Application of RTN3 protein and related biological materials thereof in regulation and control of tiller number of rice

Abstract

The invention discloses an application of RTN3 protein and related biological materials thereof in regulating and controlling the tiller number of rice, and belongs to the technical field of genetic engineering. The technical problem to be solved by the invention is how to regulate and control the tiller number of plants. In order to solve the technical problem, the invention provides the application of the RTN3 protein and / or the biological material related to the RTN3 protein in specific regulation of the tiller number of the plant. The RTN3 protein is a protein with an amino acid sequence of SEQ ID NO: 3. The invention discloses the regulation and control effect of the RTN3 gene in the tiller number of rice for the first time, and the RTN3 gene specifically regulates and controls the panicle type: only the tiller number is regulated and controlled, and the panicle type is not influenced. The rice RTN3 gene plays an important role in rice tillering breeding and rice tillering mechanism research, and can be widely applied to the plant fields of rice genetic breeding, germplasm resource screening, transgenosis, genome editing breeding and the like.

Description

Technical Field

[0001] The present application belongs to the field of genetic engineering technology, and specifically relates to the application of RTN3 protein and related biological materials in regulating the tillering number of rice. Background Art

[0002] There are many different plant types in nature, forming a beautiful landscape on the earth. Plant type refers to the overall appearance and structural characteristics of the aboveground part of the plant, which is generally composed of structures such as plant height, number and angle of branches, and leaf type. Studies have found that plant type originates from the shoot apical meristem (SAM) formed during embryonic development. In the late embryonic development, SAM establishes the stem-root axis of the plant body by continuously producing growth units composed of internodes, leaves, and lateral meristems (AM) in the axils of leaves, and eventually forms a variety of plant forms. The diversity of plant types in nature not only affects the cultivation methods, resource acquisition, and yield improvement of plants, but also regulates the environmental adaptation and survival competitiveness of plants.

[0003] Plant branching is one of the important components of plant type formation. According to the branching rules and patterns of the stem, plants form different branching types. Plant branching types are mainly divided into the following five categories: (1) Monoaxial branching, in which the growth of lateral buds is inhibited, and the terminal bud forms a branching method with a single main stem by continuously growing upward. Most gymnosperms and some angiosperms, such as poplars, ginkgo and many herbaceous plants, have this branching method. (2) Sympodial branching, in which the terminal bud of the main stem grows slowly or even stops after a period of growth, while the lateral buds continue to grow instead of the terminal buds to form new branches. The lateral buds on the branches produce new branches in the same way, thus forming a branching method with a tortuous main stem composed of multiple branches. Most angiosperms, such as tomatoes and peach trees, have this branching method. (3) Dichotomous branching, in which the growth point at the tip of the stem splits into two and develops into opposite branches, on which new branches are continuously produced, forming an umbrella-like structure. This branching method is relatively ancient and appears in some lower and a few higher plants such as liverworts. (4) Pseudo-binary branching: When the apical bud no longer grows or differentiates into flower buds, the lateral buds on both sides below it develop into branches. The growth pattern of the apical buds and lateral buds on the branches is the same as that of the main stem, and the branching method continues to develop in this way. Since this branching method is different from binary branching, it is called pseudo-binary branching. Generally, plants with opposite leaves such as dianthus, lilac, jasmine, etc. belong to this branching method. (5) Tillering: Usually located in the unextended internodes at the base of the main stem of the plant, it is in a clustered state. Tillers have independent root systems and can survive independently after being separated from the main stem. Tillering is common in Gramineae crops such as rice and wheat. As a special type of branching, tillering directly determines the yield per plant by affecting the number of panicles per plant. Therefore, it is of great theoretical value to improve crop plant type and further increase its yield by exploring the regulatory genes of tiller development and exploring the genetic mechanism behind it.

[0004] As one of the important agronomic traits, the number of rice tillers is crucial to increasing yield. In recent years, the regulatory factors of rice tiller formation have been identified one after another, but the genetic relationship between them and the molecular genetic network that mediates rice tiller formation are still not well understood. Therefore, cloning new genes that regulate rice tiller formation and clarifying their regulatory mechanisms will help reveal the genetic regulatory network of tiller development and thus improve our ability to rationally improve rice plant type. Summary of the invention

[0005] The technical problem to be solved by the present application is: how to regulate the tillering number of a plant. Specifically, the technical problem to be solved by the present application is: how to specifically regulate the tillering number of rice.

[0006] In order to solve the above technical problems, the present application provides the use of RTN3 protein and / or biological materials related to the RTN3 protein in at least one of the following: A1) Application in regulating plant tillering number; A2) Application in the preparation of products for regulating the number of plant tillers; A3) Application in plant breeding or plant assisted breeding; A4) Use in the preparation of products for plant breeding or plant-assisted breeding; The RTN3 protein may be any of the following proteins: a1), the amino acid sequence is the protein shown in SEQ ID NO: 3; a2), a protein obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a1), which has more than 80% identity with the amino acid sequence shown in a1), and is related to the tillering number of plants; a3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of the protein shown in a1) or a2).

[0007] In the present application, the plant breeding assessment index may include the number of tillers, more specifically the number of effective tillers.

[0008] In the present application, the purpose of plant breeding may include cultivating plants with altered tiller number (effective tiller number).

[0009] In the present application, the regulation may be increasing, promoting or upregulating.

[0010] In the present application, the regulation may also be reduction, inhibition or down-regulation.

[0011] In the present application, the protein may be derived from rice.

[0012] In the present application, SEQ ID NO: 3 consists of 578 amino acid residues.

[0013] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0014] The protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0015] Further, the connection described in a3) can be a peptide bond connection formed by dehydration condensation between the N-terminus of the tag and the C-terminus of the protein described in a1) or a2). Or, the connection described in a3) can be a peptide bond connection formed by dehydration condensation between the C-terminus of the tag and the N-terminus of the protein described in a1) or a2).

