New uses for eltrombopag

By acting on the NS2B/NS3pro target, eltrombopag inhibits the activity of serine proteases, solving the problem of the lack of effective anti-dengue virus and Zika virus in the existing technology, and achieving effective inhibition and treatment of flaviviruses.

CN119818487BActive Publication Date: 2025-10-03WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411912206.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-24
Publication Date
2025-10-03
Estimated Expiration
2044-12-24

AI Technical Summary

Technical Problem

Currently, there is a lack of effective drugs and vaccines against both dengue virus and Zika virus. Eltrombopag is rarely used in existing technologies, especially for the treatment of flaviviruses.

Method used

Eltrombopag inhibits dengue virus and Zika virus by acting on the NS2B/NS3pro target, inhibiting the activity of serine protease, reducing viral mRNA levels and viral copy number.

Benefits of technology

Eltrombopag can effectively inhibit the activity of Zika virus and dengue virus proteases, reduce viral mRNA levels and viral loads, and achieve effective treatment of flaviviruses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119818487B_ABST
    Figure CN119818487B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biopharmaceutical technology, and more specifically, to a novel use of eltrombopag. Eltrombopag can act on the NS2B / NS3pro target site, inhibiting the activity of NS2B / NS3pro, while also inhibiting the activity of dengue and Zika viruses. It can also be used to inhibit the activity of flaviviruses and has therapeutic effects on diseases mediated by them.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biopharmaceuticals, and in particular to a new use of Eltrombopag. Background Art

[0002] Dengue virus (DENV) can be divided into DENV-1, DENV-2, DENV-3 and DENV-4 according to different antigens. Among them, DENV-2 is more prevalent and infection can cause dengue fever. It is a mosquito-borne virus that can cause dengue fever. The clinical symptoms are mainly acute fever and other subclinical manifestations such as headache, muscle aches, maculopapular rash, etc. Severe cases can lead to dengue hemorrhagic fever and dengue shock syndrome, posing a serious threat to human life and health.

[0003] Zika virus belongs to the Flaviviridae family. Infection by Zika virus can also cause acute onset of low-grade fever, maculopapular rash, joint pain (mainly affecting the small joints of the hands and feet), conjunctivitis, and other symptoms including myalgia, headache, orbital pain, and weakness.

[0004] Currently, there are no effective drugs or vaccines that can simultaneously fight dengue virus and Zika virus for clinical treatment and prevention. Therefore, research and development of low-toxic, highly effective drugs that can simultaneously fight Zika and dengue virus is of great significance.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The present invention aims to provide a new use of eltrombopag. The present invention provides a new use of eltrombopag, which can act on the NS2B / NS3pro target site to inhibit the activity of NS2B / NS3pro, while also inhibiting the activity of dengue virus and Zika virus. It can also be used to inhibit the activity of flaviviruses and has therapeutic effects on diseases mediated by them.

[0007] The present invention is achieved in that:

[0008] In a first aspect, the present invention provides a use of eltrombopag in the preparation of an antiviral preparation for treating or inhibiting flavivirus.

[0009] In alternative embodiments, the flavivirus comprises dengue virus and Zika virus.

[0010] In alternative embodiments, the flavivirus comprises DENV-1, DENV-2, DENV-3, and DENV-4.

[0011] In an alternative embodiment, the antiviral agent is an agent capable of reducing viral mRNA levels.

[0012] In an alternative embodiment, the antiviral agent is an agent capable of inhibiting the activity of serine proteases.

[0013] In an alternative embodiment, the antiviral agent is an agent that reduces viral copy number.

[0014] In a second aspect, the present invention provides a use of eltrombopag in the preparation of an inhibitor for inhibiting serine protease activity.

[0015] In an alternative embodiment, the serine protease comprises NS2B / NS3pro.

[0016] In an alternative embodiment, the serine protease comprises NS2B / NS3pro of dengue virus and NS2B / NS3pro of Zika virus;

[0017] Preferably, the serine protease comprises DENV2 NS2B / NS3pro, DENV4 NS2B / NS3pro and ZIKA NS2B / NS3pro.

