InDel marker Pmct1 for cold-tolerant character of rice in bud stage and identification method and application of InDel marker Pmct1

Abstract

The invention discloses an InDel marker Pmct1 for the cold-tolerant character of rice in the bud stage as well as an identification method and application of the InDel marker Pmct1, and belongs to the technical field of molecular markers. The InDel molecular marker is developed from insertion and deletion sequences of a Dongxiang wild rice introgression line D2 under the background of a bud-stage strong cold-resistant material 9311 and a bud-stage cold-sensitive material 9311 at an O.sativa reference genome Chr1: 32106831.. 32106871 site, and a primer is developed according to the molecular marker, so that the InDel molecular marker is used for identifying the bud-stage cold-resistant character of rice. The detection period of the method only needs 2-3 h, the method does not depend on subjective experience of people in traditional detection, accurate and objective detection and identification results can be obtained in a short time, and the method is low in cost, high in flux, high in specificity and suitable for rice breeding and production practice.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and particularly relates to an InDel marker Pmct1 of a cold-resistance trait of rice bud stage and an identification method and application thereof. Background Art

[0002] Chilling injury is a common abiotic stress in rice production, which seriously affects the stability and development of rice production. Therefore, solving the problem of rice chilling injury is of great practical significance for world food security and promoting the economic development of rice-producing areas. Studying the cold tolerance mechanism of rice and cultivating cold-resistant rice varieties are the fundamental ways to solve the problem of low temperature chilling injury in rice. With global climate change and the promotion of direct seeding technology of rice, bud chilling injury has become an important stress that restricts the emergence rate of rice. Therefore, it is very important to predict the cold tolerance of rice at the bud stage during the variety breeding process.

[0003] At present, there are few reports on molecular markers for rice bud cold tolerance. To determine the bud cold tolerance of a breeding material, one can only do so through long and complex cultivation experiments, waiting for the seeds to be harvested before conducting bud cold tolerance phenotype identification. The entire process takes at least 6-7 months and requires professional technicians to perform field breeding and laboratory phenotypic identification. The identification process is cumbersome and time-consuming. Therefore, in breeding practice, it is necessary to find a method to quickly identify the bud cold tolerance of rice. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide an InDel marker Pmct1 for the cold tolerance trait of rice bud stage and an identification method and application thereof, so as to solve the technical problem that the identification process of the cold tolerance trait of rice bud stage is complicated and the cycle is long.

[0005] To achieve the above object, the technical solution adopted by the present invention is: to provide an InDel marker Pmct1 for the cold tolerance trait of rice bud stage, characterized in that the primer set sequences corresponding to Pmct1 are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0006] The present invention also discloses a method for identifying the cold tolerance trait of rice during the bud stage, comprising the following steps:

[0007] S1. Extract genomic DNA of the sample to be tested;

[0008] S2, using the primer set corresponding to Pmct1 to perform PCR amplification on the genomic DNA to obtain a PCR amplification product;

[0009] S3. Detect the PCR amplification product. If a band of 143 bp exists in the amplification product, it indicates that the sample is a cold-tolerant rice variety at the bud stage; if a band of 103 bp exists in the amplification product, it indicates that the sample is a cold-sensitive rice variety at the bud stage.

[0010] On the basis of the above technical solution, the present invention can also be improved as follows:

[0011] Furthermore, the PCR amplification system was: 2×Mix 5 μL, F primer 1 μL, R primer 1 μL, template DNA 2 μL, and double distilled water 1 μL.

[0012] Furthermore, the PCR amplification program was as follows: preheating at 95°C for 5 min; 35 cycles: 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s; and finally extension at 72°C for 5 min.

[0013] Furthermore, the detection step in S3 is: using 3-7% agarose gel for electrophoresis at a constant voltage of 250V and 200A for 30min.

[0014] The invention also discloses the use of an InDel marker Pmct1 of a rice sprout stage cold tolerance trait in breeding rice sprout stage cold tolerance trait varieties.

[0015] The beneficial effects of the present invention are:

[0016] 1. The detection cycle of the method of the present invention only takes 2-3 hours, does not rely on the subjective experience of people in traditional detection, and can obtain accurate and objective detection and identification results in a short time. It has low cost, high throughput, and high specificity, and is suitable for rice breeding and production practice.