[0016] Furthermore, in the application, the biomaterial may be any of the following: B1), a nucleic acid molecule encoding the RTN3 protein; B2), an expression cassette and / or construct containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette and / or construct described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette and / or construct described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette and / or construct described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), transgenic plant tissue containing the expression cassette and / or construct described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7), transgenic plant organs containing the nucleic acid molecule described in B1), transgenic plant organs containing the expression cassette and / or construct described in B2), or transgenic plant organs containing the recombinant vector described in B3); B8), a nucleic acid molecule that inhibits or reduces the expression of the RTN3 protein encoding gene; B9), expression cassette and / or construct, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue and / or transgenic plant organ containing the nucleic acid molecule described in B8).

[0017] Furthermore, in the application, the nucleic acid molecule in B1) may be a DNA molecule as described in any one of g1) to g3) below: g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID NO: 2; g2), the nucleotide sequence of the coding strand is the DNA molecule of positions 1838-5807 of SEQ ID NO: 1; g3) A DNA molecule that has more than 80% identity with the DNA molecule in g1) or g2) and regulates the tillering number of a plant.

[0018] Furthermore, in the application, the expression cassette described in B2) refers to a DNA capable of expressing the RTN3 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the RTN3 protein encoding gene, but also a terminator and / or enhancer sequence for terminating transcription of the RTN3 protein encoding gene.

[0019] In some embodiments of the present application, the recombinant vector described in B3) may be pCAMBIA1300- RTN3 . pCAMBIA1300- RTN3 The vector can express the RTN3 protein whose amino acid sequence is SEQ ID NO: 3. RTN3 The structure is: the DNA molecule with the nucleotide sequence of SEQ ID NO: 1 replaces the pCAMBIA1300 vector Hin d III and Eco The fragment between the RI restriction sites ( Hin d III and Eco RI restriction site), keeping the other nucleotide sequences of the pCAMBIA1300 vector unchanged.

[0020] Furthermore, in the application, B8) the nucleic acid molecule may be an RNA targeting the gene encoding the above-mentioned RTN3 protein or a DNA encoding the RNA.

[0021] Furthermore, in the application, B8) the target site sequence of the nucleic acid molecule may be SEQ ID NO: 4 and / or SEQ ID NO: 5.

[0022] In some embodiments of the present application, the expression cassette described in B9) may be an expression cassette of RNA targeting the gene encoding the above-mentioned RTN3 protein.

[0023] B9) The recombinant vector described in the above-mentioned may be pYLCRISPR / Cas9P ubi -H- T RTN3 . pYLCRISPR / Cas9P ubi -H- T RTN3 The vector can encode the sgRNA targeting the DNA molecule shown in SEQ ID NO: 1 and the effector protein of the CRISPR / Cas9 system: Cas9 protein.

[0024] Furthermore, in the application, the recombinant microorganism can specifically be yeast, bacteria, algae and fungi.

[0025] Furthermore, in the application, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0026] Furthermore, in the application, the transgenic plant organ can be the root, stem, leaf, flower, fruit and seed of the transgenic plant.

[0027] Furthermore, in the application, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ may or may not include propagation materials.

[0028] The present application also provides a method for increasing the tillering number of a plant, the method comprising introducing a gene encoding the RTN3 protein into a recipient plant to increase the tillering number of the recipient plant. The recipient plant does not contain the gene encoding the RTN3 protein.

[0029] The present application also provides a method for obtaining a target plant with increased tiller number, the method comprising introducing the coding gene of the RTN3 protein into a recipient plant to obtain the target plant with increased tiller number. The recipient plant does not contain the coding gene of the RTN3 protein.

[0030] Furthermore, the coding gene of the RTN3 protein may be a DNA molecule as described in any one of g1) to g3) below: g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID NO: 2; g2), the nucleotide sequence of the coding strand is the DNA molecule of positions 1838-5807 of SEQ ID NO: 1; g3) A DNA molecule that has more than 80% identity with the DNA molecule in g1) or g2) and regulates the tillering number of a plant.

[0031] The present application also provides a method for reducing the tillering number of a plant and / or obtaining a target plant with a reduced tillering number, the method comprising the following m1) or m2), m1), knocking out the coding gene of the RTN3 protein in the recipient plant by a genome editing system to reduce the plant tiller number and / or obtain a target plant with reduced tiller number; the genome editing system comprises an sgRNA with a target site of SEQ ID NO: 4, an sgRNA with a target site of SEQ ID NO: 5, and an effector protein Cas9 of CRISPR / Cas9; m2), mutating a gene in a recipient plant to reduce the number of plant tillers and / or obtain a target plant with a reduced number of tillers, wherein the mutation is: deleting the adenine deoxyribonucleotide at position 1825 of SEQ ID NO: 1 and the deoxyribonucleotides at positions 3616-3618 of SEQ ID NO: 1.

[0032] In the present application, the coding gene of the RTN3 protein may be a DNA molecule as described in any one of g1) to g3) below: g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID NO: 2; g2), the nucleotide sequence of the coding strand is the DNA molecule of positions 1838-5807 of SEQ ID NO: 1; g3) A DNA molecule that has more than 80% identity with the DNA molecule in g1) or g2) and regulates the tillering number of a plant.

[0033] Furthermore, in the method described above, the gene encoding the RTN3 protein and / or the genome editing system are introduced into the recipient plant in the form of a vector.

[0034] In one embodiment of the present application, the vector containing the coding gene may be pCAMBIA1300- RTN3 . pCAMBIA1300- RTN3 The vector can express the RTN3 protein whose amino acid sequence is SEQ ID NO: 3.

[0035] In some embodiments of the present application, the vector containing the CRISPR / Cas system may be pYLCRISPR / Cas9P ubi -H- T RTN3 The pYLCRISPR / Cas9P ubi -H- T RTN3 The vector can encode the sgRNA targeting the DNA molecule shown in SEQ ID NO: 1 and the effector protein of the CRISPR / Cas9 system: Cas9 protein. Recombinant vector pYLCRISPR / Cas9P ubi -H- T RTN3 Contains 2 sgRNA expression cassettes and 1 Cas9 protein expression cassette. RTN3 The genome editing system of a gene includes: an sgRNA with a target site of SEQ ID NO: 4, an sgRNA with a target site of SEQ ID NO: 5, and the effector protein Cas9 of CRISPR / Cas9. After being introduced into the receptor, the two transcribed guide RNAs (i.e., sgRNA and sgRNA) can target the target sequence near the PAM of the receptor genome through base complementary pairing, i.e., targeting RTN3 gene, Cas9 protein and two sgRNAs form genome editing effector complexes respectively, RTN3 The double-stranded DNA breaks near the target sites shown in SEQ ID NO: 4 and SEQ ID NO: 5 of the gene are repaired by the organism's own DNA damage repair response mechanism, causing gene mutations in the sheared regions during the repair process, thereby achieving RTN3 Knockout of genes.

