PCR primer pairs and / or probes for detecting adulterated fritillaria in fritillaria cirrhosa or its related products and their applications
By designing specific PCR primer pairs and probes, combined with fluorescence quantitative PCR technology, the problem of fructose citrus medicinal materials is solved, and the identification of fructose citrus medicinal materials with high sensitivity and high accuracy is achieved. It is suitable for qualitative or quantitative detection of fructose citrus medicinal materials and their related products.
Patent Information
- Application Number
- CN202510181402.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-19
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2045-02-19
AI Technical Summary
It is difficult to effectively distinguish and identify Fritillaria citrus from other Fritillaria medicinal materials in the prior art, especially in traditional Chinese patent medicines, which makes it difficult to market supervision and quality control of Fritillaria citrus.
Design specific PCR primer pairs and probes, combine fluorescence quantitative PCR technology, amplify the sample DNA template by detecting the sample, and use fluorescence signals to determine doped fritillaria, including fritillaria, Xinjiang fritillaria, flat fritillaria, Zhejiang fritillaria or Hubei fritillaria.
Qualitative or quantitative detection of the doped fritillaria in the medicinal materials of Fritillaria and its related products has been achieved, and the accuracy and efficiency of the doped fritillaria are improved.
Smart Images

Figure CN119799964B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of drug detection, and particularly relates to a PCR primer pair and / or probe for detecting adulterated fritillaria cirrhosa in fritillaria cirrhosa or its related products and their applications. Background Art
[0002] The genus Fritillaria has rich medicinal resources. The medicinal effects of different fritillaria herbs vary greatly. After investigation, the price differences of different fritillaria herbs in the genus Fritillaria in the medicinal material market are significant. Among them, fritillaria cirrhosa is the most widely used in Chinese patent medicines. Currently, there are more than 300 kinds of Chinese patent medicines containing fritillaria cirrhosa on the market, mainly used for relieving cough and resolving phlegm. Among them, Shedan Chuanbei Capsule and Shedan Chuanbei Powder are both composed of snake bile and fritillaria cirrhosa. Among them, fritillaria cirrhosa is the monarch drug, which has the functions of clearing heat and moistening the lungs, resolving phlegm and relieving cough, and dissipating nodules and expelling carbuncles. In the Chinese Pharmacopoeia, fritillaria cirrhosa comes from the dried bulbs of Fritillaria cirrhosa D. Don (Fritillaria cirrhosa), Fritillaria unibracteata Hsiao et K. C. Hsia, Fritillaria przewalskii Maxim., Fritillaria delavayi Franch., Fritillaria taipaiensis P. Y. Li or Fritillaria unibracteata Hsiao et K. C. Hsia var wabuensis (S. Y. Tang et S. C. Yue) Z. D. Liu, S. Wang et S. C. Chen. It is mainly distributed in the southwestern region at higher altitudes, including the Tibet Autonomous Region, Sichuan, Qinghai, Gansu, Shaanxi and other places. The morphological characteristics of fritillaria cirrhosa from different producing areas have certain differences, and there are many related species, which have been the focus and difficulty of research for many years.
[0003] Due to the relatively high market price of fritillaria cirrhosa, the phenomenon of adulteration or substitution is relatively common. Common adulterants include the following: fritillaria thunbergii, fritillaria hupehensis, fritillaria pallidiflora, fritillaria walujewii, fritillaria ussuriensis, etc. It is very difficult to distinguish some adulterated varieties from fritillaria cirrhosa through morphological identification, and the chemical compositions of other fritillaria in the genus Fritillaria and fritillaria cirrhosa are extremely similar, especially when put into patent medicines, it is more difficult to distinguish. At present, the current standard of fritillaria cirrhosa in Part I of the Chinese Pharmacopoeia cannot solve the problem of adulteration of fritillaria cirrhosa.
[0004] With the development of traditional Chinese medicine detection technology and the improvement of detection requirements, molecular identification methods are increasingly used in the field of traditional Chinese medicine identification. At present, PCR, real-time fluorescence quantitative PCR and digital PCR (dPCR) technologies can be used to achieve qualitative, relative quantitative and even absolute quantitative analysis of the detected components. Summary of the invention
[0005] The present invention develops a PCR primer pair and a probe for identifying adulteration of Fritillaria cirrhosa in Fritillaria cirrhosa medicinal materials and related products. Based on the primer pair and the probe, adulterated Fritillaria cirrhosa (one or more of Fritillaria yili, Fritillaria xinjiang, Fritillaria pinge, Fritillaria thunbergii or Fritillaria hupehensis) in Fritillaria cirrhosa medicinal materials and related products can be qualitatively or quantitatively identified.
