Lactococcus lactis R3 and application thereof in preventing and treating visceral white-spot disease of pseudosciaena crocea

Abstract

The invention provides lactococcus lactis R3 and application thereof in preventing and treating visceral white-spot disease of large yellow croakers. The strain is classified and named as lactococcus lactis R3, and is preserved in the China Center for Type Culture Collection (CCTCC) on October 21, 2024, and the preservation number is CCTCC M 20242278. The strain is separated and identified from healthy large yellow croaker intestinal tracts and has antibacterial activity and non-hemolytic activity, antibacterial tests show that the lactococcus lactis R3 is wide in antibacterial spectrum and good in biocontrol effect, and fermentation liquor of the lactococcus lactis R3 can effectively inhibit pseudomonas proteinus, aeromonas hydrophila, escherichia coli, vibrio parahaemolyticus and vibrio alginolyticus. The thallus or the fermentation liquor is used as a feed additive, so that the effect of preventing and treating the visceral white-spot disease can be achieved, a new idea is provided for replacing antibiotics to treat the visceral white-spot disease, and a reliable standby strain is also provided for a fish-source microecological preparation.

Description

Technical Field

[0001] The invention belongs to the technical field of biological control, and particularly relates to a strain of Lactococcus lactis R3 and application thereof in preventing and controlling visceral white spot disease of large yellow croaker. Background Art

[0002] Yellow croaker, commonly known as yellow croaker, belongs to the order Perciformes, family Sciaenidae, and genus Pseudocrocea. It has tender meat, delicious taste, and rich nutrients. It is known as the first of China's traditional "four major seafoods". In the process of cage farming of yellow croaker, with the continuous expansion of the farming scale, various diseases have become more and more frequent. Pseudomonas aeruginosa ( Pseudomonas plecoglossicida ) is a common disease of large yellow croaker cultured in cages in recent years. Its main symptoms are white nodules on the surface of spleen, kidney and liver tissues, with a mortality rate of up to 70% - 80%, causing great economic losses to the large yellow croaker farming industry. At present, the prevention and treatment of pathogenic Pseudomonas proteus mainly uses antibiotics. Although antibiotics have played a positive role in the prevention and treatment of aquatic animal diseases, with the development of science, their adverse effects and harm to the environment and humans have gradually emerged. Therefore, in the context of the continuous reduction of available antibiotics and the restriction of antibiotic use, it is very important to rationally screen alternatives to antibiotics for the prevention and treatment of this pathogen.

[0003] Probiotics are generally considered to be an efficient and environmentally friendly alternative to antibiotics, playing a positive role in disease prevention and water environment improvement. Among them, they are mainly lactic acid bacteria and Bacillus. Lactococcus lactis ) is a widely distributed member of the genus Lactococcus and is widely distributed in nature. Lactococcus lactis is a globally recognized relatively safe probiotic. It has a very high commercial value in regulating the balance of animal intestinal microecology and improving host immune function. At the same time, Lactococcus lactis also plays an important role in antibacterial properties. During the fermentation process, Lactococcus lactis usually produces a series of antibacterial substances such as organic acids. The U.S. Food and Drug Administration (FDA) has labeled Lactococcus lactis as Generally Recognized As Safe (GRAS). The European Food Safety Authority (EFSA) has classified Lactococcus lactis as Qualified Presumption of Safety (QPS) status. Summary of the invention

[0004] In view of the problems existing in the above-mentioned prior art, the present invention aims to provide a strain of Lactococcus lactis R3 and its application in preventing and treating white spot disease of large yellow croaker viscera.

[0005] To achieve the above object, the present invention adopts the following technical solution: A strain of Lactococcus lactis R3, the strain is classified and named as Lactococcus lactis ( Lactococcus lactis )R3, which was deposited in China Center for Type Culture Collection (Wuhan, China) on October 21, 2024. The deposit number is CCTCC M20242278.

[0006] The above-mentioned Lactococcus lactis R3 has an inhibitory effect on Pseudomonas aeruginosa, Aeromonas hydrophila, Escherichia coli, Vibrio parahaemolyticus and Vibrio alginolyticus.

[0007] A feed additive, comprising the bacterial body and fermentation liquid of the above-mentioned Lactococcus lactis R3.

[0008] The steps for preparing the bacterial cells and fermentation liquid of the Lactococcus lactis R3 are as follows: Lactococcus lactis R3 was inoculated into MRS liquid culture medium, and activated at 37°C for 12 h to obtain seed liquid; the seed liquid was transferred to new MRS liquid culture medium at an inoculation rate of 1 vol%, and fermented at 37°C for 24 h, and centrifuged at 5500 rpm for 10 min. The collected precipitate was the bacteria of Lactococcus lactis R3, and the collected supernatant was the fermentation liquid of Lactococcus lactis R3.