[0036] The present application also provides the RTN3 protein and the biological material.

[0037] The present application also provides a composition for genome editing, comprising an sgRNA with a target site of SEQ ID NO: 4, an sgRNA with a target site of SEQ ID NO: 5, and an effector protein Cas9 of CRISPR / Cas9.

[0038] In the present application, the plant can be selected from monocotyledonous plants.

[0039] In the present application, the monocotyledonous plant can be selected from the Poaceae family.

[0040] In the present application, the grass plant can be selected from cereal plants.

[0041] In the present application, the cereal plant can be selected from rice plants.

[0042] In the present application, the rice plant can be selected from rice ( Oryza sativa L.).

[0043] The beneficial technical effects achieved by this application are as follows: This application was finally located through gene positioning and map-based cloning. RTN3 Genes, and through genetic complementation experiments and genome editing experiments have been identified RTN3 The function of a gene. Rice genes RTN3 The research on rice tillering breeding and the mechanism of rice tillering plays an important role and can be widely used in plant fields such as rice genetic breeding, germplasm resource screening, transgenic and genome editing breeding.

[0044] It is worth noting that the tiller number regulating genes disclosed in the prior art are often accompanied by changes in panicle type. RTN3 The gene specifically regulates the number of tillers and has no effect on the panicle type. Tillering and panicle type are important elements of yield composition, but the antagonistic relationship between them affects the yield potential of rice to a certain extent. Exploring tillering and panicle type specific regulatory genes is an effective strategy to break the mutual constraints between the two and achieve a new breakthrough in rice yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 For mutant rtn3 Phenotypic analysis of AB: wild-type ZH11 and mutant rtn3 Phenotypes at the tillering stage (A) and maturity stage (B), the scale bar is 10 cm. CD: ZH11 and rtn3 Statistical results of tiller number (C) and plant height (D) of mutants. The values ​​in the figure are mean ± standard deviation ( n = 10). E: ZH11 andrtn3 Dynamic changes in the number of tillers of mutants. The values ​​in the figure are mean ± standard deviation ( n = 10). Student's t The test is used to analyze the data. ** indicates that P The difference was statistically significant at the <0.01 level.

[0046] Figure 2 For mutant rtn3 A: Wild-type ZH11 and rtn3 The mutant ears have the same phenotype, and the scale bar is 2.5 cm. rtn3 Grain length (B) and width (C) phenotypes of mutants. Scale bar is 10 mm. rtn3 Statistical results of the mutant ear length (D), ear branching (E), grain length (F), width (G), thousand-grain weight (H) and fruiting rate (I). The values ​​in the figure represent the mean ± standard deviation ( n = 10).

[0047] Figure 3 for RTN3 Gene cloning and functional verification. A: RTN3 Gene cloning. Blue rectangles represent exons. Letters in brackets represent base changes, and letters outside brackets represent changes in the corresponding amino acids. B: Wild-type ZH11, rtn3 and pRTN3C Phenotypes of complementary transgenic plants. Scale bar is 10 cm. CD: wild type ZH11, rtn3 and pRTN3C Statistical results of tiller number (C) and plant height (D) of complementary transgenic plants. The values ​​in the figure represent mean ± standard deviation ( n = 15). Tukey analysis of variance was performed in one-way ANOVA. Different letters represent significant differences between groups ( P <0.05).

[0048] Figure 4 for CR-rtn3 Phenotypic identification of mutants. A: RTN3 Schematic diagram of CRISPR / Cas9 target sites and gene editing results. Red fonts represent sgRNA targeting sequences, underlined positions represent sequences adjacent to the protospacer motif, and dotted lines represent missing sequences. ZH11 represents the reference sequence. CR-rtn3-1 Indicates mutant sequence. B: wild type ZH11, rtn3 and CR-rtn3 The phenotype of. The scale bar is 10 cm. CD: wild type ZH11, rtn3 and CR-rtn3Statistical results of tiller number and plant height of mutants. The values ​​in the figure represent mean ± standard deviation ( n = 15). The data were analyzed by ANOVA using the Tukey method. Different letters represent significant differences among the groups ( P <0.05). DETAILED DESCRIPTION

[0049] 1. Terms used in this application: Examples of resources describing many of the molecular biology-related terms used herein can be found in Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, Genes IX, Oxford University Press: New York, 2007.

[0050] Any references cited herein, including, for example, all patents, published patent applications, and non-patent publications, are incorporated by reference in their entirety.

[0051] To facilitate understanding of the present disclosure, several terms and abbreviations used herein are defined as follows: In this application, "consistency" refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence (or nucleotide sequence) can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Perresidue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for a pair of amino acid sequences to calculate the identity, and then the identity value (%) can be obtained.

[0052] Specifically, the consistency of more than 70% may be more than 75%. Specifically, the consistency of more than 75% may be more than 80%. Specifically, the consistency of more than 80% may be more than 85%. Specifically, the consistency of more than 85% may be more than 90%. Specifically, the consistency of more than 90% may be more than 91%, more than 92%, more than 93%, more than 94%, more than 95%, more than 96%, more than 97%, more than 98%, or more than 99%. More specifically, the consistency of more than 70% may be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0053] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B, and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C.

[0054] As used herein, "plant" includes explants, plant parts, seedlings, plantlets or whole plants at any stage of regeneration or development.

[0055] As used herein, the term "cereal" refers to monocotyledonous crop plants of the Poaceae or Gramineae family and typically harvested for their seeds, including, for example, corn, wheat, rice, millet, barley, sorghum, oats, and rye.

