PCR primer pair and / or probe for detecting adulterated fritillaria in bulbus fritillariae cirrhosae or related products thereof and application of PCR primer pair and / or probe

Abstract

The invention belongs to the technical field of drug detection, and particularly relates to a PCR primer pair and / or probe for detecting adulterated fritillaria in bulbus fritillariae cirrhosae or related products of bulbus fritillariae cirrhosae and application of the PCR primer pair and / or probe. Based on the PCR primer pair and / or probe provided by the invention, the adulterated fritillaria in the bulbus fritillariae cirrhosae or related products thereof is detected, the sensitivity is high, the repeatability and the precision are good, and qualitative or quantitative detection of the adulterated fritillaria in the bulbus fritillariae cirrhosae or related products thereof can be accurately realized.

Description

Technical Field

[0001] The invention belongs to the technical field of drug detection, and particularly relates to a PCR primer pair and / or probe for detecting adulterated Fritillaria cirrhosa or related products thereof and application thereof. Background Art

[0002] The genus Fritillaria is rich in medicinal resources. The efficacy of different species of Fritillaria medicinal materials varies greatly. After investigation, the price of different Fritillaria medicinal materials in the genus Fritillaria in the medicinal material market varies significantly. Among them, Sichuan Fritillaria is the most widely used in Chinese patent medicines. At present, there are more than 300 kinds of Chinese patent medicines containing Sichuan Fritillaria on the market, which are mainly used to relieve cough and reduce phlegm. Among them, Snake Gall Chuanbei Capsules and Snake Gall Chuanbei Powder are both composed of snake bile and Sichuan Fritillaria. Among them, Sichuan Fritillaria is the main medicine, which has the effects of clearing heat and moistening the lungs, reducing phlegm and relieving cough, and dispersing nodules and eliminating carbuncles. According to the Chinese Pharmacopoeia, Fritillaria cirrhosa comes from the dried bulbs of Fritillaria cirrhosa (fritillaria with curled leaves) D. Don, Fritillaria unibracteata Hsiao et KCHsia, Fritillaria przewalskii Maxim., Fritillaria delavayi Franch., Fritillaria taipaiensis PYLi or Fritillaria unibracteata Hsiao et K.C.Hsiavar wabuensis (SYTang et SCYue) ZDLiu, S.Wang et SCChen. It is mainly distributed in the southwest region with higher altitudes, such as Tibet, Sichuan, Qinghai, Gansu, Shaanxi and other places. The characteristics of Fritillaria cirrhosa from different origins are different, and there are many closely related species, which has been a hot spot and difficulty in research for many years.

[0003] Due to the high market price of Fritillaria cirrhosa, adulteration or substitution is common. Common adulterated products include: Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria yiliensis, Fritillaria xinjiangensis, Fritillaria pingensis, etc. Some adulterated varieties are difficult to distinguish from Fritillaria cirrhosa through trait identification, and the chemical composition of other Fritillaria genus is very similar to that of Fritillaria cirrhosa, especially when used in finished medicines, making it difficult to distinguish. At present, the current standard of Fritillaria cirrhosa, Chinese Pharmacopoeia Volume 1, cannot solve the problem of adulteration of Fritillaria cirrhosa.

[0004] With the development of TCM detection technology and the improvement of detection requirements, molecular identification methods are increasingly used in the field of TCM identification. At present, the use of PCR, real-time fluorescence quantitative PCR and digital PCR (dPCR) technology can achieve qualitative, relative and even absolute quantification of detection components. Summary of the invention

[0005] The present invention develops a PCR primer pair and a probe for identifying adulteration of Fritillaria cirrhosa in Fritillaria cirrhosa medicinal materials and related products. Based on the primer pair and the probe, adulterated Fritillaria cirrhosa (one or more of Fritillaria yili, Fritillaria xinjiang, Fritillaria pinge, Fritillaria thunbergii or Fritillaria hupehensis) in Fritillaria cirrhosa medicinal materials and related products can be qualitatively or quantitatively identified.

[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0007] In one aspect, the present invention provides a PCR primer pair for detecting adulterated Fritillaria cirrhosa or its related products. The sequence of the PCR primer pair is as follows: upstream primer: TCCCAAAATACCCCAATC; downstream primer:

[0008] CCCACGAATGATATAAATACTAC; The adulterated Fritillaria includes one or more of Ili Fritillaria, Xinjiang Fritillaria, Ping Fritillaria, Zhejiang Fritillaria or Hubei Fritillaria.

