SNP-C1216T related to thousand seed weight of wheat and application of SNP-C1216T

Abstract

The invention discloses a wheat thousand seed weight related SNP-C1216T and application thereof, the SNP site corresponds to the 1216th basic group from the 5'terminal of the sequence shown in SEQ ID NO.1, and when the site is C / C homozygous, the corresponding genotype is A; when the locus is T / T homozygous, the corresponding genotype is B; the thousand seed weight of the wheat with the homozygous genotype A is greater than or candidate to be greater than that of the wheat with the homozygous genotype B. The SNP has high effectiveness and potential application value, wheat with high thousand seed weight can be found by detecting the SNP, and the SNP has important value in research or application of cultivation of high-yield wheat varieties.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, in particular to SNP-C1216T related to wheat thousand-grain weight and application thereof. Background Art

[0002] Wheat (Triticum aestivum L) is one of the most important food crops in the world and my country. Improving wheat yield is an important way to meet the increasing demand for food in recent years, and it is also a strategic goal to ensure food security. Thousand-grain weight is one of the three major factors in the yield of wheat per plant. Therefore, exploring excellent allelic variation that regulates thousand-grain weight and developing functional markers have important application value in wheat high-yield breeding.

[0003] At present, researchers have located a large number of QTLs or genes that regulate thousand-grain weight. Zhang et al. used a double haploid population and two recombinant inbred line populations to locate two QTLs that contribute more than 10% to the thousand-grain weight phenotype: Qtkw1B and Qtkw3A-2 / Qtkw5B.1. Wang et al. used the F 1000-grain weight of Shijiazhuang 4185 and Shijiazhuang 8. 2:5 The population mined multiple SSR markers closely related to thousand-grain weight on the 5DS chromosome of wheat. Zhang Zeyuan used 216 recombinant inbred line populations constructed by Heshangtou and Longchun 23, and identified a total of 51 QTLs related to grain weight in 4 environments through 55k SNP gene chip typing, including 4 QTLs that can be stably present in 3 or more environments, located on chromosomes 2D, 5A, 6B and 7D respectively. Hu Wenjing used the recombinant inbred line population composed of artificial synthetic wheat derivative line C615 and Yangmai 13, combined with 90k SNP chip typing information, to identify a QTL that can be related to thousand-grain weight in 4 environments: QTGW.yaas-6AL. The phenotypic contribution rate of this QTL to thousand-grain weight is 7.63%-10.55%. Wang et al. used target gene association analysis to identify a transcription factor TabHLH123 related to thousand-grain weight and developed corresponding molecular markers.

[0004] Although a large number of QTLs related to thousand-grain weight have been located, it is difficult to apply these QTLs to the genetic improvement of wheat thousand-grain weight because the phenotypic contribution rate of most of these QTLs is small and the repeatability between different years and environments is poor. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide SNP-C1216T related to wheat thousand-grain weight and application thereof.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0007] A SNP site associated with wheat thousand-grain weight, the SNP site corresponds to the 1216th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B; the thousand-grain weight is: wheat homozygous for genotype A is greater than or is candidate greater than wheat homozygous for genotype B.

[0008] On the other hand, the present invention also includes a gene detection kit for the SNP site, which contains a PCR amplification specific primer combination and enzyme cutting component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0009] As a preferred technical solution of the present invention, the target DNA fragment amplified by PCR in the gene detection kit is designed to be 1197-1307 bp at the 5' end of SEQ ID NO.1.

[0010] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0011] As a preferred technical solution of the present invention, the enzyme cutting component is a restriction endonuclease KpnI.

[0012] On the other hand, the present invention also includes a method for identifying or assisting in the identification of wheat thousand-grain weight in the early stages of breeding. Based on the SNP site described in claim 1, in the early stages of molecular marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP site in the wheat genomic DNA to be tested, the wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat thousand-grain weight phenotype is identified or assisting in the identification based on the following correlation between genotype and phenotype: the thousand-grain weight of wheat homozygous for genotype A is greater than, or has a potential to be greater than, that of wheat homozygous for genotype B.

[0013] As a preferred technical solution of the present invention, the DNA fragment amplified by PCR is 1197-1307bp at the 5' end of SEQ ID NO.1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; and the enzyme digestion uses restriction endonuclease KpnI.

[0014] As a preferred technical solution of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 100 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using restriction endonuclease KpnI to digest the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphic site is T / T and the genotype is B; the thousand-grain weight of wheat homozygous for genotype A is greater than or is candidate greater than that of wheat homozygous for genotype B.

[0015] On the other hand, the present invention also includes the use of the above-mentioned wheat SNP site, which is to screen or assist in screening the wheat thousand-grain weight phenotype in the early stage of molecular marker-assisted selection breeding.

[0016] Finally, the present invention also includes a primer combination, including primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.