[0056] As used herein, "plant part" may refer to any organ or intact tissue of a plant, such as meristem, bud organ / structure (e.g., leaf, stem or node), root, flower or flower organ / structure (e.g., flower, bract, sepal, petal, stamen, carpel, anther and ovule), seed (e.g., embryo, endosperm and seed coat), fruit (e.g., mature ovary), propagule or other plant tissue (e.g., vascular tissue, dermal tissue, ground tissue, etc.) or any part thereof. The plant part of the present disclosure may be vigorous, inactive, regenerable and / or non-regenerable. "Propaganda" may include any plant part that may grow into a whole plant.

[0057] Plant cells are biological cells of plants, which are taken from plants or derived from cultures obtained by culturing cells taken from plants. As used herein, "transgenic plant cells" refer to any plant cells transformed with stably integrated recombinant DNA molecules, constructs, expression cassettes or sequences. Transgenic plant cells can include original transformed plant cells, transgenic plant cells regenerated or developed from R0 generation transgenic plant cells, transgenic plant cells obtained from another transgenic plant cell culture, or transgenic plant cells from any progeny plants or offspring of transformed R0 generation plants, including plant seeds or embryonic cells, or cultured plant cells, callus cells, etc.

[0058] As generally understood in the art, the term "promoter" can generally refer to a DNA that contains an RNA polymerase binding site, a transcription start site and / or a TATA box and assists or promotes transcription of a transcribable DNA. A promoter can be produced, altered or derived from a known or naturally occurring promoter by artificial synthesis. A promoter can also include a chimeric promoter comprising a combination of two or more heterologous sequences. Therefore, the promoter of the present application can include variants of promoter sequences that are similar in composition but not identical to other promoter sequences provided herein.

[0059] Promoters can be classified according to various standards related to the expression pattern of the relevant coding or transcribable sequence or gene (including transgenic) operably connected to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc., which drive expression in all or most tissues of the plant and are referred to as "constitutive" promoters. Promoters that drive expression at certain periods or stages of development are referred to as "developmental" promoters. Relative to other plant tissues, promoters that drive enhanced expression in certain tissues of the plant are referred to as "tissue-enhanced" or "tissue-preferred" promoters. Therefore, "tissue-preferred" promoters cause relatively high or preferential expression in the specific tissues of the plant, but the expression level is low in other tissues of the plant. Promoters that are expressed in the specific tissues of the plant and rarely or not expressed in other plant tissues are referred to as "tissue-specific" promoters. "Inducible" promoters are promoters that initiate transcription in response to environmental stimuli (such as cold, drought or light) or other stimuli (such as wounded or chemically applied). Promoters can also be classified according to their source, such as heterologous, homologous, chimeric, synthetic, etc.

[0060] The term "transcribable DNA" refers to DNA that can be transcribed into an RNA molecule.

[0061] The term "operably linked" may refer to a functional connection between a promoter and a transcribable DNA, so that the promoter functions to initiate transcription of the transcribable DNA. The term "operably linked" may also refer to a functional connection between other regulatory elements and a target gene to regulate the transcription and / or expression of the target gene.

[0062] The term "construct" means any recombinant DNA molecule or recombinant RNA molecule. A recombinant DNA molecule may be a plasmid, a cosmid, a virus, a phage, or a linear or circular DNA. A construct typically includes one or more expression cassettes.

[0063] As used herein, an "expression cassette" refers to a composition comprising at least transcribable DNA operably linked to one or more regulatory elements, usually at least a promoter and a 3'UTR (eg, a terminator).

[0064] As used herein, the term "vector" means any construct that can be used for transformation purposes, ie, to introduce heterologous DNA into a host cell, such as a plasmid, cosmid, virus, phage, or linear or circular DNA.

[0065] As used herein, "editing" or "genome editing" refers to the use of targeted genome editing technology to generate targeted mutations, deletions, inversions or substitutions of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 1000, at least 2500, at least 5000 or at least 10,000 nucleotides of an endogenous plant genomic nucleic acid sequence.

[0066] In the present application, "editing" or "genome editing" also encompasses the targeted insertion or site-directed integration of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 750, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 4000, at least 5000 or at least 10,000 nucleotides into the endogenous genome of a plant using targeted genome editing technology.

[0067] In this application, a "target site" for genome editing refers to the position of a polynucleotide sequence in a plant genome, which is targeted and cut by a site-specific nuclease, thereby introducing a double-strand break (or a single-strand nick) into the nucleic acid backbone of the polynucleotide sequence and / or its complementary DNA strand. Site-specific nucleases can be bound to the target site, for example, via non-coding guide RNAs (such as, but not limited to, CRISPR RNA (crRNA) or single-stranded guide RNAs (sgRNA)). The non-coding guide RNA provided herein can be complementary to the target site (e.g., complementary to the strand of a double-stranded nucleic acid molecule or the chromosome of the target site). "Target site" also refers to the position of a polynucleotide sequence in a plant genome that is bound and cut by another site-specific nuclease, which may not be guided by a non-coding RNA molecule, such as a large range of nucleases, zinc finger nucleases (ZFNs), or transcription activator-like effector nucleases (TALENs), to introduce double-strand breaks (or single-strand nicks) into a polynucleotide sequence and / or its complementary DNA strand.

[0068] As used herein, the term "guide RNA" or "gRNA" is a short RNA sequence that comprises (1) a structural or scaffold RNA sequence required for binding or interacting with an RNA-guided nuclease and / or with other RNA molecules (e.g., tracrRNA), and (2) an RNA sequence that is identical or complementary to a target sequence or target site (referred to herein as a "guide sequence"). A "single-stranded guide RNA" (or "sgRNA") is an RNA molecule that comprises a tracrRNA and a crRNA covalently linked by a linker sequence, which can be expressed as a single RNA transcript or molecule. The guide RNA comprises a guide or targeting sequence ("guide sequence") that is identical or complementary to a target site within a plant genome, such as at or near a GA oxidase gene. A protospacer adjacent motif (PAM) may be present in the genome immediately 5' to and upstream of a genomic target site sequence that is complementary to the targeting sequence of the guide RNA, i.e., immediately downstream (3') of the sense (+) strand of the genomic target site as known in the art (relative to the targeting sequence of the guide RNA). The genomic PAM sequence on the sense (+) strand adjacent to the target site (relative to the targeting sequence of the guide RNA) may comprise 5'-NGG-3'. However, the corresponding sequence of the guide RNA (i.e., immediately downstream (3') of the targeting sequence of the guide RNA) is typically not complementary to the genomic PAM sequence. The guide RNA may typically be a non-coding RNA molecule that does not encode a protein.