[0009] On the other hand, the present invention provides a PCR primer pair and a probe for detecting adulterated Fritillaria in Fritillaria cirrhosa or its related products. The sequence of the PCR primer pair is as follows: upstream primer: TCCCAAAATACCCCAATC; downstream primer: CCCACGAATGATATAAATACTAC; the sequence of the probe is: tggtAagAccCgcAtaaa; the adulterated Fritillaria includes one or more of Fritillaria dahurica, Fritillaria xinjiangensis, Fritillaria pingensis, Fritillaria thunbergii or Fritillaria hupehensis.

[0010] Preferably, in the above-mentioned PCR primer pair and probe, the probe further comprises a fluorescent reporter group and a fluorescent quencher group, the fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.

[0011] In another aspect, the present invention provides a detection product for detecting adulterated Fritillaria cirrhosa or its related products, comprising the PCR primer pair of the present invention or the PCR primer pair and probe of the present invention.

[0012] Preferably, the above-mentioned detection product includes a detection reagent or a detection kit.

[0013] In another aspect, the present invention provides a use of a PCR primer pair of the present invention or a PCR primer pair and a probe of the present invention in detecting adulterated Fritillaria cirrhosa or its related products.

[0014] Preferably, in the above application, the Fritillaria cirrhosa related products include Shedan Chuanbei powder or Shedan Chuanbei capsules.

[0015] In another aspect, the present invention provides a method for detecting adulterated Fritillaria cirrhosa or its related products, comprising: (1) extracting DNA from a sample to be detected to obtain a DNA template of the sample to be detected; (2) performing PCR amplification on the DNA template of the sample to be detected using the PCR primer pair and probe described in claim 2 or 3; and (3) detecting adulterated Fritillaria cirrhosa based on whether a fluorescence logarithmic increase and / or a CT value occurs.

[0016] Preferably, in the above method, the PCR amplification program includes: 94°C / 3min, 94°C / 5sec, 61.5°C / 30sec; wherein the process of 94°C / 5sec and 61.5°C / 30sec is performed for 40 cycles.

[0017] Preferably, in the above method, in step (3), if there is no logarithmic increase in fluorescence and the CT value is greater than 40, adulterated Fritillaria thunbergii is not detected; if there is a logarithmic increase in fluorescence and the CT value is ≤40, adulterated Fritillaria thunbergii is detected.

[0018] The beneficial effects of the present invention include: based on the PCR primer pairs and / or probes of the present invention, adulterated Fritillaria (one or more of Ili Fritillaria, Xinjiang Fritillaria, Ping Fritillaria, Zhejiang Fritillaria or Hubei Fritillaria) in Fritillaria cirrhosa or its related products are detected with high sensitivity, good repeatability and precision, and accurate qualitative or quantitative detection of adulterated Fritillaria in Fritillaria cirrhosa or its related products can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1A These are the amplification curves of five common counterfeit products; the green one is the amplification curve of five common counterfeit products, and the blue one is the amplification curve of the blank control;

[0020] Figure 1B This is the amplification curve of the authentic source of Fritillaria cirrhosa; the red one is the amplification curve of the six genes from the authentic source of Fritillaria cirrhosa, and the blue one is the amplification curve of the blank control;

[0021] Figure 2A This is the amplification curve for the sensitivity investigation of Fritillaria iliensis;

[0022] Figure 2B This is the amplification curve for the sensitivity investigation of Hubei Fritillaria;

[0023] Figure 2C This is the amplification curve for the sensitivity investigation of Fritillaria thunbergii;

[0024] Figure 2D This is the amplification curve for the sensitivity investigation of Fritillaria cirrhosa;

[0025] Figure 2E This is the amplification curve for the sensitivity investigation of Fritillaria cirrhosa.

