New application of eltrombopag

Abstract

The invention relates to the technical field of biological medicines, in particular to novel application of eltrombopag. The eltrombopag can act on an NS2B / NS3pro target spot, inhibit the activity of NS2B / NS3pro, inhibit the activity of dengue virus and Zika virus, can be applied to inhibition of the activity of flavivirus, and also has a treatment effect on diseases mediated by flavivirus.

Description

Technical Field

[0001] The present invention relates to the technical field of biopharmaceuticals, and in particular to a new use of Eltrombopag. Background Art

[0002] Dengue virus (DENV) can be divided into DENV-1, DENV-2, DENV-3 and DENV-4 according to different antigens. Among them, DENV-2 is more prevalent and infection can cause dengue fever. It is a mosquito-borne virus that can cause dengue fever. The clinical symptoms are mainly acute fever and other subclinical manifestations, such as headache, muscle aches, maculopapular rash, etc. In severe cases, it can lead to dengue hemorrhagic fever and dengue shock syndrome, posing a serious threat to human life and health.

[0003] Zika virus belongs to the Flaviviridae family. Infection by Zika virus can also cause acute onset of low-grade fever, maculopapular rash, joint pain (mainly affecting the small joints of the hands and feet), conjunctivitis, and other symptoms include myalgia, headache, orbital pain, and weakness.

[0004] Currently, there are no effective drugs and vaccines that can simultaneously fight dengue virus and Zika virus for clinical treatment and prevention. Therefore, it is of great significance to research and develop low-toxic and highly effective drugs that can simultaneously fight Zika and dengue virus.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to provide a new use of Eltrombopag. The embodiment of the present invention provides a new use of Eltrombopag, which can act on the NS2B / NS3pro target, inhibit the activity of NS2B / NS3pro, and inhibit the activity of dengue virus and Zika virus at the same time, and can be used to inhibit the activity of flavivirus, and also has a therapeutic effect on the diseases mediated by them.

[0007] The present invention is achieved in that:

[0008] In a first aspect, the present invention provides a use of eltrombopag in the preparation of an antiviral preparation for treating or inhibiting flavivirus.

[0009] In alternative embodiments, the flavivirus comprises dengue virus and Zika virus.

[0010] In alternative embodiments, the flavivirus comprises DENV-1, DENV-2, DENV-3 and DENV-4.

[0011] In an alternative embodiment, the antiviral agent is an agent capable of reducing viral mRNA levels.

[0012] In an alternative embodiment, the antiviral agent is an agent that can inhibit the activity of serine protease.

[0013] In an alternative embodiment, the antiviral agent is an agent that reduces viral copy number.

[0014] In a second aspect, the present invention provides a use of eltrombopag in the preparation of an inhibitor for inhibiting the activity of serine proteases.

[0015] In an alternative embodiment, the serine protease comprises NS2B / NS3pro.

[0016] In an alternative embodiment, the serine protease comprises NS2B / NS3pro of dengue virus and NS2B / NS3pro of Zika virus;

[0017] Preferably, the serine protease comprises DENV2 NS2B / NS3pro, DENV4 NS2B / NS3pro and ZIKA NS2B / NS3pro.

[0018] A third aspect is the use of eltrombopag as the sole active ingredient in the preparation of an antiviral drug for the simultaneous treatment of dengue virus and Zika virus.

[0019] The present invention has the following beneficial effects: the embodiments of the present invention can inhibit the activity of Zika virus and dengue virus silk proteases, and at the same time, can also reduce the viral mRNA level and viral load, and then can effectively inhibit dengue virus and Zika virus, and serve as a drug for treating flaviviruses such as dengue virus and Zika virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0021] Figure 1 The test result diagram provided for Experimental Example 1 of the present invention;

[0022] Figure 2 The test result diagram provided for Experimental Example 2 of the present invention;

[0023] Figure 3 This is a test result diagram provided for Experimental Example 3 of the present invention. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0025] Eltrombopag is the first oral non-peptide thrombopoietin receptor agonist approved for the treatment of adult patients with chronic ITP. It is generally used to treat thrombocytopenia in patients with chronic idiopathic thrombocytopenic purpura (ITP) who have failed to respond to glucocorticoids, immunoglobulin therapy or after splenectomy. There are few existing technologies that use Eltrombopag as an antiviral drug, especially for the treatment of flaviviruses such as dengue virus and Zika virus.

[0026] The dengue virus genome contains a single open reading frame (ORF), which is translated into a unique polyprotein. Host and viral proteases cleave this polyprotein to produce three structural proteins (capsid [C], pre-membrane [prM] and envelope [E]) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5). Among the non-structural proteins, NS3 is a multifunctional protein complex whose main function is to cut the polyprotein formed by the virus into independent proteins, which is necessary for viral replication. The N-terminal region of NS3 is very unstable, and the corresponding enzyme activity also depends on the NS2B auxiliary protein. Therefore, NS2B / NS3pro is a potential antiviral target. Related studies have shown that NS2B / NS3pro is highly conserved in a variety of flaviviruses and is involved in viral replication and immune escape, making it one of the ideal targets for the development of broad-spectrum antiviral drugs. In the past few years, the development of small molecule inhibitors of NS2B / NS3pro has been a hot topic, but no small molecule compounds targeting NS2B / NS3pro have been marketed. Therefore, there is a need in the art to develop a drug targeting the NS2B / NS3pro target, thereby improving the efficacy against various flaviviruses such as dengue virus.