[0018] In a third aspect, a method of using eltrombopag as the sole active ingredient in the preparation of an antiviral drug for the simultaneous treatment of dengue virus and Zika virus.

[0019] The present invention has the following beneficial effects: the embodiments of the present invention can inhibit the activity of Zika virus and dengue virus silk protease, and at the same time, can also reduce the viral mRNA level and viral load, thereby effectively inhibiting dengue virus and Zika virus, and can be used as a drug for treating flaviviruses such as dengue virus and Zika virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 This is a test result diagram provided for Experimental Example 1 of the present invention;

[0022] Figure 2 This is a test result diagram provided for Experimental Example 2 of the present invention;

[0023] Figure 3 This is the test result diagram provided for Experimental Example 3 of the present invention. DETAILED DESCRIPTION

[0024] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0025] Eltrombopag is the first oral non-peptide thrombopoietin receptor agonist approved for the treatment of adult patients with chronic ITP. It is generally used to treat thrombocytopenia in patients with chronic idiopathic thrombocytopenic purpura (ITP) who have failed glucocorticoids, immunoglobulins, or who have undergone splenectomy. Eltrombopag is rarely used as an antiviral drug, particularly for flaviviruses such as dengue virus and Zika virus.

[0026] The dengue virus genome consists of a single open reading frame (ORF), which is translated into a unique polyprotein. Host and viral proteases cleave this polyprotein to produce three structural proteins (capsid [C], premembrane [prM], and envelope [E]) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5). Among the nonstructural proteins, NS3 is a multifunctional protein complex whose primary function is to cleave the viral polyprotein into individual proteins, essential for viral replication. However, the N-terminal region of NS3 is highly unstable, and its enzymatic activity is dependent on the NS2B accessory protein, making NS2B / NS3pro a potential antiviral target. Studies have shown that NS2B / NS3pro is highly conserved among various flaviviruses and is involved in viral replication and immune evasion, making it an ideal target for the development of broad-spectrum antiviral drugs. The development of small molecule inhibitors of NS2B / NS3pro has been a hot topic in recent years, but no small molecule compounds targeting NS2B / NS3pro have been marketed. Therefore, there is a need in the art to develop a drug targeting the NS2B / NS3pro target to improve the effect against various flaviviruses such as dengue virus.

[0027] After extensive creative work, the inventors discovered that eltrombopag can target NS2B / NS3pro to inhibit the activity of serine proteases, specifically those of dengue virus and Zika virus. Eltrombopag can also reduce viral mRNA levels and viral copy number, thereby lowering the viral load, thereby enabling the treatment of flaviviruses such as dengue and Zika, either alone or simultaneously.

[0028] Specifically, the present invention established a high-throughput screening method using the fluorescence resonance energy transfer (FRET) method, and found that eltrombopag effectively disrupted the DENV2 NS2B / NS3pro interaction and had an inhibitory effect on the enzymatic activity of DENV2 NS2B / NS3pro. Further exploration of its broad spectrum revealed that it also inhibited the enzymatic activity of DENV4 and ZIKA NS2B / NS3pro. The present invention found that eltrombopag treatment reduced viral mRNA levels in DENV2-infected BHK-21 and Huh-7 cells. In vivo studies found that eltrombopag had a protective effect against DENV2 infection in AG129 mice, demonstrating good potential for clinical application.

[0029] The eltrombopag provided in the embodiment of the present invention was purchased from MCE, with a purity of >99%.

[0030] The DENV2, DENV4 and ZIKA provided in the embodiments of the present invention are provided by the Wuhan Institute of Virology.

[0031] DENV2 NS2B / NS3pro, DENV4 NS2B / NS3pro, and ZIKA NS2B / NS3pro in the examples of the present invention were obtained by constructing recombinant prokaryotic expression plasmid pET-28a-NS2B-NS3 and transforming them into E. coli Rosetta BL213 (DE3) competent cells. IPTG was used to induce the expression of NS2B-NS3 protease, and the protein was isolated and purified using a HisTrap™ affinity chromatography column. The above methods and processes are all existing methods and processes and will not be described in detail in the examples of the present invention.