[0026] FIG. 2A to FIG. 2EIn the figure, the red ones are the amplification curves of the six genes from the authentic source of Fritillaria cirrhosa; the green ones are the amplification curves of the fakes with different template concentrations, among which the purple curve is the DNA concentration of 0.1ng·μL –1 Sample; blue is blank control amplification curve

[0027] Figure 3A This is the amplification curve of Shedan Chuanbei Powder (capsule) of Datong Dayuan Pharmaceutical Co., Ltd.;

[0028] Figure 3B This is the amplification curve of Shedan Chuanbei Powder (Capsule) produced by Sinopharm Fengliaoxing (Foshan) Pharmaceutical Co., Ltd.

[0029] Figure 3C This is the amplification curve of Shedan Chuanbei Powder (capsule) produced by Zhangzhou Biochemical Pharmaceutical Factory Co., Ltd.

[0030] Figure 3D This is the amplification curve of Shedan Chuanbei Powder (capsule) produced by Guangzhou Yuehua Pharmaceutical Co., Ltd.

[0031] Figure 3E This is the amplification curve of Shedan Chuanbei Powder (capsule) produced by Guangzhou Baiyunshan Zhongyi Pharmaceutical Co., Ltd.

[0032] Figure 3F This is the amplification curve of Shedan Chuanbei Powder (capsule) produced by Hunan Chunguang Jiuhui Modern Chinese Medicine Co., Ltd.;

[0033] Figure 4 is the amplification curve of the control preparation; among them, the red one is the amplification curve of the Hubei Fritillaria control preparation; the green one is the amplification curve of the Zhejiang Fritillaria control preparation; the blue one is the amplification curve of the Ping Fritillaria control preparation; the black one is the amplification curve of the Yili Fritillaria control preparation; the orange one is the amplification curve of the Xinjiang Fritillaria control preparation;

[0034] Figure 5 These are the amplification curves of the negative preparation and blank control; the red one is the amplification curve of the negative preparation; the blue one is the amplification curve of the blank control. DETAILED DESCRIPTION

[0035] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0036] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0037] The present invention provides a PCR primer pair for detecting adulterated Fritillaria cirrhosa or its related products. The sequence of the PCR primer pair is as follows: upstream primer: TCCCAAAATACCCCAATC; downstream primer:

[0038] CCCACGAATGATATAAATACTAC; The adulterated Fritillaria includes one or more of Ili Fritillaria, Xinjiang Fritillaria, Ping Fritillaria, Zhejiang Fritillaria or Hubei Fritillaria.

[0039] The embodiment of the present invention also provides a PCR primer pair and probe for detecting adulterated Fritillaria in Fritillaria cirrhosa or its related products. The sequence of the PCR primer pair is as follows: upstream primer: TCCCAAAATACCCCAATC; downstream primer: CCCACGAATGATATAAATACTAC; the sequence of the probe is: tggtAagAccCgcAtaaa ((capital letters represent LNA modified bases)); the adulterated Fritillaria includes one or more of Ili Fritillaria, Xinjiang Fritillaria, Ping Fritillaria, Zhejiang Fritillaria or Hubei Fritillaria.

[0040] In addition, conventional fluorescence quantitative PCR technology can effectively improve the detection sensitivity and specificity by modifying the probe. Currently, the common modified probes include TaqMan probe, MGB probe, locked nucleic acid (LNA) probe, Scorpion probe, etc. Among them, the locked nucleic acid (LNA)-TaqMan probe (LNA-TaqMan) probe is formed by shrinking the 2′-O position and 4′-C position of the nucleic acid carbon ring to form a thiomethylene bridge, oxymethylene bridge or amine methylene bridge and connect into a ring-shaped lock structure, thereby increasing the stability of the phosphate backbone, making the double-stranded affinity formed between the probe and the target sequence in the PCR reaction higher, improving the system Tm value, and greatly improving the specificity of the probe and the sensitivity of detection. It has the strongest sensitivity among the above four different modified probes. At present, there is no related research on the application of LNA-TaqMan fluorescence quantitative PCR in the identification of Fritillaria cirrhosa.

[0041] In some specific examples, in the above-mentioned PCR primer pair and probe, the probe further includes a fluorescent reporter group and a fluorescent quencher group, the fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.

[0042] Specifically, the fluorescent reporter group and the fluorescent quencher group of the probe in the present invention may be those known in the art, preferably the fluorescent reporter group is FAM and the fluorescent quencher group is BHQ1.