[0027] After creative work, the inventors discovered that Eltrombopag can target NS2B / NS3pro and inhibit the activity of serine proteases, specifically NS2B / NS3pro of dengue virus and NS2B / NS3pro of Zika virus. At the same time, Eltrombopag can also reduce the level of viral mRNA and the number of viral copies, thereby reducing the viral load, thereby achieving the treatment of flaviviruses such as dengue virus and Zika virus alone or simultaneously.

[0028] Specifically, the embodiment of the present invention established a high-throughput screening method through the fluorescence resonance energy transfer (FRET) method, and found that Eltrombopag effectively destroyed the interaction of DENV2 NS2B / NS3pro and had an inhibitory effect on the enzymatic activity of DENV2 NS2B / NS3pro. Further exploration of its broad spectrum found that it also had an inhibitory effect on the enzymatic activity of DENV4 and ZIKA NS2B / NS3pro. The present invention found that Eltrombopag treatment reduced the viral mRNA level in DENV2-infected BHK-21 and Huh-7 cells. In vivo studies found that Eltrombopag had a protective effect on DENV2 infection in AG129 mice, showing good potential for clinical application.

[0029] The Eltrombopag provided in the embodiment of the present invention was purchased from MCE, with a purity of >99%.

[0030] The DENV2, DENV4 and ZIKA provided in the embodiments of the present invention are provided by the Wuhan Institute of Virology.

[0031] DENV2 NS2B / NS3pro, DENV4 NS2B / NS3pro and ZIKA NS2B / NS3pro in the embodiment of the present invention are obtained by constructing a recombinant prokaryotic expression plasmid pET-28a-NS2B-NS3, and transforming it into E.coli Rosetta BL213 (DE3) competent cells, inducing NS2B-NS3 protease expression by IPTG, and separating and purifying it using a HisTrapTM affinity chromatography column. The above methods and processes are all existing methods and processes, and the embodiments of the present invention will not be described in detail.

[0032] The cell culture growth medium used in the embodiment of the present invention is composed of: DMEM culture medium containing 10% fetal bovine serum and 1% ampicillin / streptomycin antibiotics, and stored at 4°C.

[0033] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0034] Experimental Example 1

[0035] Detection of the inhibitory effect of eltrombopag on DENV2 NS2B / NS3, DENV4 NS2B / NS3 and ZIKA NS2B / NS3 proteases

[0036] Experimental steps:

[0037] 1. The fluorescent peptide substrate Bz-Nle-KRR-AMC used in the experiment was purchased from KKL Med;

[0038] 2. Prepare the buffer for NS2B / NS3pro reaction: 200 mM Tris-HCl pH 8.5;

[0039] 3. Configure the experimental reaction system: the total reaction volume is 20uL, of which 1uL of Eltrombopag (final concentration gradient is 200μM, 100μM, 50μM, 25μM, 6.25μM, 3.125μM), 9uL of DENV2S2B / NS3pro and DENV4 NS2B / NS3pro (diluted with buffer to a final concentration of 600nM), and 9uL of ZIAK NS2B / NS3pro (diluted with buffer to a final concentration of 150nM) are mixed in the ELISA plate and incubated at 37°C for 10min, and then 10uL of fluorescent peptide substrate (diluted with buffer to a final concentration of 20μM) is added;

[0040] 4. Detection: The microplate reader (BioTek SYNERGY H1 microplate reader) was set with a gain value of 85, excitation light / emission light of 360nm / 460nm, detection interval of 3min, and total time of 30min;

[0041] 5. Calculation: The fluorescence value of the blank group at 15 minutes was used as a reference to calculate the inhibition rate of the drug-treated group. According to the inhibition rates of the drug-treated groups with different concentrations, the Prism 8.0 software was used to fit the drug-enzyme inhibition rate curve and calculate the half effective inhibition concentration of Eltrombopag.

[0042] Results Figure 1 ,according to Figure 1 It can be seen that Eltrombopag can target NS2B / NS3pro and inhibit the activity of NS2B / NS3pro, and then it can act as a serine protease inhibitor. Specifically, Eltrombopag has an inhibitory effect on DENV2 NS2B / NS3pro, DENV4 NS2B / NS3pro and ZIKANS2B / NS3pro, and the inhibitory effect has a concentration-dependent effect. After calculation, the enzyme activity inhibition IC 50 They were 26.43μM, 26.18μM and 29.81μM respectively. This indicates that Eltrombopag can simultaneously inhibit flaviviruses such as Zika virus and dengue virus.