[0069] In this application, "RNA-guided nuclease" refers to an RNA-guided DNA endonuclease associated with the CRISPR system. Non-limiting examples of RNA-guided nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, homologs thereof, or modified forms thereof. In one aspect embodiment, the RNA-guided nuclease is Cas9. In one aspect embodiment, the RNA-guided nuclease comprises an N-terminal and a C-terminal nuclear localization sequence (NLS).

[0070] In some embodiments of the present application, the composition for genome editing can be co-delivered with a DNA molecule containing a selection or screening marker gene.

[0071] Furthermore, the Cas9 protein described in the present application is not limited to a specific protein, as long as it can be used in combination with the sgRNA of the present application. Further, the Cas9 protein described in this article is selected from Streptococcus pyogenes Cas9 (spCas9, subtype II-A), spCas9HF (high fidelity), notchase Cas9 (nCas9), Staphylococcus aureus Cas9 (saCas9, subtype II-A), Neisseria meningitidis Cas9 (NmCas9, subtype II-C), Francisella novicida Cas9 specification 71000022023.03 (FnCas9, subtype II-B), Streptococcus thermophilus Cas9 (St1Cas9, St3Cas9), Campylobacter jejuni Cas9 (CjCas9) and Treponema sp. Cas9, as well as Cas9 orthologs of other organisms but not limited to them. The Cas9 protein may also include high-fidelity Cas9 mutants (such as SpCas9-HF1, eSpCas9-1.1 and TrueCut™HiFiCas9 protein), etc.

[0072] II. Biomaterials, Test Methods and Examples in this Application The genetic complementation vector pCAMBIA1300 is disclosed in the document “Lin, H., Wang, R., Qian, Q., Yan, M., Meng, X., Fu, Z., Yan, C., Jiang, B., Su, Z., Li, J., et al. (2009). DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth. Plant Cell 21:1512-1525.” The public may obtain the relevant biological materials from the applicant, and the obtained biological materials may only be used for the verification of the patented technical solution and may not be used for other purposes.

[0073] Gene knockout vector system pYLCRISPR / Cas9P ubi-H was kindly donated by Professor Liu Yaoguang of South China Agricultural University and was disclosed in the document "Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8: 1274-1284." The public can obtain the relevant biological materials from the applicant, and the obtained biological materials can only be used for the verification of the patented technical solution and cannot be used for other purposes.

[0074] rtn3 The mutant is Oryza sativa rtn3 in the NCBI SRA database: https: / / www.ncbi.nlm.nih.gov / sra / SRX27850146[accn], Publication Date: 2025-03-01; Accession: SRX27850146), and the public can obtain biological materials from Shandong Agricultural University.

[0075] Some experiments and methods involved in this application are as follows: 1) Rice planting and field observation methods The seeds of wild type, mutant and transgenic materials that need to be propagated or observed for phenotype are divided into breathable soaking bags, soaked at room temperature for 3-4 days, and the water is changed once a day. The germinated seeds are sown on seedling trays or nursery beds, and covered with film on the seedbed to ensure the humidity and temperature of the seedbed, which is conducive to the emergence and rapid growth of seedlings. The seedlings are transplanted to the field about 1 month later. If there are no special requirements, the general cultivation requirements are to plant 3 rows for each number, 8 seedlings per row, and the row spacing is about 10 cm. The planting and phenotypic investigation of rice materials were completed at the experimental base of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Changping and Shunyi Districts, Beijing (May to November) or the Lingshui South Breeding Base in Hainan (December to April of the following year). All materials were grown under natural field conditions.

[0076] The number of rice tillers refers to the number of effective tillers at the heading stage, i.e. tillers that grow ears; the rice plant height refers to the distance from the ear tip to the ground. In addition, rice yield traits such as ear length, ear branching, number of grains per ear, grain length, grain width, 1000-grain weight, and fruit setting rate are measured and counted at maturity. Representative individual plants are selected for photography based on the statistical results.

[0077] 2) The method for extracting rice genomic DNA is as follows: Rice genomic DNA was extracted using the CTAB method. The specific steps are as follows: CTAB extraction buffer preparation: 20g / L CTAB, 0.1 M Tris, 0.02 M EDTA and 1.4 M NaCl, the solvent is water.

[0078] (1) Take an appropriate amount of rice leaves and place them in a 2 mL round-bottom centrifuge tube containing a steel ball. Place them in liquid nitrogen and freeze them thoroughly.

[0079] (2) Oscillate the sample using a tissue disruptor (Thmorgan CK1000) at 800 times / min for 1 min and then cool to room temperature.

[0080] (3) Add 750 μL of CTAB extraction buffer to each centrifuge tube and mix by inverting. Place the tube in a 65°C oven and incubate for about 40 minutes, inverting 2-3 times to mix.

[0081] (4) Add an equal volume of chloroform, invert and mix, 10,000 g Centrifuge for 10 minutes.

[0082] (5) Take 400 μL of the supernatant and transfer it to a new centrifuge tube. Add 800 μL of anhydrous ethanol and mix thoroughly by inversion. Incubate the tube at room temperature for 30 minutes or at -20°C overnight.

[0083] (6) 10,000 g Centrifuge for 10 minutes and discard the supernatant. After a short centrifugation, remove the supernatant. After drying at room temperature, add appropriate amount of ultrapure water to dissolve and store at -20°C for later use.

