Application of furaflatness and analogues thereof in preparation of medicine for treating pigmented skin diseases

Abstract

The invention provides application of furaflatness and analogues thereof in preparation of medicines for treating pigmented skin diseases. The analogue of the furaflatness comprises vomuciclib, orientin or vitexin, and the analogue of the furaflatness comprises the vomuciclib, the orientin or the vitexin. Experimental results show that after melanocytes and melanoma cells are treated by the FH and the analogues thereof, the melanogenesis ability of the melanocytes and the melanoma cells is significantly reduced, including inhibition of cell proliferation ability, reduction of melanin content, significantly down-regulation of expression levels of melanogenesis key genes such as MITF, TYR and TYRP1, and reduction of activity of tyrosinase. Furthermore, in a zebrafish embryo model, the powerful whitening effect and safety of the FH are observed. Research results show that FH and analogues thereof are expected to become candidate therapeutic drugs for pigmented skin diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to the application of flavopiridol and its analogs in the preparation of drugs for treating pigmented skin diseases. Background Art

[0002] Fipexide Hydrochloride (FH) is a classic dopamine receptor modulator, originally used to treat nervous system-related diseases. The drug has neuroprotective and metabolic regulatory effects, improving cell function by acting on the central nervous system and multiple signaling pathways. In skin-related studies, FH may regulate signaling pathways and inflammatory responses, but there are no reports on FH directly regulating melanocyte function.

[0003] Pigmented skin diseases are caused by a variety of factors, including heredity, gene mutation, external stimulation, drugs, diet and daily routine, which can lead to abnormal differentiation, proliferation and migration of melanocytes in the skin, and disorders in melanin synthesis, secretion and transport. Such skin diseases are very common in dermatology. Although most pigmented skin diseases are not life-threatening, there is still a certain proportion of congenital diseases that are at risk of malignant transformation to melanoma. Huge skin lesions in special parts are often difficult to remove surgically and there is a risk of disfigurement or functional impairment, which will eventually seriously affect the appearance, daily work, study and life, and even death. It brings huge psychological, physical and economic burdens to patients. As people pay more and more attention to their physical and mental health and appearance, more and more patients are beginning to pay attention to early intervention and non-surgical treatments of pigmented skin diseases. Common pigmented skin diseases in clinical practice include various types of pigmented nevi (mainly congenital pigmented nevi and giant nevi with the risk of malignant transformation) and melanoma, various pigmented spots (mainly chloasma, freckles, nevus of Ota, post-inflammatory pigmentation, etc.) and depigmented / hypopigmented spots (mainly vitiligo, post-inflammatory hypopigmentation, etc.), but traditional treatments such as surgery, laser and conventional drugs have very limited effects, and finding safe and effective treatment strategies is still a huge challenge for clinicians. Therefore, it is urgent to screen new treatment targets and develop new drugs and treatment strategies.

[0004] Melanogenesis is a complex biological process that involves the differentiation, proliferation, migration of melanocytes, and the synthesis, secretion, and transport of melanin. This process not only determines the color of the skin, hair, and eyes, but is also closely related to a variety of skin diseases, especially in diseases of abnormal melanin deposition. Melanocytes originate from neural crest cells in the embryonic period, and they function by migrating to the skin, hair follicles, etc. During the differentiation process, regulatory factors such as the Wnt signaling pathway, SOX10, and MITF play an important role. MITF regulates the expression of melanin synthases such as tyrosinase (TYR). Melanocyte differentiation, proliferation, migration, melanin synthesis, and transport in the melanogenesis process are precisely regulated. Disorders in any link will lead to abnormal deposition or uneven distribution of melanin, which in turn can cause a variety of pigmented skin diseases, such as vitiligo: an autoimmune disease in which the immune system attacks melanocytes, causing skin pigmentation to depigment and form white spots; various pigmented spots such as freckles and chloasma, acanthosis nigricans, skin aging and photoaging; congenital pigmented nevus: abnormal proliferation of melanocytes during the embryonic period leads to the formation of pigmented areas on the skin surface; although most are benign, larger congenital pigmented nevus may have the risk of malignant transformation, such as developing into malignant melanoma. In-depth research on these mechanisms not only helps to explain the occurrence of pigmentary diseases, but also provides a basis for the development of new treatment strategies.