[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:
[0007] In one aspect, the present invention provides a PCR primer pair for detecting adulterated Fritillaria cirrhosa or its related products. The sequence of the PCR primer pair is as follows: upstream primer: TCCCAAAATACCCCAATC; downstream primer:
[0008] CCCACGAATGATATAAATACTAC; The adulterated Fritillaria includes one or more of Ili Fritillaria, Xinjiang Fritillaria, Ping Fritillaria, Zhejiang Fritillaria or Hubei Fritillaria.
[0009] On the other hand, the present invention provides a PCR primer pair and a probe for detecting adulterated Fritillaria in Fritillaria cirrhosa or its related products. The sequence of the PCR primer pair is as follows: upstream primer: TCCCAAAATACCCCAATC; downstream primer: CCCACGAATGATATAAATACTAC; the sequence of the probe is: tggtAagAccCgcAtaaa; the adulterated Fritillaria includes one or more of Fritillaria dahurica, Fritillaria xinjiangensis, Fritillaria pingensis, Fritillaria thunbergii or Fritillaria hupehensis.
[0010] Preferably, in the above-mentioned PCR primer pair and probe, the probe further comprises a fluorescent reporter group and a fluorescent quencher group, the fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.
[0011] In another aspect, the present invention provides a detection product for detecting adulterated Fritillaria cirrhosa or its related products, comprising the PCR primer pair of the present invention or the PCR primer pair and probe of the present invention.
[0012] Preferably, the above-mentioned detection product includes a detection reagent or a detection kit.
[0013] In another aspect, the present invention provides a use of a PCR primer pair of the present invention or a PCR primer pair and a probe of the present invention in detecting adulterated Fritillaria cirrhosa or its related products.
[0014] Preferably, in the above application, the Fritillaria cirrhosa related products include Shedan Chuanbei powder or Shedan Chuanbei capsules.
[0015] In another aspect, the present invention provides a method for detecting adulterated fritillaria cirrhosa or its related products, comprising: (1) extracting DNA from the sample to be detected to obtain a DNA template of the sample to be detected; (2) performing PCR amplification on the DNA template of the sample to be detected using the PCR primer pair and probe described in claim 2 or 3; (3) detecting adulterated fritillaria cirrhosa according to whether there is a logarithmic increase in fluorescence and / or the CT value.
[0016] Preferably, in the above method, the PCR amplification program includes: 94°C / 3 min, 94°C / 5 sec, 61.5°C / 30 sec; among which the processes of 94°C / 5 sec and 61.5°C / 30 sec are carried out for 40 cycles.
[0017] Preferably, in the above method, in step (3), if there is no logarithmic increase in fluorescence and the CT value > 40, it is determined that adulterated fritillaria cirrhosa is not detected; if there is a logarithmic increase in fluorescence and the CT value ≤ 40, it is determined that adulterated fritillaria cirrhosa is detected.
[0018] The beneficial effects of the present invention include: Based on the PCR primer pair and / or probe in the present invention, adulterated fritillaria cirrhosa (one or more of fritillaria pallidiflora, fritillaria walujewii, fritillaria ussuriensis, fritillaria thunbergii, or fritillaria hupehensis) in fritillaria cirrhosa or its related products is detected, with high sensitivity, good repeatability and precision, and can accurately achieve qualitative or quantitative detection of adulterated fritillaria cirrhosa in fritillaria cirrhosa or its related products. Description of the Drawings
[0019] Figure 1A Amplification curves for five common adulterated products; among them, the green ones are the amplification curves of the five common adulterated products, and the blue one is the amplification curve of the blank control;
[0020] Figure 1B Amplification curve for the genuine source of fritillaria cirrhosa; among them, the red ones are the amplification curves of 6 original sources of the genuine fritillaria cirrhosa, and the blue one is the amplification curve of the blank control;
[0021] Figure 2A Amplification curve for the sensitivity investigation of fritillaria pallidiflora;
[0022] Figure 2B Amplification curve for the sensitivity investigation of fritillaria hupehensis;
[0023] Figure 2C Amplification curve for the sensitivity investigation of fritillaria thunbergii;
[0024] Figure 2D Amplification curve for the sensitivity investigation of fritillaria ussuriensis;
[0025] Figure 2E Amplification curve for the sensitivity investigation of fritillaria walujewii;
[0026] Figures 2A to 2EAmong them, the red ones are the amplification curves of the 6 original sources of the genuine Fritillaria cirrhosa D. Don; the green ones are the amplification curves of different template concentrations of the counterfeits. Among them, the purple curve is the DNA concentration of 0.1 ng·μL –1 sample; the blue ones are the amplification curves of the blank controls
