Use of psoralen in the preparation of a medicament for treating sepsis
By using drugs prepared from psoralen, the inflammatory response and immune response of sepsis are inhibited, which solves the problems of poor efficacy and large side effects of existing treatments and achieves better treatment results and safety.
Patent Information
- Application Number
- CN202510057923.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-14
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2045-01-14
AI Technical Summary
Existing treatments for sepsis are ineffective and have significant side effects, making it crucial to find more effective and safer treatment methods.
Drugs for treating sepsis are prepared by using psoralen as a single active ingredient or in combination with other pharmaceutically acceptable ingredients. These drugs include oral and topical formulations that intervene in the pathological process of sepsis by inhibiting inflammatory responses, modulating immune responses, and promoting tissue repair.
It effectively controls the inflammatory response of sepsis, reduces tissue damage, lowers mortality, improves patient survival and quality of life, has few side effects, and has a wide range of applications.
Smart Images

Figure CN119818481B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of medicine, and relates to a new use of psoralen, in particular to application of psoralen in preparation of a medicine for treating sepsis. BACKGROUND
[0002] Sepsis is a severe infectious disease, which is often caused by bacteria, viruses or other pathogenic microorganisms, and is characterized by systemic inflammatory response syndrome and multiple organ dysfunction. Although there are currently various treatment methods, there are still problems such as poor curative effect and large side effects, so it is of great significance to find a more effective and safer treatment method.
[0003] Psoralen is a furanocoumarin compound derived from Psoralea corylifolia L., and also widely exists in traditional Chinese medicines such as Radix Adenophorae, Saposhnikovia divaricata and Angelica pubescens, has multiple pharmacological effects such as anti-osteoporosis, neuroprotection, anti-tumor, anti-oxidation and anti-inflammation, and can be used for treating diseases such as rheumatoid arthritis, leukemia and Alzheimer's disease. The molecular formula of psoralen is C 11 H6O3, the molecular weight is 186.163, the CAS registration number is 66-97-7, and the structural formula is:
[0004] SUMMARY
[0005] The application aims to provide a new use of psoralen, and in particular, to provide application of psoralen in preparation of a medicine for treating sepsis.
[0006] According to an aspect of the application, application of psoralen in preparation of a medicine for treating sepsis is provided.
[0007] In some embodiments, psoralen can be used as a single active ingredient or together with other pharmaceutically acceptable active ingredients which do not antagonize psoralen in preparation of a medicine for treating sepsis.
[0008] In some embodiments, the composition of the medicine for treating sepsis can further include one or more pharmaceutically acceptable adjuvants.
[0009] In some embodiments, the pharmaceutically acceptable adjuvant includes but is not limited to a filler, a binder, a disintegrant, a lubricant, a thickener, a pigment, a flavoring agent, a solvent, a surfactant, a preservative, an antioxidant, a coating agent and the like.
[0010] The filler can be one or more of starch, sucrose, maltodextrin, resistant dextrin, lactose, microcrystalline cellulose, pregelatinized starch, sorbitol, xylitol and erythritol; the binder can be one or more of starch paste, sodium carboxymethyl cellulose, hydroxypropyl methyl cellulose, hydroxypropyl cellulose, methyl cellulose, ethyl cellulose, povidone, gelatin, polyethylene glycol, ethanol and water; the disintegrant can be one or more of dry starch, sodium carboxymethyl starch, low-substituted hydroxypropyl cellulose, cross-linked polyvinylpyrrolidone, cross-linked sodium carboxymethyl cellulose and effervescent disintegrant (sodium bicarbonate, citric acid); the lubricant can be one or more of magnesium stearate, silicon dioxide, talc and polyethylene glycol; the thickening agent can be one or more of hydrogenated castor oil, glycerol monostearate and aluminum stearate; and the pigment can be one or more of sappan wood, betanin, cochineal carmine, curcumin, carotene, amaranth, tartrazine, carmine, alizarin blue and sunset yellow.
[0011] In some embodiments, the dosage form of the drug for treating sepsis can be an oral preparation, an injection or a topical preparation. The relevant dosage forms can be prepared according to the conventional processes in the field of pharmaceutical preparations.
[0012] In some embodiments, the oral preparation can be a tablet, a granule, a capsule, a pill, an emulsion or a powder. When psoralen is used as the single active ingredient in the oral preparation, the oral dose of the oral preparation can be 5-6 mg / kg·d in terms of the content of psoralen. Preferably, when psoralen is used as the single active ingredient in the oral preparation, the oral dose of the oral preparation is 5.5 mg / kg·d in terms of the content of psoralen, and the treatment course is preferably one month.