[0017] The beneficial effect of adopting the above technical scheme is that: the scientific research and development team of the present invention has found a SNP through genetic variation analysis of genes of natural variation population of wheat, corresponding to the 1216th position from the 5' end of sequence table 1, and the SNP has two genotypes: genotype A (C) and genotype B (T). It is proved by association analysis that in the homozygous types of these two genotypes, the thousand-grain weight is: wheat homozygous for genotype A> wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with higher thousand-grain weight can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties or research. The SNP site developed by the present invention not only expands the genetic resource tools of wheat, but also has good and wide application potential verified by our scientific research experiments and data statistics. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a schematic diagram of the structure and variation of the TaHIS-A gene of the present invention;

[0019] Figure 2 It is the electrophoresis detection result of the SNP development dCAPS marker digestion product of the present invention; wherein, lane C is the band cut by KpnI, and lane T is the band that cannot be cut by KpnI.

[0020] Figure 3This is a schematic diagram of the results of the association analysis between the gene polymorphism sites in the natural population and the thousand-grain weight;

[0021] Figure 4 This is a photo of the autumn planting site in 2022 in Example 2;

[0022] Figure 5 This is a photo of the wheat harvest site in June 2023 in Example 2;

[0023] Figure 6 These are on-site photos of the wheat thousand-grain weight survey in July 2023 in Example 2. DETAILED DESCRIPTION

[0024] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can be obtained from commercial sources. It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in the present specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0025] As used in the specification of the present application and the appended claims, the term "if" can be interpreted as "when..." or "once" or "in response to determination" or "in response to detection" according to the context. Similarly, the phrase "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "once it is determined" or "in response to determination" or "once [the described condition or event] is detected" or "in response to detection [the described condition or event]" according to the context. In addition, in the description of the specification of the present application and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance. The reference "one embodiment" or "some embodiments" described in the specification of the present application means that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Thus, the sentences "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in the specification are not necessarily all referring to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "include", "comprising", "having" and variations thereof mean "including but not limited to", unless specifically emphasized otherwise.

[0026] TaHIS is a gene encoding histones that has not been reported in wheat. There are three copies in the wheat genome: TaHIS-A, TaHIS-B, and TaHIS-D. Figure 1 The present invention develops and designs a primer and related molecular markers for identifying wheat thousand-grain weight with respect to the coding region of TaHIS-A.

[0027] Example 1: Detection of SNPs associated with wheat thousand-grain weight and their PCR-enzyme polymorphism

[0028] 1. Specific primers for amplifying the genome fragment containing the wheat SNP and sequence analysis

[0029] A SNP was found in the coding region of the gene TaHIS on the wheat genome, corresponding to the 1216th position from the 5' end of Sequence Listing 1; this site has two genotypes in the natural variation population of wheat:

[0030] Genotype A: C

[0031] Genotype B: T

[0032] According to the sequence differences of different wheat genomes, specific primers were designed to PCR amplify the DNA fragments containing the SNP sites:

[0033] F1: TCTGCCTTTGATACCTACGGG (SEQ ID NO. 2);

[0034] R1: CAGTTGGAAACATAGTTCAAGCAG (SEQ ID NO.3);

[0035] F2: TCATCCGCGACGCCGGTAC (SEQ ID NO.4);

[0036] R2: CGCCGAATCCGTAGAGGGT (SEQ ID NO.5);

[0037] The target sequence amplified by PCR using F1 and R1 as primers is the 664-1944 position sequence shown in SEQ ID NO.1 of the sequence list; the target sequence amplified by PCR using F2 and R2 as primers is the 1197-1307 position sequence shown in SEQ ID NO.1 of the sequence list. Enzyme digestion analysis showed that the polymorphisms can be recognized by KpnI respectively.

[0038] 2. Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

[0039] 1) Extracting genomic DNA of wheat to be tested;

[0040] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) is: 7 μL of ddH2O, 1 μL each of primer F1 (5 μmol / L) and primer R1 (5 μmol / L), 10 μL of 2×Taq mix, and 1 μL of template (20 ng / μL).

[0041] The PCR amplification conditions were 94°C for 4 min; 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 32 cycles; 72°C for 10 min, and stored at 12°C.

[0042] 3) The PCR product of step 2) was diluted 20 times and used as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) was: 7 μL of ddH2O, 1 μL each of primer F2 (5 μmol / L) and primer R2 (5 μmol / L), 10 μL of 2×Taqmix, and 1 μL of template (20 ng / μL).

[0043] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 60°C for 30 s, 72°C for 10 s, 34 cycles; 72°C for 10 min, and storage at 12°C.

[0044] 4) The PCR product obtained in step 3) is digested with KpnI to obtain a digestion product, which is detected by 4% agarose gel electrophoresis, and whether the PCR product is digested by KpnI is recorded, and the situation of the wheat to be tested at the site is determined and recorded according to the following method:

[0045] If the PCR product can be digested by KpnI, the wheat to be tested is C / C homozygous (expressed as C / C) at the site ( Figure 2 Lane C in the figure);

[0046] If the PCR product cannot be digested by KpnI, the wheat to be tested is T homozygous (expressed as T / T) at the site ( Figure 2 Lane T in the figure).