[0027] Figure 3A are the amplification curves of the Shedan Chuanbei Powder (Capsule) of Datong Dayuan Pharmaceutical Co., Ltd.;
[0028] Figure 3B are the amplification curves of the Shedan Chuanbei Powder (Capsule) of Guoyao Group Fengliao Xing (Foshan) Pharmaceutical Co., Ltd.;
[0029] Figure 3C are the amplification curves of the Shedan Chuanbei Powder (Capsule) of Zhangzhou Biochemical Pharmaceutical Factory Co., Ltd.;
[0030] Figure 3D are the amplification curves of the Shedan Chuanbei Powder (Capsule) of Guangzhou Yuehua Pharmaceutical Co., Ltd.;
[0031] Figure 3E are the amplification curves of the Shedan Chuanbei Powder (Capsule) of Guangzhou Baiyunshan Zhongyi Pharmaceutical Co., Ltd.;
[0032] Figure 3F are the amplification curves of the Shedan Chuanbei Powder (Capsule) of Hunan Chunguang Ninehui Modern Traditional Chinese Medicine Co., Ltd.;
[0033] Figure 4 are the amplification curves of the control preparations; among them, the red ones are the amplification curves of the Hubei Fritillaria thunbergii Miq. var. chekiangensis Hsiao & K. C. Hsia control preparation; the green ones are the amplification curves of the Zhejiang Fritillaria thunbergii Miq. control preparation; the blue ones are the amplification curves of the Fritillaria ussuriensis Maxim. control preparation; the black ones are the amplification curves of the Fritillaria pallidiflora Schrenk control preparation; the orange ones are the amplification curves of the Fritillaria walujewii Regel control preparation;
[0034] Figure 5 are the amplification curves of the negative preparations and the blank controls; among them, the red ones are the amplification curves of the negative preparations; the blue ones are the amplification curves of the blank controls. Detailed implementation manners
[0035] The examples given are for better illustration of the present invention, but the content of the present invention is not limited only to the examples given. Therefore, those skilled in the art who make non-essential improvements and adjustments to the implementation manners according to the above invention content still fall within the protection scope of the present invention.
[0036] The terms used in this document are only for describing specific embodiments and are not intended to limit the present disclosure. Unless having an obviously different meaning in the context, the expressions in the singular form include those in the plural form. As used herein, it should be understood that terms such as "comprising", "having", "including" are intended to indicate the existence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or their combinations may exist or can be added. As used herein, depending on the situation, " / " can be interpreted as "and" or "or".
[0037] The embodiments of the present invention provide a pair of PCR primers for detecting adulterated fritillaria in fritillaria cirrhosa or its related products. The sequences of the pair of PCR primers are shown as follows: Forward primer: TCCCAAAATACCCCAATC; Reverse primer:
[0038] CCCACGAATGATATAAATACTAC; The adulterated fritillaria includes one or more of fritillaria pallidiflora, fritillaria walujewii, fritillaria ussuriensis, fritillaria thunbergii or fritillaria hupehensis.
[0039] The embodiments of the present invention also provide a pair of PCR primers and a probe for detecting adulterated fritillaria in fritillaria cirrhosa or its related products. The sequences of the pair of PCR primers are shown as follows: Forward primer: TCCCAAAATACCCCAATC; Reverse primer: CCCACGAATGATATAAATACTAC; The sequence of the probe is: tggtAagAccCgcAtaaa (the capital letters represent LNA-modified bases); The adulterated fritillaria includes one or more of fritillaria pallidiflora, fritillaria walujewii, fritillaria ussuriensis, fritillaria thunbergii or fritillaria hupehensis.
[0040] In addition, conventional fluorescence quantitative PCR technology can effectively improve the detection sensitivity and specificity by modifying the probe. Currently, common modified probes include TaqMan probe, MGB probe, locked nucleic acid (LNA) probe, Scorpion probe, etc. Among them, the locked nucleic acid (LNA)-TaqMan probe (LNA-TaqMan) probe forms a sulfurous methylene bridge, an oxygenous methylene bridge or an amine methylene bridge through a dehydration reaction at the 2'-O position and 4'-C position of the nucleic acid carbocyclic ring and connects them into a circular locked structure, thereby increasing the stability of the phosphate backbone, making the double-stranded affinity formed by the binding between the probe and the target sequence in the PCR reaction higher, increasing the Tm value of the system, greatly improving the specificity of the probe and the detection sensitivity, and being the most sensitive among the above 4 different modified probes. At present, there is no relevant research on the application of LNA-TaqMan fluorescence quantitative PCR in the identification of fritillaria cirrhosa.