[0043] Experimental Example 2

[0044] In vitro antiviral activity of eltrombopag against DENV2

[0045] Methods: BHK-21 / Huh-7 cells in logarithmic growth phase were cultured at 4×10 4Cells / well were inoculated in a 48-well cell culture plate and cultured in a 37°C, 5% CO2 incubator for 14-18h. The initial concentration of Eltrombopag was 50μM, and the drug was diluted three times in DMEM containing 2% fetal bovine serum, with a total of 7 concentration gradients; a control group of drug solvent dimethyl sulfoxide (DMSO, 0.1% DMEM containing 2% fetal bovine serum) was set; a positive drug group (ribavirin, starting concentration of 50μM, three-fold dilution of 7 concentrations) was set. After removing the cell supernatant, 200μL of drug solution was added to the cells and incubated at 37°C for 1h. 10μL of virus dilution was added to each well (multiplicity of infection MOI = 2), and the cells were infected at 37°C for 1h. The infected material was fully removed and the cells were washed once with 200μL PBS. 200μL of drug culture medium or culture medium containing DMSO of the corresponding concentration was added to the well again, and culture was continued for 46h, and 200μL of cell culture supernatant was collected. qRTPCR was used to determine the viral copy number. Viral nucleic acid was extracted using DNA / RNAExtraction Kit (Prepackaged, Norwegian), and the copy number was detected using HiScript IIOne StepqRTPCR SYBR Green Kit (Norwegian). The copy number was detected using the standard curve method: DENV2 used a DENV2 NS5A plasmid with a known copy number (VG40267-G, Sino Biological) as a standard, and specific primers targeted NS5A (F: GCACGTGAGGCTGTTGAAGATAG; R: ACCATATGGCTCTGCTGCCT). According to the standard curve, the copy number of each sample was calculated. The inhibition rate of the drug-treated group was calculated using the copy number of the DMSO group as a reference. According to the inhibition rate of the drug-treated group with different concentrations, Prism 8.0 software was used to fit the drug inhibition rate curve, and the half-effective inhibitory concentration of Eltrombopag on DENV2 was calculated.

[0046] Results Figure 2 ,according to Figure 2 It can be seen that eltrombopag has an EC 50 The EC value for DENV2 in Huh-7 cells was 0.442 μM. 50 It is 1.46μM.

[0047] Experimental Example 3

[0048] Method: 10 7 TCID 50Female mice (7-11 weeks old, n=5 per group) were attacked intraperitoneally (ip) with DENV-2 strain (200uL). Immediately after the mice were challenged, 200μL was administered intraperitoneally to the other side. The dose of Eltrombopag was 10 and 20mg / kg for each mouse. The positive drug group (NITD008) was gavaged with 200uL at a dose of 10mg / kg, once in the morning and evening. The control group was given the same volume of solvent (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% saline), and then the same amount of medication was given in the same manner at the same time for two consecutive days, and the changes in body weight were recorded. The mice were killed on the second day after the challenge, and half of the spleen, liver and kidney were collected to detect the copy number therein. The virus copy number was detected by qRT-PCR, and the detection method was the same as the standard curve method in Example 2. All mouse experiments were performed under animal biosafety level 2 (ABSL-2) conditions, and the entire experimental process strictly complied with the ethical protocols approved by the Laboratory Animal Ethics Committee.

[0049] Results Figure 3 ,according to Figure 3 It can be seen that on the second day, the viral copies in the liver, spleen and kidney tissues of mice challenged with the virus via intraperitoneal route were significantly decreased in the eltrombopag-treated group compared with the control group, indicating that eltrombopag has an antiviral effect in vivo.

[0050] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A use of eltrombopag in the preparation of an antiviral preparation for treating or inhibiting flavivirus.

2. The use according to claim 1, characterized in that: The flaviviruses include dengue virus and Zika virus.

3. The use according to claim 1, characterized in that: The flaviviruses include DENV-1, DENV-2, DENV-3 and DENV-4.

4. The use according to claim 1, characterized in that: The antiviral preparation is a preparation that can reduce the level of viral mRNA.

5. The use according to claim 1, characterized in that: The antiviral preparation is a preparation capable of inhibiting the activity of serine protease.

6. The use according to claim 1, characterized in that: The antiviral preparation is a preparation that reduces the number of viral copies.

7. Use of Eltrombopag in the preparation of an inhibitor for inhibiting the activity of serine proteases.

8. The use according to claim 7, characterized in that: The serine proteases include NS2B / NS3pro.

9. The use according to claim 7, characterized in that: The serine proteases include NS2B / NS3pro of dengue virus and NS2B / NS3pro of Zika virus; Preferably, the serine protease comprises DENV2 NS2B / NS3pro, DENV4 NS2B / NS3pro and ZIKA NS2B / NS3pro.

10. Use of eltrombopag as the sole active ingredient in the preparation of an antiviral drug for the simultaneous treatment of dengue virus and Zika virus.

Images