[0005] UBR5 (also known as EDD1) is an important member of the E3 ubiquitin ligase family and participates in the ubiquitin-proteasome pathway to regulate the degradation of multiple proteins in cells. As an E3 ubiquitin ligase, UBR5 regulates protein homeostasis in cells by binding to specific substrates and attaching ubiquitin molecules to these proteins, marking them for entry into the proteasome for degradation. UBR5 has a wide range of functions, involving multiple biological processes such as cell cycle control, DNA damage response, gene transcription regulation, and signal transduction, and is closely related to a variety of diseases, especially in cancer, neurodegenerative diseases, and inflammation-related pathological mechanisms. At present, no research reports have described the effects and mechanisms of UBR5 on the melanogenesis function of melanocytes. Summary of the invention

[0006] In view of the deficiencies of the prior art, the purpose of the present invention is to clarify the regulatory role of the drug EA and its analogs in melanogenesis and to provide a new drug for the treatment of pigmented skin diseases.

[0007] This invention combines AI drug virtual screening technology with biological function verification, and we found that FH shows good potential in inhibiting UBR5 activity. Based on the key role of UBR5 in melanogenesis, we speculate that this small molecule inhibitor and its analogs may inhibit melanin production by regulating the expression or function of UBR5, providing theoretical support for the development of efficient and safe whitening products. By deeply exploring the mechanism of action of UBR5 in pigmentation, screening and verifying the function and activity of potential small molecule drugs, this study provides new ideas for drug development based on UBR5 targets. This study not only expands the application potential of UBR5 in the treatment of pigmented skin diseases, but also provides a scientific basis for the research and development of new cosmetics and therapeutic drugs.

[0008] The technical solution of the present invention is: The present invention provides the use of flavopiridol and its analogs in preparing medicines for treating pigmented skin diseases.

[0009] Preferably, the flavopiridol analogs include voruciclib, orientin or vitexin.

[0010] Preferably, the pigmented skin disease includes hyperpigmented skin disease and hypopigmented skin disease.

[0011] Preferably, the pigmented skin diseases include pigmented nevi, pigmented spots, and depigmented / hypopigmented spots.

[0012] Preferably, the pigmented skin diseases include pigmented nevi, congenital pigmented nevi and giant nevi with risk of malignant transformation, chloasma, freckles, nevus of Ota, post-inflammatory pigmentation, vitiligo, and post-inflammatory hypopigmentation.

[0013] Further, the pigmented skin diseases include various types of pigmented nevi (mainly congenital pigmented nevi and those with malignant changes). dangerous giant nevus) and melanoma, various pigmented spots (mainly chloasma, freckles, nevus of Ota, post-inflammatory pigmentation, etc.) and depigmented / hypopigmented spots (mainly vitiligo, post-inflammatory hypopigmentation, etc.).

[0014] The present invention also provides the use of flavopiridol and its analogs in preparing inhibitors or activators for regulating melanogenesis.

[0015] The present invention also provides the use of flavopiridol and its analogs in the preparation of tyrosinase activity inhibitors or enhancers.

[0016] The present invention also provides the use of flavopiridol and its analogs in the preparation of whitening preparations or whitening medicines.

[0017] Furthermore, the flavopiridol analogs include voruciclib, orientin or vitexin.

[0018] Furthermore, the flavopiridol is flavopiridol hydrochloride.

[0019] The experimental results of the present invention found that after FH and its analogs were used to treat melanocytes and melanoma cells, the melanin production ability of the above cells was significantly reduced, including inhibition of cell proliferation ability, reduction of melanin content, and significant downregulation of the expression levels of key melanin production genes MITF, TYR, TYRP1, etc., and reduced tyrosinase activity. Further, in the zebrafish embryo model, we observed the powerful whitening effect and safety of FH. The results of this study suggest that FH and its analogs are expected to become candidate therapeutic drugs for pigmented skin diseases.

[0020] The detailed structure of the present invention is further described below in conjunction with the accompanying drawings and specific embodiments: BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a differential analysis chart of the transcriptome sequencing data of skin tissue (left) and nevus tissue (right) in the GTEX database. After log2 transformation, the wilcox.test was used to compare the mRNA expression level of UBR5 between the two groups.