[0009] Furthermore, when used, the fermentation liquid of Lactococcus lactis R3 was added to the cells of Lactococcus lactis R3 to adjust the concentration to 3×10 9 CFU / mL is the feed additive.

[0010] The application of the feed additive in biological control preparations for preventing and controlling aquatic diseases or in large yellow croaker feed.

[0011] The aquatic disease is white spot disease of large yellow croaker viscera caused by Pseudomonas proteus.

[0012] Furthermore, when the above feed additive is used to raise large yellow croaker, the feed additive is evenly sprayed on the regular feed of large yellow croaker, and the feed containing Lactococcus lactis R3 is obtained after being shade-dried.

[0013] The amount of the above feed additives added is 3 × 10 8 CFU / g~3×10 9 CFU / g.

[0014] Compared with the prior art, the beneficial effects of the present invention are: (1) The Lactococcus lactis R3 of the present invention can improve the growth performance of large yellow croaker, and can improve the growth indicators of large yellow croaker weight growth rate, specific growth rate, and feed efficiency.

[0015] (2) The Lactococcus lactis R3 of the present invention can prevent and treat visceral white spot disease, reduce the bacterial load of various tissues of large yellow croaker after infection with Pseudomonas aeruginosa, and improve the survival rate of large yellow croaker.

[0016] (3) The Lactococcus lactis R3 of the present invention has potential application prospects in the field of replacing antibiotics for the prevention and treatment of visceral white spot disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 : The colony morphology of Lactococcus lactis R3.

[0018] Figure 2 : Microscope picture of Lactococcus lactis R3 under oil lens.

[0019] Figure 3 : Schematic diagram of the hemolytic screening results of Lactococcus lactis R3.

[0020] Figure 4 :The phylogenetic tree of Lactococcus lactis R3.

[0021] Figure 5 : The antibacterial effect of the fermentation broth of Lactococcus lactis R3 on different aquatic pathogens; including: (A) Pseudomonas aeruginosa; (B) Aeromonas hydrophila; (C) Escherichia coli; (D) Vibrio parahaemolyticus; (E) Vibrio alginolyticus.

[0022] Figure 6 : (A) Survival rate of yellow croaker infected with Pseudomonas aeruginosa after being fed with Lactococcus lactis R3 for 8 weeks, and bacterial loads of Pseudomonas aeruginosa in the liver, (C) spleen, and (D) intestine of yellow croaker 72 h and 120 h after infection with Pseudomonas aeruginosa. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further described in detail below through specific embodiments.

[0024] The reagents used in the following examples, unless otherwise specified, can be purchased from conventional biochemical reagent stores.

[0025] The formula of MRS liquid culture medium is: 10 g peptone, 5 g yeast extract, 10 g beef extract, 20 g glucose, 2 g dipotassium hydrogen phosphate, 2 g ammonium citrate, 5 g sodium acetate, 0.58 g magnesium sulfate, 0.25 g manganese sulfate, 80 mL Tween, 1.0 L distilled water, pH value is 6.5±0.2. When preparing MRS solid culture medium, add 15 g agar and sterilize it under high pressure at 115℃ for 15 min.

[0026] The formula of TSB liquid culture medium is: 15 g tryptone, 5 g soytone, 5 g sodium chloride, 1.0 L distilled water, pH 7.3±0.2. When preparing TSA culture medium, add 15 g agar and sterilize it by high pressure at 121℃ for 15 min.

[0027] The formula of 2216E liquid culture medium is: 5 g peptone, 1 g yeast extract powder, 0.1 g ferric citrate, 19.45 g sodium chloride, 5.98 g magnesium chloride, 3.24 g sodium sulfate, 1.8 g calcium chloride, 0.55 g potassium chloride, 0.16 g sodium carbonate, 0.08 g potassium bromide, 0.034 g strontium chloride, 0.022 g boric acid, 0.004 g sodium silicate, 0.0024 g sodium fluoride, 0.0016 g ammonium nitrate, 0.008 g disodium hydrogen phosphate, pH value 7.6±0.2. When preparing 2216E solid culture medium, add 15 g agar and sterilize at 121℃ for 15 min.

[0028] Example 1 Isolation and Identification of Lactococcus lactis (1) Lactococcus lactis R3 was isolated from the intestinal samples of large yellow croaker, which was caught in Ningde, Fujian. The whole intestine of large yellow croaker was fully minced and mixed with sterile PBS (pH 7.2) (w / v 1:9), and then diluted to 10% by adding sterile PBS (pH 7.2). -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 and 10 -7 6 concentrations, take 100 μL of the above dilutions of different concentrations and evenly spread them on MRS solid culture plates, and place them in round-bottom vertical anaerobic culture bags in a 37℃ incubator for 48 h. Pick a single colony on the plate, streak it on the MRS solid culture plate with an inoculation loop, and culture it at 37℃ for 48 h for purification. After 3 generations of continuous purification, a pure culture numbered R3 was obtained. Figure 1 As shown, the surface of the Lactococcus lactis R3 colony is smooth and shiny, with low protrusions and complete edges, and is in the form of a thin, light yellow, opaque circle.