[0041] In some specific examples, among the above PCR primer pairs and probes, the probe further includes a fluorescent reporter group and a fluorescent quenching group, the fluorescent reporter group is FAM, and the fluorescent quenching group is BHQ1.
[0042] Specifically, the fluorescent reporter group and the fluorescent quenching group of the probe in the present invention can be well-known in the art. Preferably, the fluorescent reporter group is FAM, and the fluorescent quenching group is BHQ1.
[0043] The embodiment of the present invention also provides a detection product for detecting adulterated fritillaria cirrhosa or its related products, including the PCR primer pair in the present invention or the PCR primer pair and probe in the present invention.
[0044] Specifically, in addition to including the PCR primer pair in the present invention or the PCR primer pair and probe in the present invention, the detection product in the present invention further includes auxiliary reagents for PCR amplification, such as buffer solution, etc.
[0045] In some specific examples, the above detection product includes a detection reagent or a detection kit.
[0046] Specifically, the detection product includes a detection reagent or a detection kit; among them, it is preferably to prepare the detection reagent in the form of a detection kit, which is more convenient for transportation and use.
[0047] The embodiment of the present invention also provides an application of the PCR primer pair in the present invention or the PCR primer pair and probe in the present invention in detecting adulterated fritillaria cirrhosa in fritillaria cirrhosa or its related products.
[0048] In some specific examples, in the above application, the related products of fritillaria cirrhosa include snake bile and fritillaria powder or snake bile and fritillaria capsules.
[0049] Specifically, the fritillaria cirrhosa in the present invention is fritillaria cirrhosa medicinal materials, and the related products of fritillaria cirrhosa are related products prepared from fritillaria cirrhosa medicinal materials. The related products can contain other active ingredients. The related products of fritillaria cirrhosa include snake bile and fritillaria powder or snake bile and fritillaria capsules.
[0050] The embodiment of the present invention also provides a method for detecting adulterated fritillaria cirrhosa in fritillaria cirrhosa or its related products, including: (1) extracting DNA from the sample to be detected to obtain a DNA template of the sample to be detected; (2) using the PCR primer pair and probe described in claim 2 or 3 to perform PCR amplification on the DNA template of the sample to be detected; (3) detecting adulterated fritillaria cirrhosa according to whether there is a logarithmic increase in fluorescence and / or CT value.
[0051] In some specific examples, in the above method, the PCR amplification program includes: 94°C / 3 min, 94°C / 5 sec, 61.5°C / 30 sec; among them, the processes of 94°C / 5 sec and 61.5°C / 30 sec are carried out for 40 cycles.
[0052] In some specific examples, in the above method, in step (3), if there is no logarithmic growth of fluorescence and the CT value > 40, it means that adulterated fritillary bulbs are not detected; if there is logarithmic growth of fluorescence and the CT value ≤ 40, it means that adulterated fritillary bulbs are detected.
[0053] To better understand the present invention, the content of the present invention will be further clarified below in conjunction with specific examples, but the content of the present invention is not limited to the following examples only.
[0054] I. Determination of primer pairs and probes
[0055] Download the chloroplast genome sequences of Fritillaria cirrhosa D. Don (Fritillaria cirrhosa), Fritillaria unibracteata Hsiao et K. C. Hsia, Fritillaria przewalskii Maxim., Fritillaria delavayi Franch., Fritillaria taipaiensis P. Y. Li, Fritillaria wabuensis S. Y. Tang et S. C. Yue, Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia from the National Center for Biotechnology Information (NCBI: https: / / www.ncbi.nlm.nih.gov / ) database. Through alignment and analysis of the chloroplast genome sequences of the above 11 species, 691 single nucleotide polymorphism (SNP) sites shared by the easily confused species Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia and the authentic sources of Fritillaria cirrhosa D. Don (Fritillaria cirrhosa), Fritillaria unibracteata Hsiao et K. C. Hsia, Fritillaria przewalskii Maxim., Fritillaria delavayi Franch., Fritillaria taipaiensis P. Y. Li, Fritillaria wabuensis S. Y. Tang et S. C. Yue were screened out. Using the Beacon Designer 8 software and a proprietary algorithm, the best primer pairs for detection were designed. Finally, taking the sequence of Fritillaria pallidiflora Schrenk (MN148405) as a reference, the cytosine (C) > thymine (T) mutation shared between the above five easily confused and adulterated products and the authentic sources of Fritillaria cirrhosa D. Don at the 13,778th position was used as a single nucleotide polymorphism (SNP) site to obtain specific probes and primer pairs for the easily confused species Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia. The probe (BM13778-P) was purified by high performance liquid chromatography (HPLC), and the 5 ′ end was labeled with the fluorophore FAM, and the 3 ′ end was labeled with the non-fluorescent quencher BHQ1. The sequences of the probe and primers are shown as follows:
[0056] BM13778-F: 5'-TCCCAAAATACCCCAATC-3';
[0057] BM13778-R: 5'-CCCACGAATGATATAAATACTAC-3'.