[0022] Figure 2 This is the test result after knocking out UBR5 in B16F10 cells: Figure 2 A is the color change diagram of centrifugal precipitation; Figure 2 B is a graph showing changes in intracellular melanin content; Figure 2 C is a graph showing changes in tyrosinase activity; Figure 2 D. Western blot method was used to detect the changes in the expression of the important transcription factor MITF and the key proteins TRP1, TRP2 and TYR in the cells. Figure 2 E is Figure 2 Statistical graph of D; Figure 2 F, 2G After knocking out UBR5 in zebrafish, the intensity of melanin signal in the head and its statistical graph were detected; Figure 3 This is the result of Western blot analysis after inhibiting UBR5 expression; Figure 3 A is the expression diagram of MITF, an important transcription factor in the melanin synthesis pathway, and TRP1, TRP2 and TYR, key proteins in melanin synthesis, in PIG1 and MNT1 cells. Figure 3 B. Figure 3 C is a statistical chart showing changes in melanin content and tyrosinase activity; Figure 4 This is the result of Western blot analysis of overexpressed UBR5. Figure 4A is the expression diagram of MITF, an important transcription factor in the melanin synthesis pathway, and TRP1, TRP2 and TYR, key proteins in melanin synthesis, in PIG1 and MNT1 cells. Figure 4 B. Figure 4 C is a statistical graph showing the changes in melanin content and tyrosinase activity in MNT1 cells.

[0023] Figure 5 The method is to use a specific concentration of UBR5 potential binding small molecule drug to intervene in B16F10 cells and detect changes in the melanin content contained in the cells.

[0024] Figure 6 A is the 3D image of EA docking with UBR5 protein. Figure 6 B is a graph showing the proliferation activity of B16F10 cells detected by CCK8 assay after the cells were cultured with medium containing different concentrations of EA for 24 h and 48 h.

[0025] Figure 7 A is a graph showing the protein expression levels of melanogenesis-related genes such as MITF, TYR, TYRP1, and TYRP1 detected by Western blot after B16F10 cell line was treated with specific concentrations of EA; Figure 7 B. Figure 7 C is the result of simultaneously detecting the changes in melanin content and tyrosinase activity.

[0026] Figure 8 A. Figure 8 B is the observation of the melanin signal intensity in the zebrafish head and its statistical results at 2 dpf after culturing zebrafish embryos with culture medium containing a specific concentration of EA. Figure 8 C. Figure 8 D. EA was made into a 2 mg / ml hydrogel and applied to a fixed position on the mouse tail. The changes in the color of the mouse tail were observed for 25 days and the statistical results are shown in the figure.

[0027] Fig. 9 A. Fig. 9 B is the treatment of B16F10 cell line with specific concentrations of EA analogs E1, E2, and E3 to detect the melanin content ( Fig. 9 A) and tyrosinase activity changes ( Fig. 9 B).

[0028] Fig.10 A is the 3D image of FH docking with UBR5 protein. Fig.10 B is a graph showing the proliferation activity of B16F10 cells detected by CCK8 assay after the cells were cultured with medium containing different concentrations of FH for 24 h and 48 h.

[0029] Fig.11A is a graph showing the expression levels of melanogenesis-related gene proteins such as MITF, TYR, TYRP1, and TYRP1 detected by Western blot after B16F10 cell line was treated with a specific concentration of FH; Fig.11 B is a graph showing the results of the melanin content test; Fig.11 C is a graph showing the results of detecting changes in tyrosinase activity.

[0030] Fig.12 This is the image of melanin signal intensity in the zebrafish head observed at 2 dpf after culturing zebrafish embryos with culture medium containing a specific concentration of FH ( Fig.12 A) and its statistical results ( Fig.12 B).

[0031] Fig.13 To treat B16F10 cell line with specific concentrations of FH analogs F1, F2, and F3, and to detect melanin content ( Fig.13 A) and tyrosinase activity changes ( Fig.13 B); Fig.13 C is a schematic diagram of the molecular docking of voruciclib and UBR5. DETAILED DESCRIPTION

[0032] Example 1

[0033] 1. Construction of mouse melanocyte cell line with UBR5 gene knockout and identification by Western blot.