[0029] (2) Bacterial genomic DNA was extracted using a bacterial genomic DNA extraction kit (DP302, Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the extracted DNA was amplified by PCR using universal primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAT (SEQ ID NO: 1); 1492R: ACGGCTACCTTGTTACGACTT (SEQ ID NO: 2)). The total reaction system for PCR amplification was 50 μL, and the specific reaction system was: Taq PCR Master Mix 25 μL, 1 μL of 10 μmol / L forward primer (27F), 1 μL of 10 μmol / L reverse primer (1492R), 22 μL of nuclease-free water, and 1 μL of DNA template. The PCR reaction program was as follows: 95 °C pre-denaturation for 10 min; 95 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 90 s, 30 cycles; 72 °C extension for 10 min; 4 °C storage. The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis. The sequence (SEQ ID NO: 3) was compared by Blast on NCBI, and strain R3 was confirmed to be Lactococcus lactis ( Figure 4 ).

[0030] (3) Results: Figure 2 As shown, Gram staining was used to take pictures under an oil lens microscope, and the results showed that Lactococcus lactis R3 was a Gram-positive bacterium.

[0031] Example 2 Hemolytic Screening of Lactococcus lactis R3 When the MRS solid culture medium is cooled to 45-50°C after high-pressure sterilization, add sterile defibrinated sheep blood preheated to room temperature (the amount added is 5% of the volume of the MRS solid culture medium), rotate the flask to mix thoroughly while avoiding the formation of bubbles, and invert the plate to cool to obtain a blood agar plate. Pick a single colony of R3 on the plate and streak it on the blood agar plate, culture it at 37°C for 24 hours, and confirm its hemolytic nature. Strains that produce green areas around the colonies (α-hemolysis) and have no effect on blood agar (γ-hemolysis) are identified as non-hemolytic strains, while strains that produce blood lysis areas around the colonies (β-hemolysis) are identified as hemolytic strains. Figure 3 As shown, Lactococcus lactis R3 had no effect on blood agar and was identified as a non-hemolytic strain, indicating that the Lactococcus lactis R3 strain could not adversely affect the host through hemolysis.

[0032] Example 3 Test on the inhibitory effect of Lactococcus lactis R3 on aquatic pathogens A single colony of Lactococcus lactis R3 was inoculated into 5 mL of MRS liquid culture medium, and activated and cultured at 37°C for 12 h to obtain a seed solution; the seed solution was then transferred to a new MRS liquid culture medium at an inoculation rate of 1 vol%, and fermented and cultured at 37°C for 24 h to obtain a pure culture; after the fermentation culture was completed, the pure culture was centrifuged at 5500 rpm for 10 min to remove the bacteria, and the supernatant was collected, which was the fermentation broth of Lactococcus lactis R3.

[0033] The plate agar diffusion method was used to determine the inhibitory activity of Lactococcus lactis R3 fermentation broth against five aquatic pathogens. The test strains were Pseudomonas proteus, Aeromonas hydrophila, Escherichia coli, Vibrio parahaemolyticus and Vibrio alginolyticus. Pseudomonas proteus, Aeromonas hydrophila and Escherichia coli were cultured in TSB medium, while Vibrio parahaemolyticus and Vibrio alginolyticus were cultured in 2216E medium. When each test strain reached the logarithmic growth phase (approximately 1×10 9 CFU / mL), transfer 100 μL of the culture solution of the above strains to 100 mL of the corresponding sterile medium (containing agar), then mix thoroughly and pour into the plate. After cooling and solidification, use a sterile puncher to punch a hole in the center, inoculate 100 μL of the fermentation solution of Lactococcus lactis R3 in each hole, diffuse on the clean bench for 1 hour, and culture at 27°C for 24 hours. Observe and count the size of the inhibition zone. If the tested pathogens are inhibited, a transparent inhibition zone will appear on the plate. The results are shown in Tables 1 and Figure 5 As shown, the fermentation broth of Lactococcus lactis R3 has inhibitory activity against five aquatic pathogens, including Pseudomonas proteus, Aeromonas hydrophila, Escherichia coli, Vibrio parahaemolyticus and Vibrio alginolyticus.