[0058] BM13778-P: 5'-FAM-tggtAagAccCgcAtaaa-BHQ1-3’ (uppercase letters represent LNA-modified bases).
[0059] II. PCR amplification detection
[0060] (1) Extraction of genomic DNA from samples
[0061] Collect 104 batches of genuine source Fritillaria walujewii, F. thunbergii, F. ussuriensis, F. cirrhosa, F. hupehensis, and F. przewalskii with accurate original plants (specific information is shown in Table 1). Take 0.1 g from each batch, wash them successively with 1 ml of 75% ethanol and 1 ml of sterile ultrapure water, absorb the surface moisture, and grind them into fine powder in a high-throughput tissue grinder (Xinyi-48 type, Ningbo Xinyi Ultrasonic Equipment Co., Ltd.); take 20 mg from each batch, place them in 1.5 ml centrifuge tubes, and extract nucleic acids using the plant genomic DNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. to obtain DNA templates.
[0062] Table 1 Sample information table
[0063]
[0064]
[0065]
[0066] (2) Fluorescent PCR amplification reaction
[0067] Add the above-obtained DNA templates to the PCR reaction system for fluorescent PCR amplification reaction and CT value analysis. Among them, the PCR reaction system is shown in Table 2 below.
[0068] Table 2 PCR reaction system
[0069]
[0070] In addition, the PCR amplification reaction program is as follows: 94°C / 3 min, 94°C / 5 sec, 61.5°C / 30 sec, and the process of 94°C / 5 sec, 61.5°C / 30 sec is carried out for 40 cycles.
[0071] (3) Result analysis
[0072] The PCR amplification products are analyzed using a Bio-Rad CFX96 analyzer. The amplification curves of different samples are as Figure 1A and Figure 1BAs shown in the figure, the results show that the probe primers in the present invention were tested on different batches of Fritillaria pallidiflora, Fritillaria walujewii, Fritillaria thunbergii var. chekiangensis, Fritillaria hupehensis, and Fritillaria thunbergii, and positive results were obtained for each sample. However, different batches of genuine source Fritillaria cirrhosa (Fritillaria cirrhosa), Fritillaria unibracteata, Fritillaria przewalskii, Fritillaria delavayi, Fritillaria taipaiensis, and Fritillaria wabuensis all gave negative results, further confirming that the primers and probes of the present invention can be used for the identification of adulterated Fritillaria thunbergii and / or Fritillaria hupehensis and / or Fritillaria pallidiflora and / or Fritillaria walujewii and / or Fritillaria thunbergii var. chekiangensis in Fritillaria cirrhosa.
[0073] III. Tests on the accuracy, repeatability, precision, and sensitivity of PCR amplification
[0074] (1) Investigation of method sensitivity
[0075] Genomic DNA from one batch each of Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria pallidiflora, Fritillaria walujewii, and Fritillaria thunbergii var. chekiangensis was selected and serially diluted with sterile double-distilled water until the DNA template concentrations were 50 ng·μL –1 , 20 ng·μL –1 , 10 ng·μL –1 , 1 ng·μL –1 , and 0.1 ng·μL –1 respectively. Then, 1 μL of the above different-concentration templates was taken for amplification (the amplification system and amplification program were as described in "II" above) to verify the method sensitivity.
[0076] The results showed that when the template DNA concentrations of the five samples were diluted to 0.1 ng·μL –1 , stable detection was achieved, and at this time, the Ct values of the amplification curves were ≤ 34, as shown in Figures 2A to 2E ; when the template DNA concentration was lower than 0.1 ng·μL –1 , the Ct value was greater than 34, indicating that the method had good sensitivity.
[0077] (2) Investigation of method repeatability
[0078] One batch each of Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria pallidiflora, Fritillaria walujewii, and Fritillaria thunbergii var. chekiangensis was selected, and under the conditions of "II" above, the measurement was repeated 3 times and the C t values were recorded. The coefficient of variation of the C t values within the group was calculated through analysis to verify the repeatability of the method. The results are shown in Table 3 below.