[0034] 1.1 Group settings: sgNC (control group) sg Ubr5 (UBR5 gene knockout group) 1.2 Experimental methods and procedures: (1) Lip2000 transfection reagent: 1 μg of plasmid (purchased from Fenghui Biotechnology) was mixed with 3 μl of transfection reagent and placed at room temperature for 15 min; (2) Add to pre-plated B16F10 cells and incubate for 6 h before replacing the medium with complete medium; (3) After 48 h of culture, add puromycin 1 μg / ml and screen for one week until only a small number of dead cells remain. Then, take the cells for subsequent testing.

[0035] (4) The sgRNA sequence for UBR5 knockout is: #1 GGGTCTGCCTGCGTGAATCA CGG (SED ID NO1) #2 CAGACCCGCGTCATCCGCAC CGG (SED ID NO2) 1.3 Experimental results: Depend on Figure 2 The mouse melanocyte cell line with UBR5 gene knockdown shown in D was successfully constructed, and Western blot identification results showed that the expression level of UBR5 protein in the gene knockout group was significantly decreased compared with the control group.

[0036] The sgRNA sequence synthesis method, siRNA sequence synthesis method, and shRNA sequence synthesis method in the embodiment are existing methods, and reference can be made to the literature: Bek JW, Shochat C, De Clercq A, De Saffel H, Boel A, Metz J, Rodenburg F, Karasik D, Willaert A, Coucke PJ. Lrp5 Mutant and CrispantZebrafish Faithfully Model Human Osteoporosis, Establishing the Zebrafish asa Platform for CRISPR-Based Functional Screening of Osteoporosis CandidateGenes. J Bone Miner Res. 2021 Sep;36(9):1749-1764. doi: 10.1002 / jbmr.4327 .Epub 2021 May 19. PMID: 33957005.

[0037] 2. Construction of human melanocyte cell line with gene silencing / overexpression of UBR5 and identification by Western blot.

[0038] 2.1 Group settings: siNC or Vector (control group) si UBR5 or UBR5 OE (UBR5 gene silencing / overexpression group) 2.2 Experimental methods and procedures: Use lip2000 transfection reagent, mix 100 pmol siRNA with 5 μl transfection reagent, and leave at room temperature for 20 minutes; Add the pre-selected PIG1 and MNT1 cells and change the medium after incubation for 6 h; (3) After 48 h of culture, the cells were harvested for the next experiment.

[0039] (4) The siRNA sequence for UBR5 silencing (purchased from Suzhou Genema Gene Co., Ltd.) is: #1 GCAAGGUUGAAUUGUUUCATT (SED ID NO3) #2 GGUCAUAAGUAGAGAAGAUTT (SED ID NO4) The UBR5 overexpression shRNA sequence (purchased from Suzhou Genema Gene Co., Ltd.) is: ACGUGACACGUUCGGAGAA (SED ID NO5) 2.3 Experimental results: Depend on Figure 3 A. The human melanocyte cell line with gene silencing or overexpression of UBR5 shown in 4A was successfully constructed. Western blot identification results showed that compared with the control group, the expression level of UBR5 protein in the gene silencing / overexpression group was significantly decreased / increased.

[0040] 3. After intervening in UBR5 gene expression, the expression levels of melanogenesis-related genes MITF (microphthalmia-related transcription factor), TRP1 (tyrosinase-related protein 1), TRP2 (tyrosinase-related protein 2), TYR (tyrosinase) and other proteins in melanocytes, as well as the melanin content and tyrosinase activity of melanocytes were detected.

[0041] 3.1 Experimental methods and procedures: Western Blot: Protein was extracted with RIPA lysis buffer (Cat. No.: P0013C, Beyotime) and centrifuged at 12000 rpm for 10 min at 4 °C. Protein concentration was determined by BCA protein assay (Cat. No.: P0010S, Beyotime) and boiled for 5 min before the experiment. 20 μg protein sample was loaded into each well, separated by 10% SDS PAGE (separation gel), and transferred to PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibodies (TYR, TYRP1, TYRP1, MITF, UBR5) at 4 °C overnight. The PVDF membrane was washed with PBST and then incubated with HRP (horseradish peroxidase)-labeled goat anti-rabbit IgG (Cat. No.: AS014, abclonal) or anti-mouse IgG (Cat. No.: AS003, abclonal) secondary antibody for 60 min at room temperature. The bound antibodies were detected by ECL chemiluminescence (Cat. No.: P10300, New Cycle).

[0042] Among them, BCA: bicinchoninic acid; PVDF: polyvinylidene fluoride; BSA: bovine serum albumin; ECL: Electrochemiluminescence.

[0043] (2) Determination of melanin content: PIG1, MNT1, and B16F10 cells (2.5×10 5 The cells were collected by trypsin digestion and centrifugation, and then lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using a microplate reader.

[0044] (3) Tyrosinase activity assay: PIG1, MNT1, and B16F10 cells (2.5×10 5 The cells were plated (10 cells per 35 mm culture dish) and digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μl 1% tritonX100 (Cat. No. A600198-0500, Bioengineering) and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA (Cat. No. 59-92-7, Aladdin) at 37 °C for 20 min, and the absorbance at 475 nm was detected using a microplate reader.

[0045] 3.2 Experimental results: Figure 2 DE, 3A, and 4A showed that compared with the control group, the expression levels of melanogenesis-related genes MITF, TRP1, TRP2, TYR and other proteins in the gene intervention group changed significantly.

[0046] Figure 2 The results of BC, 3BC, and 4BC showed that compared with the control group, there were significant changes in melanin content and tyrosinase activity in the gene intervention group.

[0047] 4. Observe the changes in melanin production ability in the zebrafish model after knocking out the UBR5 gene.

[0048] 4.1 Group settings: sgNC (control group) sg Ubr5 (UBR5 gene knockout group) 4.2 Experimental methods and procedures: (1) The sgRNA sequence for UBR5 knockout was designed as follows: #1 GGGTCTGCCTGCGTGAATCA CGG (SED ID NO1), #2 CAGACCCGCGTCATCCGCAC CGG (SED ID NO2) The sgRNA target was co-injected. The control group was injected with an ineffective target. Wild zebrafish embryos were microinjected at the 1-cell stage. About 200 embryos were injected in each group. After 2 dpf, 15 fish were randomly selected from each group to take pictures of the zebrafish head and analyze the melanin signal intensity of the zebrafish head to evaluate the differential changes in its melanin production.

[0049] 4.3 Experimental results: Depend on Figure 2 As shown in FG, compared with the control group, the intensity of melanin signal in the zebrafish head was significantly decreased after UBR5 knockout.

[0050] 5. High-throughput AI virtual screening of potential small molecule drugs for UBR5 based on drug library 5.1 Experimental methods and procedures: Specifically, it can be obtained through protein docking, and the software Maestro is used to simulate the molecular docking of the target protein and the compound to predict its possible binding sites and interactions. The software Maestro is used to simulate the molecular docking of UBR5 with the compounds in the Seleck compound library (L1200, L1300, L1400, L1700, L1700-1, L3500, L3600, L3800, L3900, L5000, L5800, L7800, L7900) to find compounds that may bind to UBR5.

[0051] 5.2 Experimental results: The results showed that about 30 small molecule compounds all had good binding to the UBR5 enzyme activity center or its surroundings, indicating that these compounds blocked or activated the UBR5 catalytic site to a certain extent, thereby inhibiting or activating the UBR5 enzyme activity. See Table 1 below for details:

[0052] 6. UBR5 has the potential to detect changes in melanin content in melanocytes after intervention with small molecule drugs.

[0053] 6.1 Group settings: Control GSK369796 dihydrochloride 50 μM (U1 intervention group) CP-91149 50 μM (U2 intervention group) Cefprozil monohydrate 50 μM (U3 intervention group) Cefaclor 50 μM (U4 intervention group) Ampicillin 50 μM (U5 intervention group) Cephalexin 50 μM (U6 intervention group) AZD5363 50 μM (U7 intervention group) Ellagic acid 0.25 μM (EA intervention group) Flavin 0.1 μM (FH intervention group) 6.2 Experimental methods and procedures: (1) Determination of melanin content: B16F10 melanocytes (2.5×10 5 The cells were collected by trypsin digestion and centrifugation, and then lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using a microplate reader.

[0054] 6.3 Experimental results: Figure 5 The results showed that compared with the control group, there was no significant change in the melanin content in the U1-U7 intervention groups. The melanin content in the two groups showed significant differences. The above results suggest that EA and FH, as potential UBR5 binding small molecules, exhibit unique melanogenesis inhibitory activity.