[0084] 3) BSA colony construction and gene cloning Will rtn3 The mutant was crossed with ZH11 to obtain F1, and self-pollinated to obtain F2 segregating population. Individuals with similar phenotypes to the wild type and mutant were obtained from F2, and 20-30 individual plants were taken from each to extract genomic DNA. rtn3DNA of the mutant population was collected and mixed in equal amounts to obtain four DNA pools. The four DNA pools were resequenced and analyzed using MutMap Pepline (Abe A, Kosugi S, Yoshida K, Natsume S, Takagi H, Kanzaki H, Matsumura H, Yoshida K, Mitsuoka C, Tamiru M, et al. (2012) Genome sequencing reveals agronomically important loci in rice using MutMap. Nat Biotechnol 30: 174-178). By comparing with the reference genome sequence, a series of single nucleotide polymorphisms (SNPs) were obtained on 12 rice chromosomes. The frequency of SNPs in the wild-type and mutant pools was calculated, i.e., the SNP index. Based on the SNP index, a mutation site that was closely linked to the mutant phenotype was locked. Further analysis revealed that the site was located on the seventh exon of the gene, resulting in a mutation from adenine A to guanine G. PCR and sequencing were further used to verify that the mutation site was consistent with the analysis results, and genetic complementation experiments and gene editing experiments were used to functionally verify the candidate gene, thus clarifying that the point mutation of the gene led to the mutant phenotype.

[0085] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0086] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0087] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0088] Embodiment 1, RTN3 Discovery and cloning of genes and their functional validation in regulating rice tillering development 1.1 Rice rtn3 Mutant phenotype analysis 1.1.1 Rice rtn3The mutant had a reduced number of tillers Our laboratory has previously collected a series of mutants with few tillers and named them reduced tiller number ( rtn ) series. Among them, rtn3 The mutant was derived from the Zhonghua 11 (Oryza sativa L. ssp. japonica, ZH11) background. Its tiller number was significantly reduced and its plant height was slightly reduced, both at the tillering stage and at the maturity stage ( Figure 1 In order to compare wild-type ZH11 and mutant rtn3 The dynamic changes of tiller number during the whole growth cycle, the tiller number of experimental materials in the field was counted, and it was found that the wild type and rtn3 Both mutants began to grow tillers. Afterwards, the number of tillers in both plants continued to increase, but rtn3 The number of tillers in the mutant was always less than that in the wild type ( Figure 1 Middle E).

[0089] To make it clear rtn3 We investigated whether the mutants had the panicle development phenotype in wild type and rtn3 The ear traits of the mutant included ear length, ear branching, grain length and width, thousand-grain weight, and fruit setting rate. rtn3 There was no significant difference in the panicle traits of the mutants ( Figure 2 ).therefore, rtn3 The mutant specifically affects the tillering development of rice. Uncovering the tillering regulatory genes of the mutant and analyzing its molecular mechanism of specific regulation of tillering development have important theoretical guiding significance for improving rice plant type.

[0090] 1.1.2、 RTN3 Gene cloning and functional analysis: Gene cloning For clone control rtn3 We identified the target gene of the mutant phenotype by combining BSA with genome resequencing. rtn3 In the backcross population of the mutant and the wild-type material ZH11, all F1 plants showed the same phenotype as the wild type. The F2 segregation population was obtained by self-pollination, and 120 plants were randomly selected from the population for phenotypic statistical analysis of tiller number and plant height. The results showed that 96 plants had a phenotype similar to the wild type, and the remaining 24 plants showed a phenotype similar to the wild type. rtn3 The mutants showed consistent low tillering phenotype. 2 The results showed that the segregation ratio between normal plants and mutant plants was 3:1 (Table 1), indicating that the genetic locus controlling the mutant phenotype was a recessive single gene.

[0091] At the same time, 50 plants with wild-type phenotype and 50 plants with mutant phenotype were selected from the F2 population, and two parents were selected to form four DNA pools. By resequencing the genomes of the four pools and performing linkage analysis using the MutMap method, a SNP (G / A) site was identified within the 1 Mbp interval. Further sequencing revealed that the site was RTN3 In the seventh exon of the gene, an amino acid change occurs (G / D) Figure 3 The mutated protein is named RTN3 G410D protein.

[0092]

[0093] RTN3 The genomic sequence of the gene is SEQ ID NO: 1. Among them, positions 1-1716 of SEQ ID NO: 1 are the promoter region, positions 1717-1837 are 5'UTR, positions 1838-1880 are the first exon, positions 1881-2131 are the first intron, positions 2132-2385 are the second exon, positions 2386-3190 are the second intron, positions 3191-3312 are the third exon, positions 3313-3416 are the third intron, positions 3417-3624 are the fourth exon, and positions 3625-37 Position 72 is the fourth intron, positions 3773-3918 are the fifth exon, positions 3919-4048 are the fifth intron, positions 4049-4355 are the sixth exon, positions 4356-4794 are the sixth intron, positions 4795-5246 are the seventh exon, positions 5247-5516 are the seventh intron, positions 5517-5807 are the eighth exon, positions 5808-6062 are 3'UTR, and positions 6063-6480 are the downstream sequence. RTN3 The coding sequence of the gene is SEQ ID NO: 2, and the encoded amino acid sequence is SEQ ID NO: 3 for the RTN3 protein.

[0094] RTN3 G410D The genome sequence of the gene is that the guanine deoxyribonucleotide (G) at position 5029 of SEQ ID NO: 1 mutates to an adenine deoxyribonucleotide (A), the corresponding coding sequence is that the guanine deoxyribonucleotide (G) at position 1229 of SEQ ID NO: 2 mutates to an adenine deoxyribonucleotide (A), and the protein obtained by transcription and translation mutates from glycine (G) to aspartic acid (D) at position 410 of SEQ ID NO: 3. The mutant protein is named RTN3 G410D protein.

[0095] 1.2. Vector construction and construction of transgenic and gene-edited lines 1.2.1. Vector construction (1) Construction of rice genetic complementation: The wild-type ZH11 genome was used as a template to amplify a genomic sequence of 6480 bp in total, including the promoter sequence, coding region, and 673 bp downstream of the stop codon (SEQ ID NO: 1). The fragment was integrated into Hin d III and Eco After RI digestion, the pCAMBIA1300 vector was obtained. RTN3 Genetic complementation vector pCAMBIA1300- RTN3 . pCAMBIA1300- RTN3 The structure is: the DNA molecule with the nucleotide sequence of SEQ ID NO: 1 replaces the pCAMBIA1300 vector Hin d III and Eco The fragment between the RI restriction sites ( Hin d III and Eco The pCAMBIA1300 vector can express the RTN3 protein whose amino acid sequence is SEQ ID NO: 3.