[0017] 2. The primers provided by the present invention were used to identify rice varieties with different cold tolerance at the bud stage. The results showed that the PCR amplification product of rice with strong cold tolerance at the bud stage obtained a 143bp band after electrophoresis, while the PCR amplification product of cold-sensitive rice obtained a 103bp band after electrophoresis, indicating that the primers designed by the present invention can identify and distinguish the cold tolerance traits of rice at the bud stage. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the electrophoresis result of PCR amplification products. DETAILED DESCRIPTION

[0019] The specific embodiments of the present invention are described below to facilitate the understanding of the present invention by those skilled in the art. If the specific conditions are not specified in the examples, the methods are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturers are not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention defined and determined by the attached claims, these changes are obvious, and all inventions and creations using the concept of the present invention are protected.

[0020] Example 1 Development of InDel marker Pmct1 and primers for identifying cold tolerance traits in rice bud stage

[0021] The genomic DNA of Dongxiang wild rice, 9311 and other materials was resequenced using the Illumina platform to obtain raw sequencing data. Trimmomatic software was used to perform quality control on the raw sequencing data and eliminate low-quality data. BWA software was used to align the high-quality valid data with the reference genome, from which a large number of InDel sites were detected. Based on the detected InDel sites, specific primers were designed. These primers were located on both sides of the insertion or deletion site, and the sequence length polymorphism was reflected by PCR amplification.

[0022] Compared with Dongxiang wild rice introgression line D2 with strong cold-tolerant material 9311 in the bud stage, cold-sensitive material 9311 in the bud stage has a 40bp base deletion at the O. sativa reference genome Chr1:32106831..32106871 site, and primers were designed on both sides of the deletion site. Among them, the sequence of cold-tolerant material D2 in the bud stage is shown in SEQ ID NO.1, with a length of 143bp; the sequence of cold-sensitive material 9311 in the bud stage is shown in SEQ ID NO.2, with a length of 103bp. It is speculated that the above molecular markers can be used to identify cold-tolerant and cold-sensitive rice strains in the bud stage. According to the above sequence information, the cold-tolerant traits of rice in the bud stage can be determined by detecting bands by electrophoresis.

[0023] The Pmct1 molecular marker has 143 bases in the Dongxiang wild rice introgression line D2 (SEQ ID NO.1) with the background of the strong cold-tolerant material 9311 at the budding stage, and 103 bases in the cold-sensitive material 9311 at the budding stage (SEQ ID NO.2). The 40bp base deletion of this molecular marker in the cold-sensitive material 9311 at the budding stage corresponds to the Chr1:32106831..32106871 site of the O. sativa reference genome.

[0024] The nucleotide sequence of the cold-tolerant material D2 in the bud stage is as follows:

[0025] GCCACCGTATAAAGCAGCTAGCTAG GGAACATTGTTCTGATTTATGACATGCACCAG CTAGCTAG CTAGACTGATATTTACTCCATCCATATATGTTTTCTTCATCCATCCTAAGATATA AAGCTGCTCCCTCTATCCGTGAA (SEQ ID NO. 1), the underlined part is the base deletion sequence of the cold-sensitive material 9311 in the bud stage.

[0026] The nucleotide sequence of the cold-sensitive material 9311 at the bud stage is as follows:

[0027] GCCACCGTATAAAGCAGCTAGCTAGCTAGACTGATATTTACTCCATCCATATATGTTT TCTTCATCCATCCTAAGATATAAAGCTGCTCCCTCTATCCGTGAA (SEQ ID NO. 2).

[0028] Example 2 Identification of cold tolerance traits of rice during bud stage using Pmct1

[0029] The specific steps include:

[0030] 1. Extract the rice genomic DNA to be tested

[0031] After rice seeds were cultured for 8 days, leaves were collected and their genomic DNA was extracted using the modified CTAB method.

[0032] 2. PCR amplification

[0033] Using the rice genomic DNA to be tested as a template, PCR amplification was performed using the following primer pairs to obtain the amplified product.

[0034] The primer sequences are as follows:

[0035] Forward primer: 5'-GCCACCGTATAAAGCAGCTAG-3' (SEQ ID NO. 3);

[0036] Reverse primer: 5'-TTCACGGATAGAGGGAGCAG-3' (SEQ ID NO. 4).