[0055] Example 2 1. Effect of EA (ellagic acid) on proliferation of melanocytes.

[0056] 1.1 Group settings: Control EA 0.1 μM (EA group concentration 1) EA 1 μM (EA group concentration 2) EA 10 μM (EA group concentration 3) EA 50 μM (EA group concentration 4) 1.2 Experimental methods and procedures: (1) CCK8 assay: cells were plated at 5 x 10 3 100 µL of culture medium were inoculated into 96-well plates, and blank wells were set. EA with gradient concentrations was added and culture was continued for 24 h and 48 h. After the culture was completed, 10 µL of CCK-8 solution (mixed with culture medium in a ratio of 1:10) was added to each well. The 96-well plate was returned to the incubator and incubated in the dark at 37 °C and 5% CO2 for 2-3 h. After the incubation, the absorbance (OD value) of each well was read at a wavelength of 450 nm using a microplate reader.

[0057] 1.3 Experimental results: Figure 6AB showed that EA bound to the UBR5 enzyme activity center or its periphery and could significantly inhibit the proliferation of melanocyte cell lines in a concentration-dependent and time-dependent manner.

[0058] 2. Western blot was used to identify changes in the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR.

[0059] 2.1 Group settings: Control EA 0.25 μM 24h (EA intervention group 1) EA 0.25 μM 48h (EA intervention group 2) 2.2 Experimental methods and procedures: (1) Western Blot: Protein was extracted with RIPA lysis buffer (Biyuntian) and centrifuged at 12000 rpm for 10 min at 4 °C. Protein concentration was determined by BCA protein assay and boiled for 5 min before the experiment. 20 μg of protein sample was loaded into each well, separated by 10% SDS PAGE, and transferred to PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibodies (TYR, TYRP1, TYRP1, MiTF, UBR5) at 4 °C overnight. The PVDF membrane was washed with PBST and then incubated with HRP-labeled goat anti-rabbit IgG or anti-mouse IgG secondary antibodies at room temperature for 60 min, and the bound antibodies were detected by ECL chemiluminescence. (The specific method is the same as Example 1) 2.3 Experimental results: Depend on Figure 7 As shown in A, after B16F10 cells were treated with EA, Western blot results showed that compared with the control group, the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR in the intervention group was significantly downregulated.

[0060] 3. Determination of the effect of EA on melanin content and tyrosinase activity in melanocytes.

[0061] 3.1 Group settings: Control EA 0.25 μM 24h (EA intervention group 1) EA 0.25 μM 48h (EA intervention group 2) 3.2 Experimental methods and procedures: (1) Determination of melanin content: Melanocyte cell line (2.5×10 5The cells were harvested by trypsin digestion and centrifugation. The cells were lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using a microplate reader.

[0062] (2) Tyrosinase activity assay: Melanocyte cell line (2.5×10 5 The cells were plated (100 cells per 35 mm culture dish) and digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μL 1% tritonX100 and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37 °C for 20 min, and the absorbance at 475 nm was detected using an enzyme reader.

[0063] 3.3 Experimental results: Figure 7 BC showed that EA could significantly inhibit the melanin content and tyrosinase activity of B16F10 cells.

[0064] 4. In vivo study on the regulatory role of EA in melanogenesis in zebrafish and mouse tail models.

[0065] 4.1 Group settings: Control EA (EA intervention group) Gel-vehicle (blank gel group) Gel-EA (EA gel group) 4.2 Experimental methods and procedures (1) Zebrafish melanin detection: 6 hpf wild-type AB strain zebrafish were randomly selected and placed in a 6-well plate, and 30 zebrafish embryos were treated in each well. EA (concentration 1.95 μg / ml) was given in water and a normal control group was set up. The volume of each well was 3 mL. After 2 days of treatment at 28°C, 5 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. The Image J advanced image processing software was used to analyze and collect data. The melanin signal intensity of the zebrafish head was analyzed, and the whitening effect of the sample was evaluated by the statistical analysis results of this indicator. The statistical analysis results were expressed as mean ± SEM. SPSS26.0 software was used for statistical analysis.

[0066] (2) Detection of melanin in the mouse tail: The mice were randomly divided into three groups. Except for the control group, no intervention was given. Blank gel and EA gel were applied to a fixed area of ​​the mouse tail every day. After continuous administration for 25 days, the color changes of the drug-coated area of ​​the mouse tail were observed, and the Image J advanced image processing software was used to analyze and collect data, and the grayscale value of the mouse tail was analyzed.

[0067] 4.3 Experimental results: Figure 8 The results showed that EA could significantly inhibit the melanin production in zebrafish embryos and mouse tail skin.

[0068] 5. Determination of the effects of EA structural analogs on melanin content and tyrosinase activity in melanocyte cell lines.

[0069] 5.1 Group settings: Control E1 (punicalagin intervention group) E2 (Corilagin intervention group) E3 (punicalagin intervention group) 5.2 Experimental methods and procedures (1) Cell intervention: B16F10 cell lines were treated with 10 μM punicalagin, corilagin, and punicalagin, respectively. After 24 h, the cells were digested with trypsin for the next experiment.

[0070] (1) Determination of melanin content: B16F10 cells (2.5×10 5 The cells were harvested by trypsin digestion and centrifugation, and then lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using a microplate reader.

[0071] (2) Tyrosinase activity assay: B16F10 cells (2.5×10 5 The cells were plated (100 cells per 35 mm culture dish), digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μl 1% tritonX100 and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37 °C for 20 min, and the absorbance at 475 nm was detected using an enzyme reader.

[0072] 5.3 Experimental results: Fig. 9 AB shows that the structural analogues of EA can significantly inhibit the melanin content and tyrosinase activity of the B16F10 melanocyte cell line.

[0073] Example 3 1. Effect of FH (Flaflavin) on proliferation of melanocytes.

[0074] 1.1 Group settings: Control FH 0.1 μM (FH group concentration 1) FH 1 μM (FH group concentration 2) FH 10 μM (FH group concentration 3) FH 50 μM (FH group concentration 4) 1.2 Experimental methods and procedures: (1) CCK8 assay: cells were plated at 5 x 10 3 100 µL of culture medium were inoculated into 96-well plates, and blank wells were set. FH with gradient concentrations was added and culture was continued for 24 h and 48 h. After the culture was completed, 10 µL of CCK-8 solution (mixed with culture medium at a ratio of 1:10) was added to each well. The 96-well plate was returned to the incubator and incubated in the dark at 37 °C and 5% CO2 for 2-3 h. After the incubation, the absorbance (OD value) of each well was read at a wavelength of 450 nm using a microplate reader.

[0075] 1.3 Experimental results: Fig.10 AB showed that FH bound to the UBR5 enzyme activity center or its periphery and could significantly inhibit the proliferation of melanocyte cell lines in a concentration-dependent and time-dependent manner.

[0076] 2. Western blot was used to identify changes in the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR.

[0077] 2.1 Group settings: Control FH 0.1 μM 24h (FH intervention group 1) FH 0.1 μM 48h (FH intervention group 2) 2.2 Experimental methods and procedures: (1) Western Blot: Protein was extracted with RIPA lysis buffer (Biyuntian) and centrifuged at 12000 rpm for 10 min at 4 °C. Protein concentration was determined by BCA protein assay and boiled for 5 min before the experiment. 20 μg of protein sample was loaded into each well, separated by 10% SDS PAGE, and transferred to PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibodies (TYR, TYRP1, TYRP1, MiTF, UBR5) at 4 °C overnight. The PVDF membrane was washed with PBST and then incubated with HRP-labeled goat anti-rabbit IgG or anti-mouse IgG secondary antibodies at room temperature for 60 min, and the bound antibodies were detected by ECL chemiluminescence. (The specific method is the same as Example 1) 2.3 Experimental results: Depend on Fig.11As shown in A, after B16F10 cells were treated with FH, Western blot results showed that compared with the control group, the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR in the intervention group was significantly downregulated.

[0078] 3. Determination of the effect of FH on melanin content and tyrosinase activity in melanocytes.

[0079] 3.1 Group settings: Control FH 0.1 μM 24h (FH intervention group 1) FH 0.1 μM 48h (FH intervention group 2) 3.2 Experimental methods and procedures: (1) Determination of melanin content: Melanocyte cell line (2.5×10 5 Cells were collected by trypsin digestion and centrifugation, and then lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using an ELISA reader.