[0043] The embodiment of the present invention also provides a detection product for detecting adulterated Fritillaria cirrhosa or its related products, comprising the PCR primer pair of the present invention or the PCR primer pair and probe of the present invention.

[0044] Specifically, the detection product of the present invention includes, in addition to the PCR primer pair of the present invention or the PCR primer pair and probe of the present invention, auxiliary reagents for PCR amplification, such as buffer and the like.

[0045] In some specific examples, the above-mentioned detection products include detection reagents or detection kits.

[0046] Specifically, the detection product includes a detection reagent or a detection kit; wherein, the detection reagent is preferably prepared in the form of a detection kit, which is more convenient for transportation and use.

[0047] The embodiment of the present invention also provides an application of the PCR primer pair of the present invention or the PCR primer pair and probe of the present invention in detecting adulterated Fritillaria cirrhosa or its related products.

[0048] In some specific examples, in the above applications, the Fritillaria cirrhosa-related products include Snake Gallbladder Fritillaria cirrhosa powder or Snake Gallbladder Fritillaria cirrhosa capsules.

[0049] Specifically, the Fritillaria cirrhosa in the present invention is Fritillaria cirrhosa medicinal material, and the Fritillaria cirrhosa related products are related products prepared from Fritillaria cirrhosa medicinal material. The related products may contain other effective ingredients. The Fritillaria cirrhosa related products include Snake Gallbladder Fritillaria cirrhosa powder or Snake Gallbladder Fritillaria cirrhosa capsules.

[0050] The embodiment of the present invention also provides a method for detecting adulterated Fritillaria cirrhosa or its related products, comprising: (1) extracting DNA from a sample to be detected to obtain a DNA template of the sample to be detected; (2) performing PCR amplification on the DNA template of the sample to be detected using the PCR primer pair and probe described in claim 2 or 3; and (3) detecting adulterated Fritillaria cirrhosa based on whether a fluorescence logarithmic increase and / or a CT value occurs.

[0051] In some specific examples, in the above method, the PCR amplification program includes: 94°C / 3min, 94°C / 5sec, 61.5°C / 30sec; wherein the process of 94°C / 5sec and 61.5°C / 30sec is performed for 40 cycles.

[0052] In some specific examples, in the above method, in step (3), if there is no logarithmic increase in fluorescence and the CT value is greater than 40, then the adulterated Fritillaria is not detected; if there is a logarithmic increase in fluorescence and the CT value is ≤40, then the adulterated Fritillaria is detected.

[0053] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.

[0054] 1. Determination of primer pairs and probes

[0055] The chloroplast genome sequences of Fritillaria cirrhosa (curly-leaved Fritillaria), Fritillaria dasyphylla, Fritillaria gansuensis, Fritillaria thunbergii, Fritillaria taibai, Fritillaria wabui, Fritillaria yiliensis, Fritillaria xinjiangensis, Fritillaria pingyuensis, Fritillaria tzuchengensis and Fritillaria hubeiensis were downloaded from the database of the National Center for Biotechnology Information (NCBI: https: / / www.ncbi.nlm.nih.gov / ). By comparing and analyzing the chloroplast genome sequences of the above 11 species, 691 single nucleotide polymorphism (SNP) sites shared by the easily confused products Fritillaria yiliensis, Fritillaria xinjiangensis, Fritillaria pingyuensis, Fritillaria tzuchengensis, Fritillaria hubeiensis and the authentic sources of Fritillaria cirrhosa (curly-leaved Fritillaria), Fritillaria dasyphylla, Fritillaria gansuensis, Fritillaria thunbergii, Fritillaria taibaiensis and Fritillaria wabui were screened out. Beacon Designer 8 software was used to design the best primer pair for detection using a proprietary algorithm. The sequence of Fritillaria dahurica (MN148405) was finally used as a reference, and the cytosine (C) > thymine (T) mutation at position 13778, which is common between the five easily confused counterfeits and the authentic source of Fritillaria cirrhosa, was used as the single nucleotide polymorphism (SNP) site to obtain specific probes and primer pairs for easily confused Fritillaria dahurica, Fritillaria xinjiangensis, Fritillaria pingensis, Fritillaria thunbergii, and Fritillaria hupehensis. The probe (BM13778-P) was purified by high-performance liquid chromatography (HPLC), and the specific probe was labeled with the fluorescein group FAM at the 5′ end and the non-fluorescein quenching group BHQ1 at the 3′ end. The probe and primer sequences are as follows:

[0056] BM13778-F:5'-TCCCAAAATACCCCAATC-3';

[0057] BM13778-R:5'-CCCACGAATGATATAAATACTAC-3'.