[0034] Table 1. Table of inhibition diameter of R3 against aquatic pathogens Pseudomonas plecoglossicida PQLYC4 was provided by the College of Oceanography, Fujian Agriculture and Forestry University. Larimichthys crocea ) in China. Example 4 Test on Growth Promotion and Prevention of Visceral White Spot Disease by Lactococcus lactis R3 At Yangze Marine Biotechnology Co., Ltd. in Luoyuan County, Fujian Province, 720 healthy large yellow croakers were selected and randomly distributed into 6 cement pools of 8.0m×2m×1m. The experiment was divided into a control group (CON) and an R-3 group, with 3 replicates in each group. The control group was fed with ordinary large yellow croaker feed (large yellow croaker compound feed, Fujian Tianma Technology Group Co., Ltd.), and the R-3 group was fed with feed containing Lactococcus lactis R3. The fish were fed twice a day at a fixed time in the morning and evening, and each time they were fed until they were visually full, and the residual bait was removed. The culture time was 8 weeks.

[0035] Preparation of feed containing Lactococcus lactis R3: a single colony of Lactococcus lactis R3 was inoculated into 5 mL of MRS liquid culture medium, and activated and cultured at 37°C for 12 h to obtain seed solution; then the seed solution was transferred to a new MRS liquid culture medium at an inoculation rate of 1 vol%, and cultured at 37°C for 24 h, and then centrifuged at 5500 rpm for 10 min. The collected precipitate was the Lactococcus lactis cell, and the collected supernatant was the fermentation broth of Lactococcus lactis. The fermentation broth of Lactococcus lactis R3 was added to adjust the concentration of the bacterial cell suspension to 3×10 10 CFU / mL for subsequent use. Use the fermentation broth of Lactococcus lactis to adjust the concentration of bacterial suspension to 3×10 9 CFU / mL, spray 100 mL (i.e. 3×10 8 CFU / g), dried in the shade and stored at 4℃ for future use.

[0036] The final body weight and feed consumption of each group of large yellow croaker were recorded, and the body weight growth rate, specific growth rate and feed efficiency of each group were calculated using the following formula: Weight gain rate = 100 × (W t − W0) / W0; Specific growth rate = 100 × (lnW t − lnW0) / t; Feed efficiency = (W t – W0) / FC; Among them, W t represents the final body weight, W0 represents the initial body weight, t represents the breeding period, and FC represents feed consumption.

[0037] The resistance of large yellow croakers cultured with Lactococcus lactis R3 to Pseudomonas proteoglycans PQLYC4 was evaluated by immersion method simulating natural infection. Fifteen large yellow croakers were randomly selected from each cement pool and then exposed to 1×10 5CFU / mL of Pseudomonas aeruginosa QLYC4 strain in seawater for 1 h at a temperature of about 22°C. After the challenge, the fish were quickly fished out and soaked in fresh seawater for 10 minutes, and then placed in a culture tank containing about 150 L of fresh seawater. The culture tank was replaced with fresh seawater once a day, and feed containing Lactococcus lactis R3 was fed every 2 days during the culture period. The observation period was 15 days.

[0038] Survival rate = 100 × (S0-S t ) / S0 S0 represents the number of fish at the beginning of the experiment, S t Indicates the number of fish at the end of the experiment.

[0039] In addition, additional infection experiments were performed to evaluate the bacterial load of Pseudomonas proteus in tissues. The infection was carried out under the same conditions as above, with 50 large yellow croakers in each group. At 72 h and 120 h after infection, 8 fish were randomly selected from each group to detect the bacterial load of Pseudomonas proteus in tissues. Total genomic DNA from the intestine, spleen, and liver was extracted using the TIANamp Marine Animal DNA Kit (DP324, Tiangen Biochemical Technology (Beijing) Co., Ltd.) according to the manufacturer's instructions. The bacterial load was determined according to ikB Gene copy number calculation, ikB The gene copy number was determined by TaqMan qRT-PCR.

[0040] Table 2 Growth indicators of large yellow croaker Note:*** p <0.001,** p <0.01,* p <0.05.

[0041] The results are shown in Table 2. Lactococcus lactis R3 can improve growth indicators such as weight growth rate, specific growth rate and feed efficiency of large yellow croaker, thereby improving growth performance. Figure 6 As shown, Lactococcus lactis R3 reduced the bacterial load in the liver, spleen and intestine of large yellow croaker after infection with Pseudomonas proteus, thereby improving the survival rate after infection.

[0042] The principles and implementation methods of the present invention are described in this article using specific examples. The description of the above embodiments is only used to help understand the method and core ideas of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made to the present invention without departing from the principles of the present invention, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. A strain of Lactococcus lactis R3, characterized in that: The strain is classified and named Lactococcus lactis R3, and was deposited in the China Center for Type Culture Collection on October 21, 2024, with the deposit number CCTCC M20242278.

2. The Lactococcus lactis R3 according to claim 1, characterized in that: The lactococcus lactis R3 has an inhibitory effect on Pseudomonas aeruginosa, Aeromonas hydrophila, Escherichia coli, