol is completely volatilized, add the system GenoBaits PCR Master Mix 10 μL, GenoBaits Uni_oligo 1 μL, GenoBaits DNA index 5 μL, Nuclease-free water 4 μL. Resuspend the magnetic beads and place in a PCR instrument, 98°C for 2 min; 98°C for 30 s, 65°C for 30 s, 72°C for 40 s for 7 cycles. 72°C for 4 min. Then add 20 μL of GenoPrep DNA Clean Beads, mix well and stand for 5 min, remove the supernatant, add 100 μL of freshly prepared 80vol% ethanol. Incubate at room temperature for 30 s, remove the supernatant. Add 30 μL of Tris-HCl to resuspend the library, mix well, place in a magnetic stand, stand for 3 min, take out the supernatant solution to obtain the DNA library. Mix the purified apple variety DNA library in equal amounts, hybridize, and hybridize at 65°C for 2 h. Use different wash buffers to elute the hybridized library. The target library eluted is further enriched to obtain a sufficient amount of library for machine use; the enriched library is purified to obtain the final library. The final library DNA concentration is determined by Qubit Fluorometric Quantitation (Thermo Fisher). The captured target library is sequenced using an Illumina sequencer using a PE150 strategy for sequencing analysis, with a sequencing depth of 1000x~1200x.The sequencing reads were used to analyze the data and determine the genotypes of the 57 fruit color SNP markers using the GDDH13.1 reference genome. The training population of 1777 strains was used to estimate the genotype effect value and marker effect value of each marker on the fruit color of apples.

[0051] Four major SNP markers related to the fruit color trait of apples were screened from the four major SNP markers related to the fruit color trait of apples with larger marker effect values as the major mutation sites of the fruit color of apples.

[0052] Among them, the four major SNP markers related to the fruit color trait of apples are Chr00_8912122, Chr06_28125821, Chr09_34074567 and Chr09_35557774.

[0053] Among them, Chr00_8912122 is SNP marker SNP1, and its nucleotide sequence is shown in SEQ ID NO. 1:

[0054] ATAGTTGCTAATAGGAGCGTATTTATACGACTTAGTTAGCTTGTTTTCTTGCATTTATATTGTTAGTTCATAGTTATTTTAGTATTTTAAGCTGTTTTCGTGTGTTTGTAGGGTCAAATGTCAAAAGTAGCAAGAAAGTGCATTTTAAAGCATTGCGGAGCAGTTTTGGGCTTGGAATGGATAGCTTATGAATGAAGCAA[G / T]GTGGATGGACGTACTTTATGCTAGGAATGTGCTGAAGAGATGAAGTAAATAAATTCAATACAAGGAAGATTAGGAAAGTTAGCAAGAAAGAAGGAATGTTAGTCAAACTACCTTATTTTGACTTAGCCTTTTCCTCATCTGATGTGAAATTTAACTAGCACTCAAATTAAACCCACTTATTGACAATTGTAGTAAAGATG; wherein, there is a G to T mutation at position 201.

[0055] Among them, Chr06_28125821 is SNP marker SNP2, and its nucleotide sequence is shown in SEQ ID NO. 2:

[0056] AAGAGAACAAATCTGCATGTTAAGTTTAAAGGAATTACTGCAGAGTTGCTAGAGCAGTGTGCGTTTTTCGCAGTTTGAATTCCCCTCCCATTAGTCTAGGTGAATTCCAGGTAGAATATGACTTGTTTAAAGGACTTATTTATAATTAATAAATCAAATTTGTGTTGCAGGTGTCCACTCTGACGCTGCTTTTTCTGGTG[A / C]ACTTTGGGGGATTTTGCTTGATTCTTCTTCTGGCTCACTTCTTATCACAAGGGCCGACCCGCGTCGCAGTTCTAGGATGGGTTTGTGTGACTTTCTCTGTCAGTGTCTTTGCAGCACCTTTAAGCGCCATGGTAATTGATTAAGCAAGTACTGTTTTCAAATTTTAAAGGTTTAAACAAAATCTCAAATTTTCTATGCAT; wherein, there is a mutation of A to C at 878bp.

[0057] wherein, Chr09_34074567, i.e., SNP marker SNP3, has a nucleotide sequence as shown in SEQ ID NO. 3:

[0058] GTTTTGCACCCCATAGAAGATATGAAATGATAATCATAGCAGAGATTAAACAATGAAATAGCAAAGCCCTTCTTTCTATATTCTCAACACGCATCTTCATGTGAATTTTTAAGTTTAATGTGTATATAACACAATTCAAGTGATGTGGAACACGTTTAATCGTTGGGTTTCACACACGAGACAACATGCTCTGATAACAT[A / G]AAAAAAGTTGAAGTTTCATCATAATACCAAATAGCAATATCGAAAGTAATCCAACCATTTTTAAGTGTGAGAGATAAGAGTGAGTTTGTGAATAGCACAAACTATCCTAATAATATTAAAATTGGAAAGAGCCTTCATTTCCATCTCCACTTCCATGTTGATAAAGTCTTCAAATTTGTTTCATAAGTGTTTTTAGCTAT; wherein, there is a mutation of A to G at 201bp.