[0058] BM13778-P: 5'-FAM-tggtAagAccCgcAtaaa-BHQ1-3' (capital letters indicate LNA modified bases).

[0059] 2. PCR amplification detection

[0060] (I) Extraction of sample genomic DNA

[0061] A total of 104 batches of Ili Fritillaria, Xinjiang Fritillaria, Ping Fritillaria, Zhejiang Fritillaria, Hubei Fritillaria and authentic Sichuan Fritillaria were collected (see Table 1 for specific information), 0.1 g of each batch was taken, and the batches were washed with 1 ml of 75% ethanol and 1 ml of sterile ultrapure water respectively, the surface moisture was absorbed, and the batches were ground into fine powder in a high-throughput tissue grinder (Xinyi-48, Ningbo Xinyi Ultrasonic Equipment Co., Ltd.); 20 mg of each batch was taken and placed in a 1.5 ml centrifuge tube, and the nucleic acid was extracted using the plant genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. to obtain a DNA template.

[0062] Table 1 Sample information table

[0063]

[0064]

[0065]

[0066] (II) Fluorescence PCR amplification reaction

[0067] The DNA template obtained above was added to the PCR reaction system for fluorescence PCR amplification reaction and CT value analysis, wherein the PCR reaction system is shown in Table 2 below.

[0068] Table 2 PCR reaction system

[0069]

[0070]

[0071] In addition, the PCR amplification reaction program was as follows: 94°C / 3 min, 94°C / 5 sec, 61.5°C / 30 sec, wherein 94°C / 5 sec, 61.5°C / 30 sec, the process was performed for 40 cycles.

[0072] (III) Results analysis

[0073] The PCR amplification products were analyzed using a Bio-Rad CFX96 analyzer. The amplification curves of different samples are shown in Figure 1A and Figure 1BAs shown, the results showed that the probe primers in the present invention were used to test different batches of Ili Fritillaria, Xinjiang Fritillaria, Ping Fritillaria, Zhejiang Fritillaria, and Hubei Fritillaria, and each obtained a positive result, while different batches of authentic sources of Sichuan Fritillaria, including Sichuan Fritillaria (curly leaf Fritillaria), dark purple Fritillaria, Gansu Fritillaria, Suosa Fritillaria, Taibai Fritillaria, and Wabu Fritillaria, all obtained negative results, further confirming that the primers and probes of the present invention can be used to identify adulterated Zhejiang Fritillaria and / or Hubei Fritillaria and / or Ili Fritillaria and / or Xinjiang Fritillaria and / or Ping Fritillaria in Sichuan Fritillaria.

[0074] 3. PCR amplification accuracy, repeatability, precision and sensitivity testing

[0075] (I) Method sensitivity investigation

[0076] A batch of genomic DNA from Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria yiliensis, Fritillaria xinjiangensis, and Fritillaria pingensis was selected and graded diluted with sterile double distilled water until the DNA template concentration was 50 ng·μL –1 , 20ng·μL –1 , 10ng·μL –1 , 1ng·μL –1 and 0.1 ng·μL –1 , take 1 μL of the above templates of different concentrations for amplification (amplification system and amplification procedure are the same as above "2") to verify the sensitivity of the method.

[0077] The results showed that the concentration of the five sample template DNA was diluted to 0.1 ng·μL –1 When the Ct value of the amplification curve is ≤34, FIG. 2A to FIG. 2E ; When the template DNA concentration is lower than 0.1ng·μL –1 When the Ct value was greater than 34, it showed that the method had good sensitivity.

[0078] (II) Method repeatability study

[0079] Select a batch of Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria yiliensis, Fritillaria xinjiangensis and Fritillaria pingbeiensis, and repeat the determination three times using the above-mentioned "two" conditions and record the C t The value is calculated by analyzing the C t The coefficient of variation of the value was calculated to verify the repeatability of the method. The results are shown in Table 3 below.

[0080] Table 3 Ct values ​​of fluorescence quantitative PCR repeatability experiment

[0081]

[0082]

[0083] From Table 3 above, we can see that the Ct values ​​of the same sample of Ili Fritillaria thunbergii were 19.98, 19.2 and 19.10, with a mean of 19.43, a standard deviation SD value of 0.48, and a Ct value variation coefficient CV of 0.02; the Ct values ​​of Hubei Fritillaria thunbergii were 23.81, 23.27, and 23.51, with a mean of 23.53, a standard deviation SD value of 0.27, and a Ct value variation coefficient CV of 0.01; the Ct values ​​of Zhejiang Fritillaria thunbergii were 21.43, 20.99, and 20.55, with a mean of The Ct values ​​of three repeated measurements of Fritillaria thunbergii were 21.77, 21.03, and 20.62, with a mean of 21.14, a standard deviation SD of 0.58, and a Ct coefficient of variation CV of 0.03; the Ct values ​​of three repeated measurements of Fritillaria thunbergii were 24.29, 24.45, and 24.39, with a mean of 24.38, a standard deviation SD of 0.08, and a Ct coefficient of variation CV of 0.01. The above results show that this method has good repeatability.

[0084] (III) Method precision investigation

[0085] Select a batch of Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria yiliensis, Fritillaria xinjiangensis and Fritillaria pingensis samples respectively, measure 5 samples in parallel, mark 1-5, and measure and record C according to the above method "two". t Value, analytical calculation C t The coefficient of variation of the value was used to examine the precision of the method. The results are shown in Table 4 below.

[0086] Table 4 Ct values ​​of fluorescence quantitative PCR precision experiment

[0087]

[0088]

[0089] It can be seen from Table 4 above that the mean Ct value of Ili Fritillaria samples is 19.45, the standard deviation SD value is 0.39, and the coefficient of variation of Ct value within the group CV is 0.02; the mean Ct value of Hubei Fritillaria is 23.64, the standard deviation SD value is 0.53, and the coefficient of variation of Ct value within the group CV is 0.02; the mean Ct value of Zhejiang Fritillaria is 21.09, the standard deviation SD value is 0.41, and the coefficient of variation of Ct value within the group CV is 0.02; the mean Ct value of Ping Fritillaria is 20.78, the standard deviation SD value is 0.27, and the coefficient of variation of Ct value within the group CV is 0.01; the mean Ct value of Xinjiang Fritillaria is 23.94, the standard deviation SD value is 0.76, and the coefficient of variation of Ct value within the group CV is 0.03; the above results show that the method has good precision.

[0090] IV. Investigation of different adulteration ratios and setting of limits

[0091] (I) Investigation of different adulteration ratios

[0092] A batch of samples of Fritillaria thunbergii (ZBM-01), Fritillaria hupehensis (HBBM-01), Fritillaria yiliensis (YLBM-01), Fritillaria xinjiangensis (XJBM-04) and Fritillaria pingensis (PBM-09) were selected respectively, and their fine powders were taken and mixed with Fritillaria cirrhosae fine powder according to the samples in Table 5 to form samples with different adulteration ratios. DNA was extracted using the above method and amplified using the above conditions. The C t Value, according to the standard (S) (here should be the C of the corresponding counterfeit content 100%) t value) and the test sample (T) (here should be the C value of samples with different adulteration ratios t Value) of C t The difference between the values ​​△C t , according to the test sample (T) / standard sample (S) % = 2 -△CT绝对值 ×100% calculated sample ratio, and by comparing the actual adulteration ratio with the calculated value, the accuracy of this method for adulteration inspection was determined. The test results are shown in Table 6 below.

[0093] Table 5 Mixing ratio of five counterfeit products and Fritillaria cirrhosa

[0094]

[0095] Table 6 Results of adulteration test of mixed samples

[0096]

[0097] It can be seen from Table 6 above that the above five counterfeit products can be stably detected when they are adulterated at 1%, indicating that this method can be used as a qualitative inspection method for the adulteration of five counterfeit products, namely, Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria yiliensis, Fritillaria xinjiangensis and Fritillaria pingheenensis in Fritillaria chuanxiensis medicinal materials.

[0098] (II) Result determination

[0099] According to the above experimental samples, the following conditions must be met: (1) Blank control: no logarithmic increase in fluorescence, and the corresponding CT value is greater than 40.0 or cannot be determined; (2) Positive control: there is a logarithmic increase in fluorescence, and the corresponding CT value is less than 40.0.

[0100] The final determination criteria were as follows: (1) no logarithmic increase in fluorescence, indicating that one of the Fritillaria thunbergii, Hubei Fritillaria thunbergii, Ili Fritillaria thunbergii, Xinjiang Fritillaria thunbergii, or Chinese Fritillaria thunbergii was not detected; (2) there was a logarithmic increase in fluorescence, indicating that one of the Fritillaria thunbergii, Hubei Fritillaria thunbergii, Ili Fritillaria thunbergii, Xinjiang Fritillaria thunbergii, or Chinese Fritillaria thunbergii was detected.

[0101] 5. Adulteration of Fritillaria cirrhosae in Shedan Chuanbei powder (capsules)

[0102] In the following example, the preparation method of snake gall and Fritillaria cirrhosa capsule is as follows: according to the ratio of 49g snake bile and 295g Fritillaria cirrhosa, the Fritillaria cirrhosa is crushed into fine powder, mixed with snake bile, dried, crushed, sieved, and put into capsules to make 1000g hard capsules; the content of the hard capsule is light yellow to light brown powder: sweet and slightly bitter.

[0103] In the following example, the preparation method of Snake Gallbladder and Fritillaria Powder is as follows: take 100g of snake bile and 600g of Fritillaria cirrhosa, crush the Fritillaria cirrhosa into fine powder, mix it with snake bile, dry, crush and sieve to obtain the powder.

[0104] Based on the method established above, a total of 45 batches of samples of Shedan Chuanbei Powder (capsules) were collected to check the authenticity of the Fritillaria cirrhosa in the prescription. The sources and batch numbers are shown in Table 7 below. By adding control preparations, negative preparations and snake bile blank samples, they were used to identify the adulteration of Fritillaria cirrhosa in the samples and verify the feasibility of the method.

[0105] Table 7 Shedan Chuanbei powder (capsule) sample information

[0106]

[0107]

[0108] 1. DNA extraction

[0109] The powder of Shedan Chuanbei powder (capsule) was used for nucleic acid extraction using the plant genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. to obtain a DNA template.

[0110] Preparation of control preparation: According to the prescription of Shedan Chuanbei powder (capsule), five common counterfeit products of Chuanbei, including Zhejiang Fritillaria, Hubei Fritillaria, Yili Fritillaria, Xinjiang Fritillaria and Ping Fritillaria, were used to replace Chuanbei to prepare control preparation; DNA was extracted according to the same method as the medicinal materials and stored for use as a positive control;

[0111] Negative preparation: At the same time, according to the prescription of Shedan Chuanbei Powder (Capsule), take a mixture of Chuanbei powder and snake bile as a negative preparation, extract DNA according to the same method as the medicinal materials and store it for later use.

[0112] Blank control: Take snake bile (artificially bred, Wangdian Sanlong Special Breeding Farm, Xiuzhou District, Jiaxing City) as a blank sample without Fritillaria cirrhosa powder, operate in the same way, extract total DNA and save it for later use.

[0113] (II) Fluorescence PCR amplification reaction

[0114] The DNA template obtained above was added to the PCR reaction system for fluorescent PCR amplification reaction and CT value analysis, wherein the PCR reaction system is shown in Table 8 below.

[0115] Table 8 PCR reaction system

[0116]

[0117] In addition, the PCR amplification reaction program was as follows: 94°C / 3 min, 94°C / 5 sec, 61.5°C / 30 sec, wherein 94°C / 5 sec, 61.5°C / 30 sec, the process was performed for 40 cycles.

