Application of linc-ZNF25-1 gene inhibitor

Abstract

The invention relates to the technical field of biological medicines, in particular to application of an inhibitor of a linc-ZNF25-1 gene, and the nucleotide sequence of the linc-ZNF25-1 gene is shown as SEQ ID NO. 1. It is found that lncRNA in pancreatic cancer cells EVs and parent pancreatic cancer cells have significant difference, linc-ZNF25-1 is significantly highly expressed in the EVs, which prompts that EVs-mediated linc-ZNF25-1 may be related to the progression of pancreatic cancer, and it is found that the linc-ZNF25-1 gene is highly expressed in pancreatic cancer cells, which indicates that the linc-ZNF25-1 gene is highly expressed in pancreatic cancer cells, and the linc-ZNF25-1 gene is highly expressed in pancreatic cancer cells. Therefore, the invention provides the application of the linc-ZNF25-1 gene inhibitor in preparing the medicine for treating the pancreatic cancer, and an important scientific basis is provided for further diagnosis and treatment of the pancreatic cancer.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to the application of a linc-ZNF25-1 gene inhibitor. Background Art

[0002] Pancreatic cancer is a malignant tumor with insidious onset, rapid progression, and extremely poor prognosis. It is one of the most challenging diseases among digestive system tumors. In the past two decades, the number of patients has increased significantly compared with before. Due to the lack of symptoms in the early stage and the limitations of screening methods, most pancreatic cancers are already in the late stage when they are discovered, and only a small number of people have the opportunity for surgery. Although there have been great advances in surgical techniques and adjuvant drug treatments, the effects of chemotherapy, radiotherapy, and immunotherapy are still not ideal, and the prognosis of pancreatic cancer patients is still not optimistic. Therefore, although chemotherapy is one of the important treatments for patients with advanced pancreatic cancer, its efficacy is still unsatisfactory.

[0003] Extracellular vesicles are abbreviated as EVs. EVs are an important component of signal transduction between cells and play an important role in the progression of various tumors and chemotherapy resistance. There are many long noncoding RNAs (lncRNAs) in vesicles. These lncRNAs have physiological activity, but the role of lncRNAs in extracellular vesicles derived from pancreatic cancer cells in pancreatic cancer is unclear. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides the application of linc-ZNF25-1 gene inhibitor.

[0005] The present invention is carried out by adopting the following technical scheme.

[0006] The present invention provides application of a linc-ZNF25-1 gene inhibitor in preparing a medicine for treating pancreatic cancer.

[0007]

[0008] The LNCipedia gene ID of the linc-ZNF25-1 gene is lnc-BMS1-15.

[0009] In some embodiments of the present invention, the linc-ZNF25-1 gene inhibitor includes: a linc-ZNF25-1 gene knockout agent or an interfering RNA of the linc-ZNF25-1 gene.

[0010] In some embodiments of the present invention, the linc-ZNF25-1 gene knockout reagent includes: reagents used in CRISPR / Cas9 technology;

[0011] The interfering RNA of the linc-ZNF25-1 gene is any one of antisense oligonucleotide (ASO), small interfering RNA (siRNA) and Smart Silencer (a mixture of ASO and siRNA).

[0012] In some embodiments of the present invention, the interfering RNA of the linc-ZNF25-1 gene consists of the sequence shown in SEQ ID NO. 2-7.

[0013] In some embodiments of the present invention, the drug is an extracellular vesicle comprising the linc-ZNF25-1 gene knockout agent.

[0014] In some embodiments of the present invention, the drug is used to reduce the resistance of pancreatic cancer cells to chemotherapy drugs.

[0015] In some embodiments of the present invention, the medicament is used to reduce the clonogenicity of pancreatic cancer cells.

[0016] In some embodiments of the present invention, the medicament is used to reduce the proliferation of pancreatic cancer cells.

[0017] The linc-ZNF25-1 gene inhibitor is used in the preparation of a drug for reducing the tolerance of pancreatic cancer chemotherapy.

[0018] In some embodiments of the present invention, the pancreatic cancer chemotherapy drug is gemcitabine.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention found that there were significant differences between the lncRNA in pancreatic cancer cell EVs and the parental pancreatic cancer cells, among which linc-ZNF25-1 was significantly highly expressed in EVs, suggesting that EVs-mediated linc-ZNF25-1 may be related to the progression of pancreatic cancer. In addition, it was found that the linc-ZNF25-1 gene was highly expressed in pancreatic cancer cells, thus proposing the use of linc-ZNF25-1 gene inhibitors in the preparation of drugs for the treatment of pancreatic cancer.

[0021] The present invention also discovered that the linc-ZNF25-1 gene is highly expressed in gemcitabine-resistant pancreatic cancer cells, thereby proposing the use of a linc-ZNF25-1 gene inhibitor in the preparation of a drug for reducing the tolerance of pancreatic cancer chemotherapy.

[0022] The present invention silences the expression of linc-ZNF25-1 gene in pancreatic cancer cells and finds that silencing the linc-ZNF25-1 gene in pancreatic cancer cells can reduce the cloning ability of pancreatic cancer cells and weaken the proliferation ability of pancreatic cancer cells. It discovers a new mechanism for the development of pancreatic cancer. EVs-mediated linc-ZNF25-1 is a new target for the treatment of pancreatic cancer, which provides an important scientific basis for further diagnosis and treatment of pancreatic cancer.

[0023] The present invention demonstrates that the linc-ZNF25-1 gene mediated by pancreatic cancer cell-derived EVs plays an important role in the progression and drug resistance of pancreatic cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a volcano plot of sequencing long non-coding RNA in EVs of gemcitabine-resistant pancreatic cancer cells and parental pancreatic cancer cells.

[0025] Figure 2 The relative expression level of linc-ZNF25-1 in gemcitabine-resistant pancreatic cancer cells and parental pancreatic cancer cells was determined by qRT-PCR.

[0026] Figure 3 The relative expression level of linc-ZNF25-1 in EVs of gemcitabine-resistant pancreatic cancer cells and parental pancreatic cancer cells was determined by qRT-PCR.

[0027] Figure 4 The relative expression levels of linc-ZNF25-1 in the nucleus and cytoplasm of pancreatic cancer cells were detected by qRT-PCR. Figure 4 Middle A shows the relative expression levels of linc-ZNF25-1 in the nucleus and cytoplasm of MIA PaCa-2 cells; Figure 4 B in the figure indicates the relative expression level of linc-ZNF25-1 in the nucleus and cytoplasm of PANC-1 cells.

[0028] Figure 5 The efficiency of plasmid overexpression of linc-ZNF25-1 in pancreatic cancer cells and the level of linc-ZNF25-1 in the corresponding EVs were detected by qRT-PCR; Figure 5 Middle A indicates the relative expression level of linc-ZNF25-1 in pancreatic cancer cells after overexpression of linc-ZNF25-1 detected by qRT-PCR; Figure 5 Panel B indicates the relative expression level of linc-ZNF25-1 in EVs after overexpression of linc-ZNF25-1 in pancreatic cancer cells detected by qRT-PCR.

[0029] Figure 6 Cell viability of pancreatic cancer cells transfected or not with linc-ZNF25-1 overexpressing plasmid treated with different concentrations of gemcitabine for 72 hours; Figure 6 Middle A shows the cell viability of MIAPaCa-2 cells overexpressing linc-ZNF25-1 and treated with different concentrations of gemcitabine for 72 hours; Figure 6 Panel B shows the cell viability of PANC-1 cells overexpressing linc-ZNF25-1 and treated with different concentrations of gemcitabine for 72 hours.

[0030] Figure 7 The plate clones of pancreatic cancer cells transfected or not transfected with linc-ZNF25-1 overexpressing plasmid; A is the plate clone diagram; B is the counting statistics diagram of the plate clones.

[0031] Figure 8 This is the Edu proliferation diagram after pancreatic cancer cells overexpress linc-ZNF25-1; Figure 8 Middle A shows the Edu proliferation diagram of pancreatic cancer cells, with a scale of 50 μm; Figure 8 B in the figure is a statistical graph showing the proliferation of Edu in pancreatic cancer cells.

[0032] Fig. 9 The efficiency of smart silencer silencing linc-ZNF25-1 in pancreatic cancer cells and the level of linc-ZNF25-1 in the corresponding EVs were detected by qRT-PCR; Fig. 9 Middle A indicates the relative expression level of linc-ZNF25-1 in pancreatic cancer cells after silencing linc-ZNF25-1 by qRT-PCR; Fig. 9 Panel B shows the relative expression level of linc-ZNF25-1 in EVs after silencing of linc-ZNF25-1 in pancreatic cancer cells detected by qRT-PCR.

[0033] Fig.10The cell activity after silencing linc-ZNF25-1 in pancreatic cancer cells and treating with different concentrations of gemcitabine for 72 hours; Fig.10 Middle A shows the cell activity after silencing linc-ZNF25-1 in MIAPaCa-2 and then treated with different concentrations of gemcitabine for 72 hours; Fig.10 Panel B shows the cell viability after PANC-1 silenced linc-ZNF25-1 and then treated with different concentrations of gemcitabine for 72 hours.

[0034] Fig.11 This is the Edu proliferation diagram after silencing linc-ZNF25-1 in pancreatic cancer cells; Fig.11 Middle A shows the Edu proliferation diagram of pancreatic cancer cells, with a scale of 50 μm; Fig.11 B in the figure is a statistical graph showing the proliferation of Edu in pancreatic cancer cells.

[0035] Fig.12 The plate clones of silencing linc-ZNF25-1 in pancreatic cancer cells; A is a plate clone diagram; B is a counting statistical diagram of plate clones.

[0036] Fig.13 This is an in vivo experiment to show that linc-ZNF25-1 promotes the progression of pancreatic cancer; Fig.13 Middle A shows representative bioluminescence images of orthotopic pancreatic cancer mice constructed by MIAPaCa-2 cells transfected with control or linc-ZNF25-1 overexpressing lentivirus at specific times; Fig.13 B in the figure shows the images of mice and tumors at the end point of the experiment.

[0037] Fig.14 The figure shows the average radiation statistics of the tumors of pancreatic cancer mice in the control group and the linc-ZNF25-1 overexpression group.

[0038] Fig.15 It is a statistical chart of mouse tumor weight and tumor volume; Fig.15 A in the middle shows the mouse tumor weight; Fig.15 B in the figure shows the tumor volume of mice.

[0039] Fig.16 Immunohistochemistry images of ki-67, BAX and Bcl2 in the tumors of pancreatic cancer mice in the control group and the linc-ZNF25-1 overexpression group.

[0040] Fig.17 This is a map of the linc-ZNF25-1 overexpression plasmid. DETAILED DESCRIPTION

[0041] The present invention is described in detail below in conjunction with specific examples, but it should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0042] Experimental Materials:

[0043] 1. The human pancreatic cancer cell lines MIAPaCa-2 and PANC-1 used in the present invention were purchased from the American Type Culture Collection (ATCC).

[0044] 2. Drug-resistant pancreatic cancer cells MIAPaCa-2 R 、PANC-1 R Build:

[0045] First, determine the IC50 value of gemcitabine (GEM) for the parental cells MIA PaCa-2 and PANC-1. Use GEM (1nM) less than IC50 as the initial drug concentration, and continue to subculture after the cells adapt to the drug concentration, gradually increase the drug concentration to 500nM-1μM, until the cells reach a state of resistance to gemcitabine, and successfully construct pancreatic cancer resistant cell line MIA PaCa-2 R 、PANC-1 R .

[0046] Example 1

[0047] 1. Drug-resistant pancreatic cancer cells MIA PaCa-2 R Long noncoding RNA (lncRNA) sequencing of EVs derived from MIA PaCa-2 and parental pancreatic cancer cells

[0048] The present invention first treats gemcitabine-resistant pancreatic cancer cell MIAPaCa-2 R Long noncoding RNA (lncRNA) sequencing was performed on EVs derived from the parental pancreatic cancer cell MIAPaCa-2.

[0049] The sequencing results are as follows Figure 1 As shown in Figure 2, lncRNAs in gemcitabine-resistant pancreatic cancer cell EVs were found to be significantly different from those in parental pancreatic cancer cells, among which the linc-ZNF25-1 gene was expressed in MIAPaCa-2 R This suggests that EVs-mediated linc-ZNF25-1 gene may be associated with the progression and chemotherapy resistance of pancreatic cancer.

[0050] 2. linc-ZNF25-1 gene detection

[0051] For further verification, the present invention used parent pancreatic cancer cell lines MIAPaCa-2 and PANC-1 and gemcitabine-resistant MIAPaCa-2 R and PANC-1 R The linc-ZNF25-1 gene was detected.

[0052] Total cellular RNA was extracted using an RNA purification kit (B0004D, EZBioscience). The specific method is as follows:

[0053] (1) Sample lysis: for cells ≤ 3×10 6 For adherent cell samples, discard the culture medium, wash the cells with PBS, then add 500 μL lysis buffer, place on a shaker at room temperature at 120-150 rpm for 1-2 minutes, or pipette about 30 times to fully lyse the cells;

[0054] (2) Add an equal volume of anhydrous ethanol to the above cell lysate and mix thoroughly. If precipitation occurs after adding ethanol, it is recommended to use a pipette to blow until the precipitation is no longer visible, then add it to a spin column and centrifuge at 4000g (equivalent to 7000rpm of Eppendorf, Thermo or Beckman centrifuges commonly used in laboratories) for 1 minute (if there is liquid remaining in the column after centrifugation, centrifuge it again at 12000g for 1 minute), and discard the liquid;

[0055] (3) DNA enzyme treatment: According to the ratio of 2 μL DNA enzyme (gDNARemover) to 10 μL ddH2O (needs to be sterilized) for each sample, take the corresponding volume of DNA enzyme and ddH2O according to the number of samples, and mix them by pipetting; take 12 μL and add it to the membrane in the center of each column, and leave it at room temperature for 5 minutes to remove a small amount of genome that may remain (do not centrifuge after DNA enzyme treatment, directly add washing solution to proceed to the next washing operation).

[0056] (4) Add 500 μL of washing buffer to the centrifuge column and centrifuge at 12,000 g for 1 minute. Note: When removing the centrifuge column from the collection tube, be careful to prevent the bottom of the centrifuge column from contacting the liquid (recommended operation: after pouring out the liquid, you can turn the collection tube upside down on absorbent paper, tap it twice, then put the centrifuge column back into the collection tube and centrifuge the empty column at 12,000 g for 1 minute);

[0057] (5) Without discarding the waste liquid, transfer the spin column directly to an RNase-free 1.5 mL EP tube and leave it to air-dry for 2 minutes with the lid open.

[0058] (6) Add 30 μL of elution buffer to the membrane in the center of the centrifuge column and leave at room temperature for 2 minutes.

[0059] (7) Centrifuge at 12,000 g for 1 minute. (Optional: After the initial elution and centrifugation, the liquid can be added back into the centrifuge column and allowed to stand for another 3 minutes to allow the RNA to fully dissolve before centrifugation to increase RNA yield.) Discard the centrifuge column and quickly transfer the resulting RNA to ice for concentration measurement before subsequent experiments or store at -80°C for later use.

[0060] The concentration and purity of the RNA extracted by the above extraction method were measured using a spectrophotometer. The total RNA was then reverse transcribed into cDNA using PrimeScript RT MasterMix (RR036A, TaKaRa).

[0061] Reverse transcription:

[0062] Prepare RT reaction solution according to the following composition (total system 10 μL, reaction solution preparation is carried out on ice):

[0063] 5X PrimeScript RT MasterMix 2μL, RNA 500ng, RNase Free dH2O up to10μL;

[0064] After gentle mixing, perform the reverse transcription reaction under the following conditions:

[0065] 37°C for 15 minutes (reverse transcription reaction), 85°C for 5 seconds (reverse transcriptase inactivation reaction).

[0066] Quantitative PCR was performed at 4°C using SYBR Green PCR Master Mix with GAPDH as the control gene. The relative expression level was estimated by

[0067] like Figure 2 As shown, the results showed that gemcitabine-resistant pancreatic cancer cells highly expressed the linc-ZNF25-1 gene.

[0068] 3. Parental pancreatic cancer cells MIA PaCa-2, PANC-1 and gemcitabine-resistant cells MIA PaCa-2 R and PANC-1 R Extraction of cell-derived EVs

[0069] (1) EVs extraction method:

[0070] The cells were cultured in complete medium. When the cell confluence reached 80%, the complete medium was discarded, the cells were washed three times with PBS, and replaced with serum-free medium. The supernatant was collected after 48 hours of culture. The collected supernatant was extracted with differential ultracentrifugation, that is, after centrifugation at 500×g for 15 minutes, centrifugation at 10,000×g for 30 minutes, and then ultracentrifugation at 110,000×g for 70 minutes to separate EVs. The extracted EVs (from MIA PaCa-2 / MIAPaCa-2 R and PANC-1 / PANC-1 R EVs, respectively, are called EV m / EV mR and EV P / EV PR ) were dissolved in PBS and stored at −80°C. The concentration of EVs was determined by the BCA method.

[0071] (2) Extraction, reverse transcription and qRT-PCR of RNA from EVs

[0072] RNA extraction from EVs was performed using a kit (EZB-exo-RN1, EZBioscience). The specific method is as follows:

[0073] 1) Place 10 μL of EVs into a 1.5 mL centrifuge tube and add 500 μL of lysis buffer.

[0074] 2) Dissolve EVs by pipetting up and down 20 times. Incubate at room temperature for 5 minutes.

[0075] 3) Add 150 μL of buffer A to the EVs lysate and shake vigorously for 15 seconds to mix thoroughly. Incubate at room temperature for 3 minutes.

[0076] 4) Centrifuge at 15,000×g for 3 minutes at 4°C. The mixture is then separated into three phases. Transfer the upper supernatant (about 300 μL) to a new RNase-free 1.5 mL centrifuge tube (be careful to avoid stirring the middle or bottom layer).

[0077] 5) Add 10 μL of supplemental reagent to each volume of supernatant, mix thoroughly, and then add 1.6 times the volume of 100% ethanol to each volume of the above solution.

[0078] 6) Invert the tube several times or pipette up and down 10 times to mix thoroughly. Then transfer the sample to the centrifuge column. Centrifuge at 4000×g, 4°C for 1 minute. Pour off the liquid.

[0079] 7) Add 500 μL Wash Buffer 1 to the centrifuge column. Centrifuge at 12,000×g, 4°C for 1 minute (be careful to avoid contact between the bottom of the centrifuge column and the liquid when removing the centrifuge column). Discard the liquid.

[0080] 8) Add 500 μL Wash Buffer 2 to the spin column. Centrifuge at 12,000 × g, 4°C for 1 minute.

[0081] 9) Pour off the liquid and remove any remaining liquid with absorbent paper. Place the spin column back on the collection tube and centrifuge at 12,000×g, 4°C for 1 minute.

[0082] 10) Discard the collection tube with the flow-through and place the spin column in a new RNase-free 1.5 ml centrifuge tube, open the lid and leave in air for 10 minutes. Open the lid and leave in air for 2 minutes.

[0083] 11) Preheat the elution buffer to 60°C, add 20 μL of elution buffer to the center of the membrane, and then place the EP tube containing the spin column in a 60°C water bath or metal bath for 3 minutes to dissolve the RNA.

[0084] 12) Centrifuge at 12,000×g and 4°C for 1 minute (return the eluate to the spin column and centrifuge again at 12,000×g and 4°C for 1 minute).

[0085] 13) Discard the spin column, determine the RNA concentration, and use the purified RNA for subsequent experiments or store the RNA at -80°C until needed.

[0086] The concentration and purity of RNA were measured by spectrophotometer.

[0087] Total RNA was then reverse transcribed into cDNA using PrimeScript RT MasterMix (RR036A, TaKaRa). Quantitative PCR was performed using SYBR Green PCR MasterMix with GAPDH as the control gene. The relative expression level was estimated by

[0088] (3) Nuclear and cytoplasmic separation:

[0089] Using NE-PER TMNuclear and cytoplasmic extraction reagent (78833, Thermo Fisher Scientific) was used for nuclear and cytoplasmic separation. In brief, the collected cells were placed in cell separation buffer and incubated on ice for 10 minutes. After centrifugation at 500×g for 5 minutes, the supernatant was collected as the cytoplasmic fraction. The nuclear pellet was resuspended in cell division buffer and incubated at 4°C for 30 minutes. After centrifugation at 12,000×g for 10 minutes, the nuclear component was obtained after removing the insoluble membrane fragments. Then, qRT-PCR was used to detect the expression levels of GAPDH, U6 and lincZNF25-1 genes in the cytoplasm or nucleus of pancreatic cancer cells.

[0090] qRT-PCR results showed that MIA PaCa-2 R and PANC-1 R The EVs derived from the Figure 3 Nuclear-cytoplasmic separation experiments showed that the linc-ZNF25-1 gene was distributed in both the nucleus and cytoplasm of pancreatic cancer cells, with a higher content in the cytoplasm, which is consistent with its transmission through EVs ( Figure 4 A and B in FIG.

[0091] Example 2

[0092] 1. Construction of linc-ZNF25-1 overexpression plasmid:

[0093] The map of linc-ZNF25-1 overexpression plasmid is as follows Fig.17 shown.

[0094] 2. In order to clarify the role of linc-ZNF25-1 mediated by pancreatic cancer cell-derived EVs in the progression of pancreatic cancer, the present invention overexpressed the linc-ZNF25-1 gene in pancreatic cancer cells MIAPaCa-2 and PANC-1 using a linc-ZNF25-1 overexpression plasmid.

[0095] Experimental methods:

[0096] (1) Cell culture: 1-2×10 5 / well cells, and culture in a 37°C, 5% CO2 incubator to a density of 40% to 60%.

[0097] (2) Preparation of transfection solution: Prepare the following two solutions in an EP tube (the amount required for transfection of cells in each well):

[0098] Solution A: Dilute 2 μg of linc-ZNF25-1 overexpression plasmid DNA in serum-free medium.

[0099] Solution B: Dilute 5 μl of liposomes with serum-free culture medium.

[0100] (3) Add Solution B to Solution A and flick to mix. Leave at room temperature for 10 minutes.

[0101] (4) Transfection: Slowly add the A / B complex to the culture medium, shake well, and place in a 37°C incubator for 12 hours. Aspirate the serum-free transfection medium and replace with normal culture medium to continue culturing.

[0102] (5) After transient transfection, the cell RNA can be extracted after the cells have grown to full size to verify the overexpression efficiency.

[0103] Experimental results:

[0104] qRT-PCR confirmed its overexpression effect in pancreatic cancer cells ( Figure 5 Then we extracted EVs from pancreatic cancer cells overexpressing linc-ZNF25-1 and corresponding control pancreatic cancer cells and detected the expression level of linc-ZNF25-1 gene. The results showed that EVs derived from pancreatic cancer cells overexpressing linc-ZNF25-1 gene contained more linc-ZNF25-1 gene ( Figure 5 (as shown in B in the figure).

[0105] 3. Furthermore, the present invention adopted IC50 experiments, clone formation, and EdU experimental studies to explore the effect of linc-ZNF25-1 on the function of pancreatic cancer cells.

[0106] Experimental methods:

[0107] (1) IC50:

[0108] The control group and pancreatic cancer cells overexpressing linc-ZNF25-1 were inoculated at 1×10 4 Cells were seeded into 96-well plates. After cell adhesion, different concentrations of gemcitabine (1nM, 10nM, 100nM, 1μM, 10μM) were added to each group. After 72 hours of incubation, the cells were washed with PBS and the cell viability was determined using CCK-8 (K1018-5, APExBIO) reagent, that is, the OD450 value was measured by spectrophotometry 2 hours after the addition of CCK-8 reagent.

[0109] (2) Clone formation:

[0110] The control group and pancreatic cancer cells overexpressing the linc-ZNF25-1 gene were inoculated in 6-well plates at 500 cells per well, and the medium was changed every three days for 2 weeks. Then the medium was discarded, and the cells were fixed with 4% paraformaldehyde after rinsing with PBS. After discarding the fixative, the cells were washed once with PBS and then stained with 0.4% crystal violet. Finally, the colonies on the plate were photographed and counted.

[0111] (3) EdU proliferation:

[0112] Use UELandy according to the manufacturer's instructions. TM EdU cell proliferation kit was used for EdU staining. First, 10 μM EdU was added to the control group and pancreatic cancer cells overexpressing linc-ZNF25-1 for 2 hours, followed by rinsing with PBS, fixation with 4% paraformaldehyde, permeabilization with 0.5% Triton X-100, and treatment of cells with Click-iT working solution for 30 minutes. Finally, after incubation with DAPI solution, the cells were observed under a fluorescence microscope (Nikon, Japan).

[0113] Experimental results:

[0114] (1) IC50:

[0115] First, we added different concentrations of gemcitabine (1nM, 10nM, 100nM, 1μM, 10μM) to the control group and pancreatic cancer cells overexpressing linc-ZNF25-1. After 72 hours, CCK-8 results showed that overexpression of linc-ZNF25-1 promoted gemcitabine resistance in pancreatic cancer cells ( Figure 6 AB in the figure).

[0116] (2) Clone formation:

[0117] The results of the clone formation experiment showed that overexpression of linc-ZNF25-1 in pancreatic cancer cells could increase the clone formation ability of pancreatic cancer cells (e.g. Figure 7 AB).

[0118] (2) EdU proliferation:

[0119] Similarly, after EdU incubation of the above-treated pancreatic cancer cells, immunofluorescence showed that the pancreatic cancer cell group overexpressing linc-ZNF25-1 had a stronger proliferation ability ( Figure 8 A and B in FIG.

[0120] Example 3

[0121] Effects of inhibiting linc-ZNF25-1 gene on pancreatic cancer cells

[0122] 1. Construction of linc-ZNF25-1 Smart Silencer:

[0123] linc-ZNF25-1 Smart Silencer is composed of GACGATTCCATTCAATTCCT, recorded as SEQ ID NO.2, CCATTCTATTCCATTTGAGG, recorded as SEQ ID NO.3, CCATTCCAT TCCATTCGATG, recorded as SEQ ID NO.4, TCCTTTCACTTCCATTCGA, recorded as SEQ ID NO.5, CCATTCCTTTCCATTTGAT, recorded as SEQ ID NO.6, and CCATTCCA TTCCATTCGAT, recorded as SEQ ID NO.7.

[0124] To further clarify the inhibitory effect of silencing linc-ZNF25-1 in pancreatic cancer cells on pancreatic cancer progression and drug resistance, the present invention used Smart Silencer to silence linc-ZNF25-1 in pancreatic cancer cells MIAPaCa-2 and PANC-1, and then used qRT-RCR to confirm the silencing effect in pancreatic cancer cells.

[0125] The specific silencing methods are as follows:

[0126] (1) Cell culture: 1-2×10 5 / well cells, and culture in a 37°C, 5% CO2 incubator to a density of 40% to 60%.

[0127] (2) Preparation of transfection solution: Prepare the following two solutions in an EP tube (the amount required for transfection of cells in each well):

[0128] Solution A: Dilute 5 μL of Smart Silencer Diluent with serum-free culture medium.

[0129] Solution B: Dilute 5 μL of liposomes with serum-free culture medium.

[0130] (3) Add Solution B to Solution A and flick to mix. Leave at room temperature for 10 minutes.

[0131] (4) Transfection: Slowly add the A / B complex to the culture medium, shake well, and place in a 37°C incubator for 12 hours. Aspirate the serum-free transfection medium and replace with normal culture medium to continue culturing.

[0132] (5) After transient transfection, the cellular RNA can be extracted after the cells have grown to full size to verify the silencing efficiency.

[0133] like Fig. 9As shown in Figure A, qRT-RCR confirmed its silencing effect in pancreatic cancer cells. Subsequently, EVs of pancreatic cancer cells with silenced linc-ZNF25-1 gene and corresponding control pancreatic cancer cells were extracted and the expression level of linc-ZNF25-1 gene was detected. The results showed that the expression of linc-ZNF25-1 gene in EVs derived from pancreatic cancer cells with silenced linc-ZNF25-1 gene was reduced ( Fig. 9 (as shown in B in the figure).

[0134] 2. The present invention subsequently explored the effect of silencing the linc-ZNF25-1 gene on the function of pancreatic cancer cells.

[0135] Experimental methods:

[0136] (1) IC50:

[0137] The pancreatic cancer cells of the control group and linc-ZNF25-1 gene silenced were respectively divided into 1×10 4 Cells were seeded into 96-well plates. After cell adhesion, different concentrations of gemcitabine (1nM, 10nM, 100nM, 1μM, 10μM) were added to each group. After 72 hours of incubation, the cells were washed with PBS and the cell viability was determined using CCK-8 (K1018-5, APExBIO) reagent, that is, the OD450 value was measured by spectrophotometry 2 hours after the addition of CCK-8 reagent.

[0138] (2) Clone formation:

[0139] The control group and pancreatic cancer cells with linc-ZNF25-1 gene silenced were seeded in 6-well plates at 500 cells per well, and the medium was changed every three days for 2 weeks. Then the medium was discarded, and the cells were fixed with 4% paraformaldehyde after rinsing with PBS. After discarding the fixative, the cells were washed with PBS and then stained with 0.4% crystal violet. Finally, the colonies on the plate were photographed and counted.

[0140] (3) EdU proliferation:

[0141] Use UELandy according to the manufacturer's instructions. TM EdU cell proliferation kit was used for EdU staining. First, 10 μM EdU was added to the control group and pancreatic cancer cells with linc-ZNF25-1 silenced for 2 hours, followed by rinsing with PBS, fixation with 4% paraformaldehyde, permeabilization with 0.5% Triton X-100, and treatment of cells with Click-iT working solution for 30 minutes. Finally, after incubation with DAPI solution, the cells were observed under a fluorescence microscope (Nikon, Japan).

[0142] Experimental results:

[0143] CCK-8 results showed that silencing the linc-ZNF25-1 gene reduced the tolerance of pancreatic cancer cells to gemcitabine ( Fig.10 After incubating the pancreatic cancer cells treated with EdU, immunofluorescence showed that the proliferation ability of the pancreatic cancer cells in which the linc-ZNF25-1 gene was silenced was weakened ( Fig.11 Consistent with this, the results of the clone formation experiment showed that silencing the linc-ZNF25-1 gene in pancreatic cancer cells could reduce the clone formation ability of pancreatic cancer cells ( Fig.12 AB).

[0144] Embodiment 4:

[0145] In vivo experiments validated the role of the linc-ZNF25-1 gene

[0146] 1. Experimental animals:

[0147] BALB / c nude mice, 6 weeks old, female, weighing 14-16 g, 16 mice in total.

[0148] 2. Experimental methods:

[0149] 2×10 6 MIA PaCa-2 cells transfected with LV17 blank vector virus or LV17-linc-ZNF25-1 overexpression lentivirus (D020011, Genema Gene) were injected into the pancreas of 6-week-old female BALB / c nude mice. Fluorescence images of tumor mice were captured using a small animal in vivo fluorescence imaging system (Maestro 3.0.0, USA). When the in vivo fluorescence imaging showed that the tumor was visible (about 3 weeks after cell implantation), in vivo fluorescence imaging of small animals was performed weekly to observe tumor progression. After reaching the 6th week, the tumor was obtained for immunohistochemistry and other tests.

[0150] 3. Experimental results:

[0151] The LV17 blank vector virus was introduced into MIAPaCa-2 and injected into the pancreas of nude mice to construct an orthotopic transplant tumor model as the control group, and the LV17-linc-ZNF25-1 overexpression lentivirus was introduced into MIAPaCa-2 and injected into the pancreas of nude mice to construct an orthotopic transplant tumor model as the experimental group. Small animal live imaging was used to show the growth of the tumor, and bioluminescent images showed that the tumor in the OE-linc-ZNF25-1 group grew faster ( Fig.13 After reaching the end point of the experiment, the mouse tumors were obtained ( Fig.13 The results showed that the average radiation value, tumor volume and tumor weight of the OE-linc-ZNF25-1 group were significantly greater than those of the control group (as shown in B). Fig.14 A and B in Fig.15 The obtained mouse tumors were subjected to immunohistochemical staining for Ki-67, Bax, and Bcl2. The results showed that Ki-67 and Bcl2 had more positive staining in the OE-linc-ZNF25-1 group, while the pro-apoptotic protein Bax was relatively less (as shown in Figure 2A). Fig.16 This demonstrates that overexpression of linc-ZNF25-1 does promote the progression of pancreatic cancer.

[0152] This patent of the present invention discovered a new mechanism for the development of pancreatic cancer. EVs-mediated linc-ZNF25-1 is a new target for the treatment of pancreatic cancer, providing an important scientific basis for the further diagnosis and treatment of pancreatic cancer.

[0153] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0154] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Use of a linc-ZNF25-1 gene inhibitor in the preparation of a drug for treating pancreatic cancer, characterized in that: The nucleotide sequence of the linc-ZNF25-1 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The linc-ZNF25-1 gene inhibitor includes: a linc-ZNF25-1 gene knockout reagent or a linc-ZNF25-1 gene interfering RNA.

3. The use according to claim 2, characterized in that The linc-ZNF25-1 gene knockout reagents include: reagents used in CRISPR / Cas9 technology; The interfering RNA of the linc-ZNF25-1 gene is any one of antisense oligonucleotide, small interfering RNA and a mixture of antisense oligonucleotide and small interfering RNA.

4. The use according to claim 3, characterized in that The interfering RNA of the linc-ZNF25-1 gene consists of the sequence shown in SEQ ID NO. 2-7.

5. The use according to claim 3, characterized in that The drug is an extracellular vesicle comprising the linc-ZNF25-1 gene knockout agent.

6. The use according to claim 1, characterized in that The drug is used to reduce the clonogenicity of pancreatic cancer cells.

7. The use according to claim 1, characterized in that The medicament is used to reduce the proliferation of pancreatic cancer cells.

8. The use according to claim 1, characterized in that The drug is used to reduce the resistance of pancreatic cancer cells to chemotherapy drugs.

9. Use of the linc-ZNF25-1 gene inhibitor of claim 1 in the preparation of a drug for reducing the tolerance of pancreatic cancer chemotherapy.

10. The use according to claim 9, characterized in that The pancreatic cancer chemotherapy drug is gemcitabine.

Images