[0096] (2) Construction of rice genome editing vector To further clarify the function of RTN3 in regulating rice tillering development, CRISPR / Cas9 technology was used to design target sites in the 5'UTR and the fourth exon of the RTN3 gene for gene editing to create an RTN3 homozygous mutant. CR-rtn3-1 ( Figure 4 The target site sequences and corresponding promoter sequences are as follows: T1 (5' to 3'): CCATTAGAGGGAAGCTTGG (SEQ ID NO: 4); T2 (5' to 3'): AAGGGCAGTGGTGATATCAA (SEQ ID NO: 5); The promoter of the sgRNA gene targeting T1 is the U6 promoter, and the promoter of the sgRNA gene targeting T2 is the U3 promoter.

[0097] According to the method reported by Ma et al. (Ma X, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8: 1274-1284.), the target site primers were annealed and integrated into gRNA vectors containing different promoters, and U3 / U6-sgRNA fragments were obtained by amplification. Different fragments were connected to pYLCRISPR / Cas9P by end complementation. ubi -H, thereby obtaining the gene editing vector pYLCRISPR / Cas9P ubi -H- T RTN3 .

[0098] Recombinant vector pYLCRISPR / Cas9P ubi -H- T RTN3 Contains 2 sgRNA expression cassettes and 1 Cas9 protein expression cassette. RTN3 The genome editing system of the gene includes: sgRNA with a target site of SEQ ID NO: 4, sgRNA with a target site of SEQ ID NO: 5, and CRISPR / Cas9 effector protein Cas9. After being introduced into the receptor, the two transcribed guide RNAs (i.e., sgRNAs) can target the RTN3 The Cas9 protein forms a genome editing effector complex with two sgRNAs to target the PAM of the gene. RTN3 The DNA double-strand breaks near the gene target site cause gene mutations in the sheared area during the repair process through the organism's own DNA damage repair response mechanism, thereby achieving RTN3 Knockout of genes.

[0099] 1.2.2 Agrobacterium-mediated rice genetic transformation Genetic transformation mediated by Agrobacterium tumefaciens EHA105 (Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice ( Oryza sativa L.)mediated by Agrobacteriumand sequence analysis of the boundaries of the T-DNA. Plant J6: 271-282) to transform rice callus to create rice transgenic and genome editing materials. The genetic complementation vector pCAMBIA1300- RTN3 Rice rtn3 Mutant, pYLCRISPR / Cas9P ubi -H- T RTN3 The transformation receptor is rice Zhonghua 11 (ZH11). The details are as follows: (1) Rice callus induction and subculture. After dehulling the rice seeds, sterilize the surface with 70% ethanol for 1 minute. Then wash with 2.5% (w / v) sodium hypochlorite for 45 minutes. After washing with sterile water 3-4 times, sow the seeds on NB solid culture medium and place them in a 28℃ incubator in the dark for 10 days. Cut the newly grown callus and subculture it on a new NB solid culture medium. Replace the new NB solid culture medium every 7 days, and it can be used for genetic transformation after 3-4 propagations.

[0100] (2) Agrobacterium culture. The constructed plasmids were transformed into the EHA105 strain by electroporation and spread on solid LB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. The culture was placed at 28°C for 2-3 days. The positive clones were selected and inoculated into liquid LB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin and cultured for 14-16 hours. The room temperature was 3,500 g Centrifuge for 10 minutes to collect the cells. Resuspend the cells in the infection solution to a concentration of OD 600 was 0.6-0.8 and then used for transformation of rice callus.

[0101] (3) Agrobacterium infection. Select 100-200 calli with light yellow color, smooth and dense surface and incubate with Agrobacterium infection solution for 3-4 minutes, shaking continuously. Then remove the calli and absorb the remaining bacterial solution with sterile filter paper. Place in a culture dish containing filter paper and incubate in a 22℃ incubator in the dark for 2-3 days.

[0102] (4) Screening, differentiation and plant regeneration of callus tissue. After the callus tissue is removed, it is placed on NB solid medium containing hygromycin and carbenicillin. After 7 days of selection culture at 28°C in the dark, it is transferred to a new selection medium. After 3-4 rounds of selection culture, the callus tissue with better growth status is transferred to the differentiation medium. After one month of light culture at 28°C, the main stem of the seedlings and part of the young roots are inserted into the rooting medium for rooting and seedling strengthening. After about 2 weeks of culture, water is added to harden the seedlings. After one week, the seedlings are transplanted to the experimental field.

[0103] The culture medium formulas involved are as follows: Preparation of NB solid medium: add 2830 mg potassium nitrate, 463 mg ammonium sulfate, 400 mg potassium dihydrogen phosphate, 185 mg magnesium sulfate heptahydrate, 166 calcium chloride dihydrate, 27.8 mg ferrous sulfate heptahydrate, 37.5 mg disodium ethylenediaminetetraacetic acid, 10 mg manganese sulfate tetrahydrate, 3 mg boric acid, 2 mg zinc sulfate heptahydrate, 0.25 mg sodium molybdate crystals, 0.025 mg copper sulfate pentahydrate, 0.025 mg cobalt dichloride hexahydrate, 0.75 mg potassium iodide, 10 mg vitamin B1, 1 mg vitamin B6, 1 mg niacin, 100 mg inositol tripyrophosphate, 300 mg casein hydrolyzate, 500 mg glutamine, 2 mg glycine, 1000 mg proline, 2 mg 2,4-dichlorophenoxyacetic acid and 3.2 g plant gel to 1 L of double distilled water.

[0104] LB medium preparation: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride and 15 g / L agar, the solvent is water.

[0105] Preparation of infection solution: NB liquid medium (the only difference from NB solid medium is that it does not contain 3.2 g of plant gel) was added with 2 g / L inositol, 2 g / L glutamine, 500 mg / L casein hydrolysate, 10 mL / L 10% poloxamer and 100 μM acetosyringone.

[0106] Selection medium: NB solid medium supplemented with 50 mg / L hygromycin and 100 mg / L carbenicillin.