[0013] In some embodiments, the topical preparation can be a gel patch or a mucilage dispersion type patch. When psoralen is used as the single active ingredient in the topical preparation, the administration dose of the topical preparation can be 5-6 mg / kg·d in terms of the content of psoralen, and preferably 5.5 mg / kg·d, and the treatment course is preferably 1-2 weeks.
[0014] The beneficial effects of the present application include:
[0015] (1) Psoralen can intervene in the pathological process of sepsis through various mechanisms of action such as inhibiting inflammatory response, regulating immune response and promoting tissue repair; the application of psoralen in the treatment of sepsis can effectively control the inflammatory response of sepsis, reduce tissue damage and reduce mortality, thereby improving the survival rate and quality of life of patients with sepsis, and having good efficacy in the treatment of sepsis.
[0016] (2) Psoralen is a natural product, which has high safety and good tolerance, fewer side effects and a wider range of applications compared with traditional therapeutic drugs.BRIEF DESCRIPTION OF DRAWINGS BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 Figures of lung tissue phenotype changes of mice in each group;
[0018] Figure 2 Lung coefficients of mice in each group;
[0019] Figure 3 Figures of HE staining results of lung tissues of mice in each group, in which the microscope shooting magnification is 20 times, and the scale is 50 μm;
[0020] Figures 4-5 Figures of expression results of inflammatory factors IL-1β and IL-6 in serum of mice in each group detected by ELISA method;
[0021] Figures 6-8 Figures of expression results of inflammatory factors TNF-α, IL-6 and IL-1β in lung tissues of mice in each group detected by RT-qPCR;
[0022] Figures 9-10 Figures of proportions of M1 and M2 type macrophages in lung tissues of mice in each group detected by flow cytometry;
[0023] Figure 11 Figure of neutrophil infiltration in lung tissues of mice in each group detected by flow cytometry. DETAILED DESCRIPTION
[0024] The application will be further described in detail below in conjunction with the embodiments. The examples are only used for explanation and do not limit the application in any way. If not otherwise specified, the raw materials and reagents used in the examples are conventional products that can be commercially available; the experimental methods not specified with specific conditions in the examples are usually according to the conventional conditions in the art or according to the conditions suggested by the manufacturers.
[0025] Example 1
[0026] Lipopolysaccharides (LPS) intraperitoneal injection was used to establish a sepsis mouse model to evaluate the therapeutic effect of psoralen on sepsis mice.
[0027] 1. Experimental materials
[0028] 1.1 Materials
[0029] Table 1 Materials and manufacturers
[0030]
[0031]
[0032] 1.2 Experimental instruments
[0033] Electronic analytical balance, centrifuge, pipette, beaker, measuring cylinder, -80℃ refrigerator, ultrapure water machine, Beckman flow cytometer, panoramic scanner, ultramicro ultraviolet visible spectrophotometer, real-time fluorescent quantitative PCR instrument, high-speed homogenizer, etc.
[0034] 1.3 Experimental animals
[0035] SPF level male C57BL / 6 mice, 6-8 weeks old, weighing 21-23g, purchased from Guangdong Weitong Lihua Experimental Animal Technology Co., Ltd. The experimental animals were housed in cages, and the adaptive feeding lasted for one week. The animal feeding environment adopted a simulated natural light cycle lighting mode with a 12h interval between day and night, an environmental temperature of 22-25℃, and a humidity of 45%-55%. The animals were allowed to drink water and eat freely, and the articles used in the animal feeding environment were sterilized.
[0036] 2、Experimental method
[0037] 2.1 Experimental grouping and specific steps
[0038] Take 60 SPF level C57BL / 6J male mice, and randomly divide them into normal group (Normal), model group (Model), positive drug group (Positive), and high, medium and low dose groups of psoralen (PSO-high, PSO-mid, PSO-Low). Each group has 10 mice. The psoralen group is given intragastric administration at the corresponding dose (50mg / kg, 25mg / kg, 12.5mg / kg) once a day for 7 days; the normal group and the model group are given the same amount of 0.9% normal saline; the positive drug group is given intragastric administration of dexamethasone acetate (1.5mg / kg); immediately after the administration on the 7th day, the model group, the positive drug group, and the psoralen group are injected with LPS (25mg / kg) intraperitoneally, and the normal group is injected with the same amount of 0.9% normal saline intraperitoneally. The survival status of the mice is observed every 12h since the modeling; 24h after the modeling, the mice are euthanized, the eyeball blood is taken, the blood is collected and separated to obtain serum for testing, and the lung and cecum contents are taken for examination.
[0039] 2.2 Histopathological observation of mouse lung tissue
[0040] Dissect the lung tissue and take photos to record the overall morphology of the lung tissue.
[0041] Calculate the lung coefficient according to the formula "lung coefficient = lung wet weight (mg) / body weight (g)".