[0032] The cell culture growth medium used in the embodiment of the present invention is composed of: DMEM culture medium containing 10% fetal bovine serum and 1% ampicillin / streptomycin antibiotics, and stored at 4°C.

[0033] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0034] Experimental Example 1

[0035] Detection of the inhibitory effect of eltrombopag on DENV2 NS2B / NS3, DENV4 NS2B / NS3 and ZIKA NS2B / NS3 proteases

[0036] Experimental steps:

[0037] 1. The fluorescent peptide substrate Bz-Nle-KRR-AMC used in the experiment was purchased from KKL Med;

[0038] 2. Prepare NS2B / NS3pro reaction buffer: 200 mM Tris-HCl pH 8.5;

[0039] 3. Prepare the experimental reaction system: the total reaction volume is 20uL, including 1uL of eltrombopag (final concentration gradient: 200μM, 100μM, 50μM, 25μM, 6.25μM, 3.125μM), 9uL of DENV2S2B / NS3pro and DENV4 NS2B / NS3pro (diluted with buffer to a final concentration of 600nM), and 9uL of ZIAK NS2B / NS3pro (diluted with buffer to a final concentration of 150nM). Mix well in the ELISA plate and incubate at 37°C for 10min. Then, add 10uL of fluorescent peptide substrate (diluted with buffer to a final concentration of 20μM).

[0040] 4. Detection: The microplate reader (BioTek SYNERGY H1) was set to a gain of 85, excitation / emission at 360 nm / 460 nm, a detection interval of 3 min, and a total detection time of 30 min.

[0041] 5. Calculation: Using the fluorescence value of the blank group at 15 minutes as a reference, calculate the inhibition rate of the drug-treated groups. Based on the inhibition rates of the drug-treated groups at different concentrations, use Prism 8.0 software to fit the drug-enzyme inhibition rate curve and calculate the 50% effective inhibitory concentration of eltrombopag.

[0042] Results see Figure 1 ,according to Figure 1 It can be seen that Eltrombopag can target NS2B / NS3pro and inhibit the activity of NS2B / NS3pro, thereby acting as a serine protease inhibitor. Specifically, Eltrombopag has an inhibitory effect on DENV2 NS2B / NS3pro, DENV4 NS2B / NS3pro, and ZIKA NS2B / NS3pro, and the inhibitory effect is concentration-dependent. After calculation, the enzyme activity inhibition IC measured by this detection system is 50 The results were 26.43μM, 26.18μM and 29.81μM respectively. This indicates that Eltrombopag can simultaneously inhibit flaviviruses such as Zika virus and dengue virus.

[0043] Experimental Example 2

[0044] In vitro antiviral activity of eltrombopag against DENV2

[0045] Methods: BHK-21 / Huh-7 cells in logarithmic growth phase were cultured at 4×10 4Cells were seeded per well in a 48-well cell culture plate and cultured at 37°C in a 5% CO2 incubator for 14-18 hours. Eltrombopag was diluted threefold in DMEM containing 2% fetal bovine serum (FBS) at a starting concentration of 50 μM, with a total of seven concentrations. A control group was prepared using the drug solvent dimethyl sulfoxide (DMSO, diluted in 0.1% DMEM containing 2% FBS). A positive drug control group (ribavirin, starting at 50 μM, was diluted threefold over seven concentrations). After removing the cell supernatant, 200 μL of the drug solution was added to the cells and incubated at 37°C for 1 hour. 10 μL of the virus dilution (multiplicity of infection (MOI) = 2) was added to each well, and the cells were infected at 37°C for 1 hour. After thorough removal of the infection, the cells were washed once with 200 μL of PBS. 200 μL of the corresponding concentration of drug medium or DMSO-containing medium was added to the wells again. Culture was continued for 46 hours, and 200 μL of the cell culture supernatant was collected. Viral copy number was determined by qRT-PCR. Viral nucleic acid was extracted using a DNA / RNA Extraction Kit (Prepackaged, Norvegant), and copy number was detected using the HiScript II One Step qRT-PCR SYBR Green Kit (Norvegant). A standard curve method was used to determine copy number: a DENV2 NS5A plasmid with a known copy number (VG40267-G, Sino Biological) was used as a standard, and specific primers targeted NS5A (F: GCACGTGAGGCTGTTGAAGATAG; R: ACCATATGGCTCTGCTGCCT). The copy number of each sample was calculated based on the standard curve. The inhibition rate of the drug-treated group was calculated using the copy number of the DMSO group as a reference. Prism 8.0 software was used to fit the drug inhibition rate curve based on the inhibition rate of the drug-treated groups at different concentrations, and the half-maximal inhibitory concentration of eltrombopag against DENV2 was calculated.