[0059] Chr09_35557774, i.e. SNP marker SNP4, has a nucleotide sequence as shown in SEQ ID NO. 4:

[0060] ACAAAGAGTGGAGCATTCTACTCTAACTAACTTATATGTAAATGTGTCTCCAGATTATGAACAGAATAATCTAGGCTTTTACTGGCTTTTCATTTCAACTGATTGTTTGTTTTACATTTGTTGCTAAAGCAGAAACTGAAGACTCGAGTGGTGAAGAAGAATGTGAATCCGGAGTGGAACGAAAAATTGACTCTTTCAGT[A / T]GCAGACCCAAATCTTCCAATCAGGCTTTCTGTGTATGACAAAGATACATTTAGTTTTGATGACAAAATGGGGGATGCAGAGTTTGAGATTGGTACATTTATTAAAGTCTTGAGGATGGGATTGGAAGGCCTCCCAGATGGAACCATAATTACAAAAGTACAACCAAGTAGAAAAAACTGCCTTGCTGAAGAGAGCTACAT; wherein, a mutation of A to T exists at 201bp.

[0061] The flanking sequence information of the above-mentioned four major SNP variation sites of the fruit surface color degree is as follows. The non-variation base (front) and variation base (back) are marked in square brackets "[ ]", and are separated by " / ".

[0062] The GenoBaits DNA probe sequence information corresponding to the above-mentioned four major SNP markers of apple fruit surface color degree is as follows:

[0063] The nucleotide sequence of the DNA probe for detecting SNP1 is as shown in SEQ ID NO. 5:

[0064] GGAATGGATAGCTTATGAATGAAGCAAGGTGGATGGACGTACTTTATGCTAGGAATGTGCTGAAGAGATGAAGTAAATAAATTCAATACAAGGAAGATTAGGAAAGTTAG.

[0065] The nucleotide sequence of the DNA probe for detecting SNP2 is as shown in SEQ ID NO. 6:

[0066] TGACTTGTTTAAAGGACTTATTTATAATTAATAAATCAAATTTGTGTTGCAGGTGTCCACTCTGACGCTGCTTTTTCTGGTGAACTTTGGGGGATTTTGCTTGATTCTTC.

[0067] The nucleotide sequence of the DNA probe for detecting SNP3 is shown as SEQ ID NO. 7:

[0068] TGTGTATATAACACAATTCAAGTGATGTGGAACACGTTTAATCGTTGGGTTTCACACACGAGACAACATGCTCTGATAACATAAAAAAAGTTGAAGTTTCATCATAATAC.

[0069] The nucleotide sequence of the DNA probe for detecting SNP4 is shown as SEQ ID NO. 8:

[0070] ATCATATTACGAAGGCACATAAGAGGGATTTGTAAATCACTATTTCTGAGTAGGAATTTACAAATATCTCTCGCATGTCTTTGTAATTCTGATATAGTACGTTTTTAATC.

[0071] 5. Marker-assisted selection method for color degree of apple fruit surface

[0072] In the training population in the present embodiment, the genotype distribution of the above-mentioned four main-effect marker genes of apple fruit surface color degree and the contribution to the trait phenotype are as follows:

[0073] SNP1, i.e. Chr00_8912122 marker, contains 5 genotypes of AA, GA, GG, GT and TT, wherein the individual with AA genotype has red fruit surface.

[0074] SNP2, i.e. Chr06_28125821 marker, contains 3 genotypes of AA, AC and CC, wherein the individual with CC genotype has red fruit surface.

[0075] SNP3, i.e. Chr09_34074567 marker, contains 3 genotypes of AA, AG and GG, wherein the individual with AA genotype has yellow fruit surface.

[0076] SNP4, i.e. Chr09_35557774 marker, contains 3 genotypes of AA, TA and TT, wherein the individual with AA genotype has red fruit surface.

[0077] There is a complementary epistatic effect among the four major SNP markers for apple fruit surface coloration mentioned above. Apple fruit surface coloration was assessed and selected from individual apple germplasm resources or hybrid offspring according to the following criteria:

[0078] ① Germplasm resources or hybrid offspring with genotype AA at Chr09_34074567 have a single plant fruit coloring degree of less than 40 and are marked as Y.

[0079] ② Germplasm resources or hybrid offspring with a genotype of AA at Chr00_8912122, or a genotype of CC at Chr06_28125821, or a genotype of AA at Chr09_35557774, and a single plant with a fruit surface coloring degree greater than 70%, are marked as R.

[0080] ③ After the two rounds of selection in ① and ② above, the germplasm resources or hybrid offspring of the remaining genotype combinations of the above four major SNP markers for apple fruit coloring have a single-plant fruit coloring degree of 40%~70%, and are marked as M.