[0079] Table 3 Ct values of the fluorescence quantitative PCR repeatability experiment
[0080]
[0081]
[0082] As can be seen from Table 3 above, the Ct values of three repeated measurements of the same sample of Fritillaria pallidiflora Schrenk were 19.98, 19.2, and 19.10 respectively, with an average value of 19.43, a standard deviation SD value of 0.48, and a coefficient of variation CV of Ct values within the group of 0.02; the Ct values of three repeated measurements of Fritillaria hupehensis Hsiao et K. C. Hsia were 23.81, 23.27, and 23.51 respectively, with an average value of 23.53, a standard deviation SD value of 0.27, and a coefficient of variation CV of Ct values within the group of 0.01; the Ct values of three repeated measurements of Fritillaria thunbergii Miq. were 21.43, 20.99, and 20.55 respectively, with an average value of 20.99, a standard deviation SD value of 0.44, and a coefficient of variation CV of Ct values within the group of 0.02; the Ct values of three repeated measurements of Fritillaria ussuriensis Maxim. were 21.77, 21.03, and 20.62 respectively, with an average value of 21.14, a standard deviation SD value of 0.58, and a coefficient of variation CV of Ct values within the group of 0.03; the Ct values of three repeated measurements of Fritillaria walujewii Regel were 24.29, 24.45, and 24.39 respectively, with an average value of 24.38, a standard deviation SD value of 0.08, and a coefficient of variation CV of Ct values within the group of 0.01; the above results show that the repeatability of this method is good.
[0083] (3) Investigation of method precision
[0084] Select a batch of samples of Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia, Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, and Fritillaria ussuriensis Maxim. respectively, and measure 5 parallel samples, marked 1 - 5, and measure and record C according to the method in “(2)” above. t value, analyze and calculate the coefficient of variation of C t value to investigate the precision of the method. The results are shown in Table 4 below.
[0085] Table 4 Ct values of fluorescence quantitative PCR precision experiment
[0086]
[0087]
[0088] As can be seen from Table 4 above, the average Ct value of the Fritillaria pallidiflora Schrenk sample measurement is 19.45, the standard deviation SD value is 0.39, and the coefficient of variation CV of Ct values within the group is 0.02; the average Ct value of Fritillaria hupehensis Hsiao et K. C. Hsia is 23.64, the standard deviation SD value is 0.53, and the coefficient of variation CV of Ct values within the group is 0.02; the average Ct value of Fritillaria thunbergii Miq. is 21.09, the standard deviation SD value is 0.41, and the coefficient of variation CV of Ct values within the group is 0.02; the average Ct value of Fritillaria ussuriensis Maxim. is 20.78, the standard deviation SD value is 0.27, and the coefficient of variation CV of Ct values within the group is 0.01; the average Ct value of Fritillaria walujewii Regel is 23.94, the standard deviation SD value is 0.76, and the coefficient of variation CV of Ct values within the group is 0.03; the above results show that the precision of this method is good.
[0089] IV. Investigation on Different Adulteration Ratios and Establishment of Limits
[0090] (I) Investigation on Different Adulteration Ratios
[0091] Select one batch of samples of Fritillaria thunbergii Miq. (ZBM - 01), Fritillaria hupehensis Hsiao et K. C. Hsia (HBBM - 01), Fritillaria pallidiflora Schrenk (YLBM - 01), Fritillaria walujewii Regel (XJBM - 04), and Fritillaria ussuriensis Maxim. (PBM - 09) respectively. Take their fine powders and mix them with the fine powder of Fritillaria cirrhosa D. Don according to the sample weighing in Table 5 to form samples with different adulteration ratios. Extract DNA using the above method and amplify under the above conditions, and record the C t value. According to the standard product (S) (here it should be the C t value of the corresponding adulterant content of 100%) and the test sample (T) (here it should be the C t value of the sample with different adulteration ratios), the difference in C t values is △C t . According to the formula of test sample (T) / standard product (S)% = 2 -△CT绝对值 ×100% to calculate the sample ratio. By comparing the actual adulteration ratio with the calculated value, determine the accuracy of this method for adulteration inspection. The test results are shown in Table 6 below.
[0092] Table 5 Mixing ratios of five adulterants and Fritillaria cirrhosa D. Don
[0093]
[0094]
[0095] Table 6 Detection results of adulteration degrees of mixed samples
[0096]
[0097] It can be seen from Table 6 above that when the above five adulterants are adulterated by 1%, they can all be stably detected, indicating that this method can be used as a qualitative inspection method for five adulterants, namely Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia, Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, and Fritillaria ussuriensis Maxim., in Fritillaria cirrhosa D. Don medicinal materials.