[0047] According to the result of step 4), the wheat is divided into two types, I and II, as follows:

[0048] I: C / C (i.e., homozygous for genotype A);

[0049] II: T / T (i.e., homozygous for genotype B);

[0050] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0051] 3. Use dCAPs markers to genotype natural populations and conduct association analysis with 1000-grain weight traits

[0052] Each wheat in the natural population consisting of 286 hexaploid wheats was used as the wheat to be tested, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0053] Table 1 The situation of the polymorphic sites in natural wheat populations

[0054]

[0055]

[0056]

[0057]

[0058] Example 2: Association analysis between gene polymorphisms and thousand-grain weight in natural populations

[0059] A natural population of 286 hexaploid wheat accessions was sown at the Luancheng Agricultural Ecosystem Experimental Station of the Chinese Academy of Sciences in mid-October 2022 and mid-October 2023. Two irrigation treatments were set up each year: normal irrigation and no irrigation. Normal irrigation was irrigated once at the jointing stage and once at the flowering stage, with an irrigation volume of 50m3 each time. 3 / mu. Four blocks were set up for each irrigation method each year. The sowing method was manual spot sowing, and each variety was planted in one row in each block, with a row spacing of 20 cm, a row width of 1.5 m, and a plant spacing of 7.5 cm. Except for the irrigation method, other farmland management methods were exactly the same. After wheat harvest, the thousand-grain weight was investigated, and the thousand-grain weight of each variety in a block was taken as a replicate. The thousand-grain weight of each variety under each irrigation method each year is shown in Tables 2 and 3. Figure 4 Photos of the 2022 autumn planting site. Figure 5 These are photos of wheat harvest in June 2023. Figure 6 These are on-site photos of the wheat thousand-grain weight survey in July 2023.

[0060] The thousand-grain weight of each wheat variety under different planting environments was investigated, and the association analysis between the thousand-grain weight and the polymorphic loci was performed by variance analysis, with P < 0.05 as the significance level. The results are shown in Table 4 and Figure 3 shown.

[0061] Table 2 Thousand-grain weight of different wheat varieties under two irrigation methods in 2022

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068] Table 3 Thousand-grain weight of different wheat varieties under two irrigation methods in 2023

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076] Table 4 Results of association analysis between gene polymorphisms and thousand-grain weight in natural populations

[0077]

[0078] The results of association analysis in Table 4 show that the differences in the thousand-grain weight of the two types formed by the natural population composed of 286 hexaploid wheats shown in Table 1 reached a significant level (P<0.05). Among them, the thousand-grain weight of wheat in type I is higher than that of wheat in type II. In several environments, the thousand-grain weight of wheat materials in type I is 2.76, 2.97, 2.59 and 3.12 g higher than that of wheat in type II, respectively. Studies on natural populations have shown that type I is an excellent genotype for improving the thousand-grain weight of wheat.

[0079] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0080] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A SNP locus associated with wheat thousand-grain weight, characterized in that: The SNP site corresponds to the 1216th base from the 5' end of the sequence shown in SEQ ID NO.

1. When the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B; the thousand-grain weight is: wheat homozygous for genotype A is greater than or is candidate greater than wheat homozygous for genotype B.

2. A gene detection kit, characterized in that: Used to detect the SNP site described in claim 1, the gene detection kit contains a PCR amplification specific primer combination and an enzyme cutting component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

3. The gene detection kit according to claim 2, characterized in that: The target DNA fragment amplified by PCR in the gene detection kit is designed to be 1197-1307 bp at the 5' end of SEQ ID NO.

1.

4. The gene detection kit according to claim 2, characterized in that: The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

5. The gene detection kit according to claim 2, characterized in that: The enzyme cutting component is the restriction endonuclease KpnI.

6. A method for identifying or assisting in identifying the thousand-grain weight of wheat in the early stage of breeding, characterized in that: Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP site in the wheat genomic DNA to be tested, the wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat thousand-grain weight phenotype is identified or assisted in identification based on the following correlation between genotype and phenotype: the thousand-grain weight of wheat homozygous for genotype A is greater than, or has the potential to be greater than, that of wheat homozygous for genotype B.

7. The method according to claim 6, characterized in that: The DNA fragment amplified by PCR is 1197-1307bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the restriction endonuclease KpnI is used for enzyme digestion.

8. The method according to claim 6, characterized in that: The enzyme digestion comprises the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 20 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using restriction endonuclease KpnI to digest the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphic site is T / T and the genotype is B; the thousand-grain weight of wheat homozygous for genotype A is greater than or has a candidate greater than that of wheat homozygous for genotype B.

9. The use of the wheat SNP locus according to claim 1, characterized in that: The use is to screen or assist in screening the thousand-grain weight phenotype of wheat in the early stage of molecular marker-assisted selection breeding.

10. A primer combination, characterized in that: It comprises a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.

Images