[0037] The PCR amplification system was: 2×Mix 5 μL, F primer 1 μL, R primer 1 μL, template DNA 2 μL, and double distilled water 1 μL.

[0038] The PCR amplification program was as follows: preheating at 95°C for 5 min; 35 cycles: 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s; and finally extension at 72°C for 5 min.

[0039] 3. Electrophoresis identification

[0040] Add 5 μL of denaturant to the above PCR product, mix well and then perform electrophoresis. The electrophoresis procedure is as follows: use 5% agarose gel for electrophoresis at a constant voltage of 250V and 200A for 30 minutes. Use a gel imaging system to detect the results. The electrophoresis results are as follows: Figure 1 The sample information corresponding to the electrophoresis results is shown in Table 1.

[0041] Table 1 Sample sources

[0042]

[0043] Depend on Figure 1 It can be seen that two bands at 143bp and 103bp can be seen by gel electrophoresis. The cold-tolerant strains at the bud stage have a 143bp band, and the cold-sensitive strains at the bud stage have a 103bp band. The cold-tolerant traits and plant types of rice at the bud stage can be identified by the length of the bands. The final identification results are: Pmct1-001, Pmct1-003, Pmct1-004, Pmct1-005 and Pmct1-007 are cold-tolerant rice varieties at the bud stage, and Pmct1-002 and Pmct1-006 are cold-sensitive rice varieties at the bud stage.

[0044] Example 3

[0045] In order to verify the accuracy of the identification results in Example 2, the cold tolerance of the samples Pmct1-001 to Pmct1-007 during the germination period was identified. After the seed drying, seed soaking and whitening treatment, the seeds with the same germination level were selected and cold-treated in a 4°C low-temperature incubator for 4 days, and then recovered for 7 days, and the survival rate was counted. The identification results are shown in Table 2.

[0046] Table 2 Live seedling rate of samples to be tested

[0047]

[0048] As shown in Table 2, the live seedling rates of Pmct1-001, Pmct1-003, Pmct1-004, Pmct1-005 and Pmct1-007 are all higher than 50.0%, indicating that they are cold-tolerant plants at the bud stage; the live seedling rates of Pmct1-002 and Pmct1-006 are lower than 30.0%, indicating that they are cold-sensitive plants at the bud stage. This result is consistent with the results of molecular marker identification in Example 2, indicating that the molecular markers, primers and identification methods disclosed in the present invention can specifically identify the cold-tolerant traits of rice at the bud stage, providing practical value for rice breeding.

Claims

1. An InDel marker Pmct1 for cold tolerance trait in rice bud stage, characterized in that: The primer set sequences corresponding to the Pmct1 are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

2. A method for identifying the cold tolerance of rice during the bud stage, characterized in that: The following steps are involved: S1. Extract genomic DNA of the sample to be tested; S2. Performing PCR amplification on genomic DNA using the primer set corresponding to Pmct1 described in claim 1 to obtain a PCR amplification product; S3. Detect the PCR amplification product. If a band of 143 bp exists in the amplification product, it indicates that the sample is a cold-tolerant rice variety at the bud stage; if a band of 103 bp exists in the amplification product, it indicates that the sample is a cold-sensitive rice variety at the bud stage.

3. The method for identifying the cold tolerance trait of rice during bud stage according to claim 2, characterized in that: The PCR amplification system is: 2×Mix 5 μL, F primer 1 μL, R primer 1 μL, template DNA 2 μL, double distilled water 1 μL.

4. The method for identifying the cold tolerance trait of rice during bud stage according to claim 2, characterized in that: The PCR amplification program was: preheating at 95°C for 5 min; 35 cycles: 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s; and finally extension at 72°C for 5 min.

5. The method for identifying the cold tolerance trait of rice during bud stage according to claim 2, characterized in that: The detection step in S3 is: using 3-7% agarose gel for electrophoresis at a constant voltage of 250V and 200A for 30 minutes.

6. Use of the InDel marker Pmct1 for the cold tolerance trait of rice bud stage according to claim 1 in breeding rice varieties with the cold tolerance trait of rice bud stage.

Images