[0046] Results see Figure 2 ,according to Figure 2 It can be seen that Eltrombopag has an effect on the EC of DENV2 in BHK-21 cells. 50 The EC value for DENV2 in Huh-7 cells was 0.442 μM. 50 It is 1.46μM.

[0047] Experimental Example 3

[0048] Method: Using 10 7 TCID 50Female mice (7-11 weeks old, n=5 per group) were challenged intraperitoneally (ip) with the DENV-2 strain (200 μL). Immediately after challenge, 200 μL of eltrombopag was administered intraperitoneally to the other side of the mouse. Each mouse received 10 or 20 mg / kg of eltrombopag. The positive drug group (NITD008) was gavaged with 200 μL of 10 mg / kg once in the morning and evening. The control group received the same volume of solvent (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% saline). The mice were then administered the same amount of solvent (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% saline) at the same time for two consecutive days, and body weight changes were recorded. Mice were sacrificed on the second day after challenge, and half of the spleen, liver, and kidney were harvested for copy number analysis. Viral copy number was determined by qRT-PCR using the same standard curve method as in Example 2. All mouse experiments were performed under an animal biosafety level 2 (ABSL-2) environment, and the entire experimental process strictly adhered to the ethical protocol approved by the Laboratory Animal Ethics Committee.

[0049] Results see Figure 3 ,according to Figure 3 It can be seen that on the second day, the viral copies in the liver, spleen and kidney tissues of mice challenged with the virus via intraperitoneal administration were significantly reduced in the eltrombopag-treated group compared with the control group, indicating that eltrombopag has an antiviral effect in vivo.

[0050] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A use of eltrombopag in the preparation of an antiviral preparation for treating or inhibiting flavivirus; characterized in that: The flaviviruses include dengue virus and Zika virus.

2. The use according to claim 1, characterized in that The flaviviruses include DENV-1, DENV-2, DENV-3 and DENV-4.

3. The use according to claim 1, characterized in that The antiviral preparation is a preparation that can reduce the level of viral mRNA.

4. The use according to claim 1, characterized in that The antiviral preparation is a preparation capable of inhibiting the activity of serine protease.

5. The use according to claim 1, characterized in that The antiviral preparation is a preparation that reduces the number of viral copies.

6. A use of eltrombopag in the preparation of an inhibitor for inhibiting serine protease activity, characterized in that: The serine proteases include NS2B / NS3pro of dengue virus and NS2B / NS3pro of Zika virus.

7. The use according to claim 6, characterized in that The serine proteases include DENV2 NS2B / NS3pro, DENV4 NS2B / NS3pro and ZIKV NS2B / NS3pro.

8. Use of eltrombopag as the sole active ingredient in the preparation of an antiviral drug for the simultaneous treatment of dengue virus and Zika virus.

Citation Information

Patent Citations

  • Compounds and methods for treating diseases and / or conditions caused by coronavirus

    US20230124467A1

  • Dengue virus and yellow fever virus therapies

    WO2013029006A1