[0118] 1. Results Analysis

[0119] According to the method established above, the presence of adulteration of Fritillaria thunbergii and / or Fritillaria hupehensis and / or Fritillaria yiliensis and / or Fritillaria xinjiangensis and / or Fritillaria pingensis in the finished medicine was determined based on the presence or absence of fluorescence logarithmic growth; 45 batches of Shedan Chuanbei powder (capsule) samples from 6 manufacturers were tested, and the amplification results were as follows: FIG. 3A to FIG. 3F As shown, 24 batches of samples showed logarithmic growth in fluorescence, and adulteration of one of the following was detected on the surface: Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria yiliensis, Fritillaria xinjiangensis, Fritillaria pingensis, with a failure rate of 53.3%. Four manufacturers were involved: Guangzhou Yuehua Pharmaceutical Co., Ltd., Guangzhou Baiyunshan Zhongyi Pharmaceutical Co., Ltd., Hunan Chunguang Jiuhui Modern Chinese Medicine Co., Ltd., and Zhangzhou Biochemical Pharmaceutical Factory Co., Ltd.

[0120] (IV) Investigation of PCR amplification specificity

[0121] The DNA samples of five control preparations, including Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria yiliensis, Fritillaria xinjiangensis and Fritillaria pingheensis, were amplified by the above method and the sample amplification curves were recorded. The results showed that the five control preparations all showed logarithmic growth of fluorescence. Figure 4 The negative preparations made by mixing Fritillaria cirrhosa powder with snake bile and the blank control made with only snake bile were amplified by the above method, and no logarithmic increase in fluorescence was observed. Figure 5 The above results show that this method has good specificity in identifying the five common counterfeits of Shedan Chuanbei Powder (Capsule) and Chuanbei Mu prescriptions that are adulterated with Zhejiang Fritillaria, Hubei Fritillaria, Yili Fritillaria, Xinjiang Fritillaria, and Ping Fritillaria.

[0122] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. A PCR primer pair for detecting adulteration of Fritillaria cirrhosa or its related products, characterized in that: The sequences of the PCR primer pairs are as follows: Upstream primer: TCCCAAAATACCCCAATC; Downstream primer: CCCACGAATGATATAAATACTAC; The adulterated Fritillaria include one or more of Ili Fritillaria, Xinjiang Fritillaria, Ping Fritillaria, Zhejiang Fritillaria or Hubei Fritillaria.

2. A PCR primer pair and probe for detecting adulterated Fritillaria cirrhosae in Fritillaria cirrhosae or its related products, characterized in that: The sequences of the PCR primer pairs are as follows: Upstream primer: TCCCAAAATACCCCAATC; Downstream primer: CCCACGAATGATATAAATACTAC; The sequence of the probe is: tggtAagAccCgcAtaaa; The adulterated Fritillaria include one or more of Ili Fritillaria, Xinjiang Fritillaria, Ping Fritillaria, Zhejiang Fritillaria or Hubei Fritillaria.

3. The PCR primer pair and probe according to claim 2, characterized in that: The probe also includes a fluorescence reporter group and a fluorescence quencher group, the fluorescence reporter group is FAM, and the fluorescence quencher group is BHQ1.

4. A detection product for detecting adulteration of Fritillaria cirrhosa or its related products, characterized in that: It comprises the PCR primer pair according to claim 1 or the PCR primer pair and probe according to claim 2 or 3.

5. The detection product according to claim 4, characterized in that: Testing products include testing reagents or testing kits.

6. Use of the PCR primer pair according to claim 1 or the PCR primer pair and probe according to claim 2 or 3 in detecting adulterated Fritillaria cirrhosa or its related products.

7. The use according to claim 6, characterized in that: Chuanbeimu related products include Shedan Chuanbei powder or Shedan Chuanbei capsules.

8. A method for detecting adulterated Fritillaria cirrhosae in Fritillaria cirrhosae or its related products, characterized in that: include: (1) extracting DNA from a sample to be tested to obtain a DNA template of the sample to be tested; (2) using the PCR primer pair and probe described in claim 2 or 3 to perform PCR amplification on the DNA template of the sample to be tested; (3) detecting adulterated Fritillaria based on whether a fluorescence logarithmic increase and / or CT value occurs.

9. The method according to claim 8, characterized in that The PCR amplification program included: 94°C / 3 min, 94°C / 5 sec, 61.5°C / 30 sec; the process of 94°C / 5 sec and 61.5°C / 30 sec was performed for 40 cycles.

10. The method according to claim 8 or 9, characterized in that: In step (3), if there is no logarithmic increase in fluorescence and the CT value is greater than 40, then the adulterated Fritillaria is not detected; if there is a logarithmic increase in fluorescence and the CT value is ≤40, then the adulterated Fritillaria is detected.

Images