[0042] Take the left half of the lung and fix it with 4% paraformaldehyde, embed it in paraffin, and reserve it for use. Observe the pathological changes of the lung tissue by HE staining.
[0043] 2.3 Determination of the content of inflammatory factors in mouse serum
[0044] The expression of IL-1β and IL-6 in the serum of mice in each group was measured using an enzyme-linked immunosorbent assay (ELISA) kit.
[0045] 2.4 Determination of mRNA expression levels of inflammatory factors in mouse lung tissue by RT-qPCR
[0046] Mouse lung tissue was collected, and the mRNA expression levels of IL-6, IL-1β, and TNF-α were measured.
[0047] 2.4.1 Total RNA extraction from lung tissue
[0048] Before the experiment, the scissors and tweezers were autoclaved and then dried in an oven.
[0049] Using sterile scissors, cut an appropriate amount of lung tissue (approximately 50 mg) and place it in a homogenization tube. Add 1 mL of... Tissue lysis was performed using TRIzol. The tissues were then homogenized using a homogenizer, centrifuged at 12,000 rpm for 15 min, and the supernatant was collected. Chloroform and isopropanol were added, and the mixture was centrifuged again to obtain the total RNA in the aqueous phase.
[0050] 2.4.1.1 Determination of total RNA sample concentration
[0051] RNA sample concentration was determined using NanoDrop 2000 UV spectrophotometer software.
[0052] The total RNA concentration of the sample is obtained by measuring the A260 / A280 ratio in the range of 1.8-2.0.
[0053] 2.4.1.2 Reverse transcription to synthesize cDNA
[0054] For ice-based incubation, add 2 μL of gDNA Remover to each of the eight-tube sets, followed by the appropriate volume of RNA. Mix thoroughly by pipetting, and incubate at room temperature for five minutes. After five minutes, place the tubes on ice. Next, add the appropriate volume of ddH₂O to each of the eight-tube sets, followed by 5 μL of 4×RTmix. Gently pipette for 10 seconds. Seal tightly and centrifuge briefly. Reverse transcription is performed at 42°C for 15 minutes and then at 95°C for 30 seconds to obtain cDNA.
[0055] 2.4.1.3 qRT-PCR
[0056] ①According to the instructions for use of the real-time PCR reagent ( The reaction was performed using Sybr Green qPCR Master Mix. The total reaction volume was 10 μL, with each reactant added sequentially from the table.
[0057] Table 2 qPCR reaction system
[0058] Ingredients 10 μL system 2* Color SYBR Green qPCR Master Mix 5 μL Forward primer (10 μM) 0.2 μL Forward primer (10 μM) 0.2 μL cDNA 1 μL (0.5-2 μL) ddH2O Make up to 10 μL
[0059] Table 3 related primers
[0060] Gene Forward Primer (5'-3') Reverse Primer (5'-3') Actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC IL-1 β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT TNF-α ACGGCATGGATCTCAAA AGATAGCAAATCGGCTGAC
[0061] 2. After the sample was added, the sealing film was covered and sealed, and then the liquid was centrifuged to the bottom of the hole plate by using a centrifuge at 1000 rpm for 1 min.
[0062] 3. The reaction procedure was performed by using a real-time fluorescent quantitative PCR instrument for qRT-PCR, and the specific procedure was set as follows:
[0063] Hot start enzyme activation 95℃ for 5 min, melting 95℃ for 10 s, annealing 60℃ for 30 s, PCR reaction cycle 40 cycles. And read the corresponding Ct value of each sample.
[0064] 2.5 Flow cytometry detection of macrophages and neutrophils in mouse lung tissue
[0065] The percentage of macrophages and neutrophils in lung tissue was determined. After the lung tissue was cut, ground and filtered, red blood cell lysis solution was added for resuspension, and incubated at room temperature for 5 min; PBS was added to terminate red blood cell lysis, centrifuged to remove the supernatant, and then PBS was added for resuspension and cell counting, and then centrifuged to remove the supernatant; antibodies were added, and incubated at room temperature for 30 min in the dark; PBS was added to terminate staining, centrifuged to remove the supernatant, and then PBS was added for resuspension before being subjected to flow cytometry detection. M1 type macrophages: CD86+F4 / 80+CD11b+; M2 type macrophages: CD206+F4 / 80+CD11b+. Neutrophils: CD45+CD11b+Ly6C+, staining. The samples were analyzed by Beckman flow cytometry.
[0066] 3. Statistical processing
[0067] Each data was expressed as mean ± standard error (mean ± SEM), and the graphpad Prism 9.0 software was used for drawing, and P<0.05 was used as the standard to represent significant difference. Comparison between normal group and model group, independent sample T test (Student's test) was used. Compared with the model group, * : P<0.05, ** : P<0.01; *** : P<0.001; compared with the normal group, # : P<0.05, ## : P<0.01, ### : P<0.001.