[0080] (2) Tyrosinase activity assay: Melanocyte cell line (2.5×10 5 The cells were plated (100 cells per 35 mm culture dish) and digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μL 1% tritonX100 and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37 °C for 20 min, and the absorbance at 475 nm was detected using an enzyme reader.

[0081] 3.3 Experimental results: Fig.11 BC showed that FH could significantly inhibit the melanin content and tyrosinase activity of B16F10 cells.

[0082] 4. In vivo study on the regulatory role of FH in melanogenesis in zebrafish model.

[0083] 4.1 Group settings: Control FH (FH intervention group) 4.2 Experimental methods and procedures Zebrafish melanin detection: 6 hpf wild-type AB strain zebrafish were randomly selected in a 6-well plate, and 30 zebrafish embryos were treated in each well. FH was given in water, and a normal control group was set up at the same time, with a volume of 3 mL per well. After 2 days of treatment at 28 ℃, 5 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. The Image J advanced image processing software was used to analyze and collect data, and the melanin signal intensity of the zebrafish head was analyzed. The statistical analysis results of this indicator were used to evaluate the whitening effect of the sample. The statistical analysis results were expressed as mean ± SEM. SPSS26.0 software was used for statistical analysis.

[0084] 4.3 Experimental results: Fig.12 These results showed that FH could significantly inhibit the melanogenesis ability of zebrafish embryos.

[0085] 5. Determination of the effects of FH structural analogs on melanin content and tyrosinase activity in melanocyte cell lines.

[0086] 5.1 Group settings: Control F1 (voruciclib group) F2 (Orientin group) F3 (vitexin group) 5.2 Experimental methods and procedures (1) Cell intervention: B16F10 cells were treated with 10 μM voruciclib, orientin, and vitexin, respectively. After 24 h, the cells were digested with trypsin for the next experiment.

[0087] (1) Determination of melanin content: B16F10 cells (2.5×10 5 The cells were collected by trypsin digestion and centrifugation, and then lysed by heating in a 100°C water bath with 1 ml of 1 mol / L NaOH for 30 min. The absorbance was measured at 470 nm using an ELISA reader.

[0088] (2) Tyrosinase activity assay: B16F10 cells (2.5×10 5 The cells were plated (100 cells per 35 mm culture dish), digested with trypsin, centrifuged, and collected. The cells were lysed with 200 μl 1% tritonX100 and immediately placed in -80 °C for 30 min, taken out, thawed at 37 °C, centrifuged at 1000 g for 10 min, and the supernatant was incubated with L-DOPA at 37 °C for 20 min, and the absorbance at 475 nm was detected using an enzyme reader.

[0089] 5.3 Experimental results: Fig.13AB shows that voruciclib, a structural analogue of FH, can significantly upregulate the pigment content and tyrosinase activity in mouse B16F10. Fig.13 C suggests that voruciclib interacts with UBR5.

Claims

1. Application of flavopiridol and its analogs in the preparation of drugs for the treatment of pigmented skin diseases.

2. The use according to claim 1, characterized in that The flavopiridol analogs include voruciclib, orientin or vitexin.

3. The use according to claim 1 or 2, characterized in that: The pigmented skin diseases include hyperpigmented skin diseases and hypopigmented skin diseases.

4. The use according to claim 1 or 2, characterized in that: The pigmented skin diseases include pigmented nevi, pigmented spots, and depigmented / hypopigmented spots.

5. The use according to claim 4, characterized in that The pigmented skin diseases include pigmented nevi, congenital pigmented nevi, giant nevi with risk of malignant transformation, chloasma, freckles, nevus of Ota, post-inflammatory pigmentation, vitiligo, and post-inflammatory hypopigmentation.

6. Use of flavopiridol and its analogs in the preparation of inhibitors or activators for regulating melanogenesis.

7. Use of flavopiridol and its analogs in the preparation of tyrosinase activity inhibitors or enhancers.

8. Use of flavopiridol and its analogs in the preparation of whitening preparations or whitening drugs.

9. The use according to any one of claims 6 to 8, characterized in that: Analogues of flavopiridol include voruciclib, orientin or vitexin.

Images