[0098] (II) Result Judgment
[0099] The above experimental samples need to meet the following conditions: (1) Blank control: No fluorescence logarithmic growth, and the corresponding CT value > 40.0 or cannot be determined; (2) Positive control: There is fluorescence logarithmic growth, and the corresponding CT value < 40.0.
[0100] Finally, the judgment criteria are determined as follows: (1) No fluorescence logarithmic growth means that none of Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia, Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, or Fritillaria ussuriensis Maxim. is detected; (2) There is fluorescence logarithmic growth means that one of Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia, Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, or Fritillaria ussuriensis Maxim. is detected.
[0101] V. Adulteration Application of Shedan Chuanbei Powder (Capsules) with Fritillaria cirrhosa
[0102] In the following examples, the preparation method of Shedan Chuanbei Capsules is as follows: According to the ratio of 49 g of snake bile and 295 g of Fritillaria cirrhosa, the Fritillaria cirrhosa is pulverized into fine powder, mixed with snake bile, dried, pulverized, sieved, and filled into capsules to make 1000 g of hard capsules; the content of the hard capsules is a light yellow to light brown powder, sweet in taste and slightly bitter.
[0103] In the following examples, the preparation method of Shedan Chuanbei Powder is as follows: Take 100 g of snake bile and 600 g of Fritillaria cirrhosa, pulverize the Fritillaria cirrhosa into fine powder, mix it with snake bile, dry it, pulverize it, and sieve it to obtain the product.
[0104] Based on the established method above, a total of 45 batches of Shedan Chuanbei Powder (Capsules) samples were collected for the authenticity inspection of the Fritillaria cirrhosa input in the prescription. The sources and batch numbers are shown in Table 7 below. By adding control preparations, negative preparations, and snake bile blank samples, they were used for the adulteration identification of Fritillaria cirrhosa in the samples and to verify the feasibility of the method.
[0105] Table 7 Information of Shedan Chuanbei Powder (Capsules) Samples
[0106]
[0107]
[0108] (I) DNA Extraction
[0109] For the finished product powder of Shedan Chuanbei Powder (Capsules), nucleic acid extraction was carried out using the Plant Genomic DNA Extraction Kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. to obtain a DNA template.
[0110] Preparation of control preparations: According to the prescription of Shedan Chuanbei Powder (Capsules), control preparations were prepared by replacing Fritillaria cirrhosa with five common adulterated products of Fritillaria cirrhosa, namely Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria pallidiflora, Fritillaria walujewii, and Fritillaria ussuriensis, respectively; DNA was extracted and stored for later use in the same way as the medicinal materials, as a positive control.
[0111] Negative preparation: At the same time, according to the prescription of Shedan Chuanbei Powder (Capsules), a sample was prepared by mixing Fritillaria cirrhosa powder and snake bile as a negative preparation, and DNA was extracted and stored for later use in the same way as the medicinal materials.
[0112] Blank control: Take snake bile (artificially farmed, Wangdian Sanlong Special Breeding Farm, Xiuzhou District, Jiaxing City) as a blank sample without Fritillaria cirrhosa powder, and operate in the same way to extract total DNA and store it for later use.
[0113] (II) Fluorescent PCR Amplification Reaction
[0114] Add the obtained DNA template described above to the PCR reaction system for fluorescence PCR amplification reaction and CT value analysis. Among them, the PCR reaction system is shown in Table 8 below.
[0115] Table 8 PCR reaction system
[0116]
[0117] In addition, the PCR amplification reaction procedure is as follows: 94°C / 3 min, 94°C / 5 sec, 61.5°C / 30 sec, and the process of 94°C / 5 sec and 61.5°C / 30 sec is carried out for 40 cycles.
[0118] (I) Result analysis
[0119] Determine according to the established method described above. Based on the presence or absence of logarithmic fluorescence growth, determine whether there is adulteration of Fritillaria thunbergii Miq. and / or Fritillaria hupehensis Hsiao et K. C. Hsia and / or Fritillaria pallidiflora Schrenk and / or Fritillaria walujewii Regel and / or Fritillaria ussuriensis Maxim. in the finished medicine; by measuring 45 batches of Shedan Chuanbei Powder (capsule) samples from 6 manufacturers, the amplification results are as Figures 3A to 3F shown. Fluorescence logarithmic growth occurred in 24 batches of samples, indicating that one of Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia, Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, and Fritillaria ussuriensis Maxim. was detected as adulterated, and the unqualified rate was 53.3%. This includes a total of four manufacturing enterprises: Guangzhou Yuehua Pharmaceutical Co., Ltd., Guangzhou Baiyunshan Zhongyi Pharmaceutical Co., Ltd., Hunan Chunguang JiuHui Modern Traditional Chinese Medicine Co., Ltd., and Zhangzhou Biochemical Pharmaceutical Co., Ltd.