[0107] Preparation of differentiation medium: Add 100 mg / L inositol, 2 g / L casein hydrolysate, 0.2 mg / L naphthaleneacetic acid, 0.2 mg / L kinetin, 2 mg / L 6-benzylaminoadenine, 30 g / L sorbitol, 30 g / L sucrose, 3 g / L hygromycin and 50 mg / L gelatin to NB solid medium.

[0108] Rooting medium: NB solid medium supplemented with 1.0-5.0 mg / L methionine and 0.5 mg / L indolebutyric acid.

[0109] RTN3 Genetic complementation vector pCAMBIA1300- RTN3 Transformation mutant rtn3 The obtained strains were named pRTN3C complemented transgenic strains. After three generations of propagation, the T3 plants were used for phenotypic verification, and finally the T3 pRTN3C complemented transgenic strains numbered #1, #2 and #3 were obtained. The pRTN3C complemented transgenic strains numbered #1, #2 and #3, Zhonghua 11 (ZH11) and mutants were OsCpn60α1 24 plants were planted in the field in 3 rows with a row spacing of 25 cm, and 8 plants in each row with a plant spacing of 15 cm.

[0110] pYLCRISPR / Cas9P ubi -H- T RTN3 The strain obtained by transforming the wild type Zhonghua 11 (ZH11) was named CR-rtn3 After two generations of propagation, the T2 generation plants were used for phenotypic verification, and the T2 generation plants were finally numbered CR-rtn3-1 The sequencing results showed that: CR-rtn3-1 In the T2 generation homozygous lines, compared with the rice variety ZH11, RTN3 The region corresponding to the gene has undergone the following changes: The 1825th position (adenine deoxyribonucleotide) and the 3616-3618th deoxyribonucleotides (ATA) of the sequence shown in SEQ ID NO: 1 are deleted, thereby changing the RTN3 Gene knockout ( Figure 4 Middle A).

[0111] 1.3、 RTN3 Functional verification in regulating rice tillering development Will CR-rtn3-1 , ZH11 and mutants OsCpn60α1 24 plants were planted in the field in 3 rows with a row spacing of 25 cm, and 8 plants in each row with a plant spacing of 15 cm.

[0112] The results are as follows: (1) Through molecular identification and phenotypic observation, it was found that pRTN3C The tiller number and plant height of the complementary transgenic lines were restored to the wild type level ( Figure 3 BD), indicating rtn3 The low tillering phenotype of the mutant is due to RTN3The introduction of the gene encoding the RTN3 protein into the recipient rice caused by a gene mutation (G410D) can increase the tiller number of the recipient rice.

[0113] (2) Phenotypic analysis revealed that the mutant CR-rtn3-1 The number of tillers was significantly reduced compared with the wild type, and the plant height was slightly reduced, showing a similar rtn3 Similar phenotypes ( Figure 4 The above results show that RTN3 It plays an important role in regulating rice tillering development.

[0114] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of RTN3 protein and / or biomaterials related to the RTN3 protein, characterized in that: The application is any of the following: A1) Application in regulating plant tillering number; A2) Application in the preparation of products for regulating the number of plant tillers; A3) Application in plant breeding or plant assisted breeding; A4) Use in the preparation of products for plant breeding or plant-assisted breeding; The RTN3 protein is any of the following proteins: a1), the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in a1).

2. The use according to claim 1, characterized in that: The biological material is any of the following: B1), a nucleic acid molecule encoding the RTN3 protein; B2), an expression cassette and / or construct containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette and / or construct described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette and / or construct described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette and / or construct described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), transgenic plant tissue containing the expression cassette and / or construct described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7), transgenic plant organs containing the nucleic acid molecule described in B1), transgenic plant organs containing the expression cassette and / or construct described in B2), or transgenic plant organs containing the recombinant vector described in B3); B8), a nucleic acid molecule that inhibits or reduces the expression of the RTN3 protein encoding gene; B9), expression cassette and / or construct, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue and / or transgenic plant organ containing the nucleic acid molecule described in B8).

3. The use according to claim 2, characterized in that: B1) The nucleic acid molecule is the DNA molecule described in g1) or g2) below: g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID NO: 2; g2), the nucleotide sequence of the coding chain is the DNA molecule at positions 1838-5807 of SEQ ID NO:

1.

4. The use according to claim 2, characterized in that: B8) The nucleic acid molecule is an RNA targeting the gene encoding the RTN3 protein of claim 1 or a DNA encoding the RNA.

5. The use according to claim 4, characterized in that: B8) The target site sequence of the nucleic acid molecule is SEQ ID NO: 4 and / or SEQ ID NO:

5.

6. A method for increasing the number of plant tillers, characterized in that: The method comprises introducing the coding gene of the RTN3 protein into a recipient plant to increase the tiller number of the recipient plant.

7. A method for obtaining a target plant with increased tillering number, characterized in that: The method comprises the step of introducing the coding gene of the RTN3 protein into a recipient plant to obtain a target plant with increased tillering number.

8. A method for reducing the number of tillers of a plant and / or obtaining a target plant with a reduced number of tillers, characterized in that: The method comprises the following m1) or m2), m1), knocking out the coding gene of the RTN3 protein in the recipient plant by a genome editing system to reduce the number of plant tillers and / or obtain a target plant with reduced tiller number; the genome editing system comprises an sgRNA with a target site of SEQ ID NO: 4, an sgRNA with a target site of SEQ ID NO: 5, and an effector protein Cas9 of CRISPR / Cas9; m2), mutating a gene in a recipient plant to reduce the number of plant tillers and / or obtain a target plant with a reduced number of tillers, wherein the mutation is: deleting the adenine deoxyribonucleotide at position 1825 of SEQ ID NO: 1 and the deoxyribonucleotides at positions 3616-3618 of SEQ ID NO:

1.

9. Biomaterial, characterized in that: The biomaterial is the biomaterial described in any one of claims 2 to 5.

10. A composition for genome editing of a gene encoding RTN3 protein, characterized in that: The composition includes an sgRNA with a target site of SEQ ID NO: 4, an sgRNA with a target site of SEQ ID NO: 5, and an effector protein Cas9 of CRISPR / Cas9.

Images