[0081] As shown above, the four major SNP markers for apple surface coloring can be used to comprehensively and accurately predict apple surface coloring. These four major SNP markers are SNP markers, specifically SNP1 to SNP4.

[0082] Example 2

[0083] To verify the feasibility of the above-mentioned four major SNP markers for apple surface coloration and their probe sets, the present invention conducted the following research:

[0084] Based on the genotyping data of four major markers from 1777 apple materials, the complementary epistatic effect among the four major SNP markers linked to apple fruit coloring traits, and the criteria for judging and selecting apple fruit coloring, were used to screen and judge apple germplasm resources or hybrid progeny:

[0085] like Figure 1 As shown, 1777 apple materials were divided into three grades: those with genotype AA at Chr09_34074567, or hybrid offspring with a single-plant fruit coloring degree of less than 40%, were marked as Y; those with genotype AA at Chr00_8912122, genotype CC at Chr06_28125821, or genotype AA at Chr09_35557774, or hybrid offspring with a single-plant fruit coloring degree of greater than 70%, were marked as R; after the above two rounds of selection ① and ②, the remaining genotype combinations of the above four major SNP markers for apple fruit coloring degree, with a single-plant fruit coloring degree of 40%~70%, were marked as M.

[0086] From the above experimental results, the SNP marker combination provided by the present application has comprehensive Malus wild species and related species related to color degree, accurate prediction, and covers multiple allele sites, can integrate the excellent alleles related to color degree in Malus wild species and related species, and can solve the problems that the prediction comprehensiveness and application effect of the existing SNP marker combination in molecular assisted breeding are limited, and it is difficult to meet the demand of precise breeding.

[0087] It should be noted that when a numerical range is involved in the present application, both endpoints of each numerical range and any number between the two endpoints can be selected, and in order to prevent repetition, the present application describes preferred embodiments.

[0088] Although the preferred embodiments of the present application have been described, those skilled in the art can make further changes and modifications to these embodiments once they know the basic creative concept, and all changes and modifications falling within the scope of the present application.

Claims

1. A probe set for detecting a SNP marker combination for marker assisted selection of fruit skin color in apple, characterized in that, The SNP marker combination consists of 4 SNP markers; the 4 SNP markers comprise SNP1 to SNP4; The SNP1 is Chr00_8912122, the nucleotide sequence of Chr00_8912122 is shown as SEQ ID NO. 1, wherein there is a G to T mutation at position 201 bp; The SNP2 is Chr06_28125821, the nucleotide sequence of Chr06_28125821 is shown as SEQ ID NO. 2, wherein there is an A to C mutation at position 201 bp; The SNP3 is Chr09_34074567, the nucleotide sequence of Chr09_34074567 is shown as SEQ ID NO. 3, wherein there is an A to G mutation at position 201 bp; The SNP4 is Chr09_35557774, the nucleotide sequence of Chr09_35557774 is shown as SEQ ID NO. 4, wherein there is an A to T mutation at position 201 bp; The nucleotide sequence of the GenoBaits DNA probe for detecting the SNP1 is shown as SEQ ID NO. 5; The nucleotide sequence of the GenoBaits DNA probe for detecting the SNP2 is shown as SEQ ID NO. 6; The nucleotide sequence of the GenoBaits DNA probe for detecting the SNP3 is shown as SEQ ID NO. 7; The nucleotide sequence of the GenoBaits DNA probe for detecting the SNP4 is shown as SEQ ID NO.

8.

2. Application of the probe set of claim 1 in the preparation of a kit for determining the fruit surface coloring degree of apple.

3. Use of the probe set according to claim 1 for determining the degree of coloration of the fruit surface of apples, characterized in that, When the genotype at Chr09_34074567 is AA, the fruit surface coloring degree of the apple plant to be measured is less than 40%, marked as Y; when the genotype at Chr00_8912122 is AA, the genotype at Chr06_28125821 is CC, or the genotype at Chr09_35557774 is AA, the fruit surface coloring degree of the apple plant to be measured is greater than 70%, marked as R; when the above two conditions are not met, the fruit surface coloring degree of the apple plant to be measured with the remaining genotype combination is 40% to 70%, marked as M.

4. Use according to claim 3, characterized in that, The method for determining the fruit surface coloring degree of apple comprises the following steps: Extracting the genomic DNA of the apple plant to be measured; Using the genomic DNA of the apple plant to be measured as a template, performing PCR amplification with the probe set to obtain a PCR amplification product; Performing typing detection on the PCR amplification product; Determining the fruit surface coloring degree of the apple plant to be measured.

5. Use according to claim 4, characterized in that, The reaction conditions during the PCR amplification are as follows: 98℃ for 2 min; 98℃ for 30 s, 65℃ for 30 s, 72℃ for 40 s for 7 cycles; 72℃ for 4 min.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) marker combination and probe group for single apple remarking assisted selection and application of SNP marker combination and probe group

    CN120464781A