[0120] (IV) Specificity investigation of PCR amplification
[0121] Self-prepare DNA of five control preparation samples of Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia, Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, and Fritillaria ussuriensis Maxim., amplify them by the above method, and record the sample amplification curves. The results show that logarithmic fluorescence growth occurred in all five control preparations, as shown in Figure 4 . The negative preparation made by mixing Fritillaria cirrhosa D. Don powder and snake bile and the blank control of only snake bile were amplified by the above method, and no logarithmic fluorescence growth occurred, as shown in Figure 5 . The above results indicate that this method has good specificity for identifying the adulteration of Fritillaria thunbergii Miq., Fritillaria hupehensis Hsiao et K. C. Hsia, Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, and Fritillaria ussuriensis Maxim. in the Fritillaria cirrhosa D. Don prescription of Shedan Chuanbei Powder (capsule).
[0122] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered by the scope of the claims of the present invention.
Claims
1. PCR primer pairs and probes for detecting adulterated fritillaria in fritillaria cirrhosa or its related products, characterized in that, The sequences of the PCR primer pairs are shown as follows: The upstream primer sequence is shown as SEQ NO ID: 1: TCCCAAAATACCCCAATC; The downstream primer sequence is shown as SEQ NO ID: 2: CCCACGAATGATATAAATACTAC; The sequence of the probe is shown as SEQ NO ID: 3: tggtAagAccCgcAtaaa; The adulterated Fritillaria thunbergii includes one or more of Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, Fritillaria ussuriensis Maxim, Fritillaria thunbergii Miq. var. chekiangensis Hsiao et K. C. Hsia, or Fritillaria hupehensis Hsiao et K. C. Hsia.
2. The PCR primer pair and probe according to claim 1, characterized in that, The probe also includes a fluorescent reporter group and a fluorescent quenching group. The fluorescent reporter group is FAM, and the fluorescent quenching group is BHQ1.
3. A detection product for detecting adulterated fritillaria cirrhosa in fritillaria cirrhosa or its related products, characterized in that, It includes the PCR primer pairs and probes described in claim 1 or 2.
4. The detection product according to claim 3, characterized in that, The detection product includes a detection reagent or a detection kit.
5. Use of the PCR primer pairs and probes described in claim 1 or 2 in detecting adulterated Fritillaria thunbergii in Fritillaria cirrhosa D. Don or its related products, where the adulterated Fritillaria thunbergii includes one or more of Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, Fritillaria ussuriensis Maxim, Fritillaria thunbergii Miq. var. chekiangensis Hsiao et K. C. Hsia, or Fritillaria hupehensis Hsiao et K. C. Hsia.
6. The application according to claim 5, wherein The related products of Fritillaria cirrhosa D. Don include Shedan Chuanbei Powder or Shedan Chuanbei Capsule.
7. A method for detecting adulterated fritillaria cirrhosa or its related products, characterized in that, It includes: (1) Extract DNA from the sample to be detected to obtain the DNA template of the sample to be detected; (2) Use the PCR primer pairs and probes described in claim 1 or 2 to perform PCR amplification on the DNA template of the sample to be detected; (3) Detect adulterated Fritillaria thunbergii according to whether there is a logarithmic increase in fluorescence and / or the CT value; the adulterated Fritillaria thunbergii includes one or more of Fritillaria pallidiflora Schrenk, Fritillaria walujewii Regel, Fritillaria ussuriensis Maxim, Fritillaria thunbergii Miq. var. chekiangensis Hsiao et K. C. Hsia, or Fritillaria hupehensis Hsiao et K. C. Hsia.
8. The method according to claim 7, characterized in that The procedure of PCR amplification includes: 94°C / 3 min, 94°C / 5 sec, 61.5°C / 30 sec; among which the processes of 94°C / 5 sec and 61.5°C / 30 sec are carried out for 40 cycles.
9. The method according to claim 7 or 8, characterized in that In step (3), if there is no logarithmic increase in fluorescence and the CT value > 40, then no adulterated Fritillaria thunbergii is detected; if there is a logarithmic increase in fluorescence and the CT value ≤ 40, then adulterated Fritillaria thunbergii is detected.
Citation Information
Patent Citations
Method for detecting fritillaria cirrhosa species specificity based on TaqMan probe real-time fluorescence quantitative PCR technology
CN107385067A
Multiplex PCR (Polymerase Chain Reaction) primer, method and application for identification and adulteration detection of bulbus fritillariae cirrhosae
CN118667995A