[0068] 4. Results
[0069] 4.1 Lung phenotype and lung coefficient of sepsis mice
[0070] As shown in Figure 1 , the lung tissue of normal group mice was normal in shape, smooth in surface and pink in color; compared with the normal group, the lung tissue of model group mice was larger in volume and accompanied by a large number of dark red bleeding spots; the lung tissue of positive drug group and psoralen administration group mice had a small amount of dark red bleeding spots, and the rest was pink in color. It showed that psoralen could alleviate acute lung injury caused by sepsis.
[0071] As shown in Figure 2 , compared with the normal group, the lung coefficient of the model group mice was significantly increased (P<0.001), indicating that pulmonary edema occurred and the model was successfully constructed; compared with the model group, the lung coefficient of the psoralen administration group was reduced, among which the low and medium dose groups were significantly reduced and the difference was statistically significant (P<0.01).
[0072] 4.2 Pathological changes of lung tissue of sepsis mice
[0073] As shown in Figure 3 , after 24h of modeling, the degree of lung injury of mice was observed by HE staining. Under the microscope, the lung tissue pathological section was observed. Compared with the normal group, the lung tissue of the model group mice was severely damaged, the lung tissue was congested, the alveolar structure was destroyed, the lung septum was significantly thickened, and a large number of inflammatory cells infiltrated in the lung interstitium and alveoli. Compared with the model group, the lung tissue injury of the psoralen group mice was reduced, the alveolar structure basically existed, the inflammatory cells infiltrated in the lung tissue were reduced, and the bleeding was reduced.
[0074] 4.3 Effect of psoralen on expression of inflammatory factors in serum and lung tissue of sepsis mice
[0075] (1) The expression of inflammatory factors in the serum of mice was detected by ELISA method. As shown in Figures 4-5 , compared with the model group, the expression of serum inflammatory factor IL-1β in the psoralen group was significantly decreased (P<0.001), the serum inflammatory factor IL-6 in the low and high dose groups was significantly reduced (P<0.05), and the medium dose group was reduced; it showed that psoralen treatment could reduce the level of inflammatory factors.
[0076] (2) The expression of inflammatory factors TNF-α, IL-6 and IL-1β in lung tissue was detected by RT-qPCR. Figures 6-8 The experimental results showed that compared with the normal group, the expression of TNF-α, IL-6 and IL-1β in the model group was significantly increased (P<0.001); compared with the model group, psoralen significantly reduced the expression of these inflammatory factors in the lung (P<0.01).
[0077] 4.4 Effect of psoralen on the number of monocytes, macrophages and neutrophils in the lung tissue of sepsis mice
[0078] The proportion of M1 and M2 macrophages in the lung tissue of mice was detected by flow cytometry to more directly observe the change of macrophage phenotype. As shown in Figures 9-10 The results showed that, compared with the model group, the proportion of M1 macrophages in the psoralen group decreased (P<0.05) Figure 9 Compared with the normal group, the content of M2 macrophages in the model group mice after modeling decreased significantly (P<0.001), while the content in the psoralen group mice increased significantly (P<0.01) Figure 10 The above results show that psoralen can reduce the proportion of M1 pro-inflammatory macrophages in the lung of sepsis mice and increase the proportion of M2 anti-inflammatory macrophages.
[0079] Flow cytometry was used to detect the infiltration of neutrophils in the lung tissue of mice. The results are shown in Figure 11 Compared with the normal group, the proportion of neutrophil infiltration in the lung tissue of the model group mice increased significantly, and the statistical results had significant difference (P<0.001). Compared with the model group mice, the proportion of neutrophils in the lung of the psoralen medium dose group mice decreased significantly (P<0.01).
[0080] The above only describes some embodiments of the present application. For those skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are all within the protection scope of the present application.
Claims
1. Use of psoralen in the preparation of a medicament for treating sepsis.
2. Use according to claim 1, characterized in that, The psoralen is used as a single active ingredient or together with other pharmaceutically acceptable active ingredient(s) which does not antagonize psoralen in the preparation of a medicament for treating sepsis.
3. Use according to claim 1 or 2, characterized in that, The medicament for treating sepsis further comprises pharmaceutically acceptable excipient(s).
4. Use according to claim 3, characterized in that, The medicament for treating sepsis is oral preparation, injection or external preparation.
5. Use according to claim 4, characterized in that, The oral preparation is tablet, granule, capsule, pill, emulsion or powder.
6. Use according to claim 4, characterized in that, The external preparation is gel patch or mucilage dispersion type patch.
7. Use according to claim 3, characterized in that, The excipient is selected from at least one of filler, binder, disintegrant, lubricant, thickening agent, pigment, flavoring agent, solvent, surfactant, preservative, antioxidant, coating agent.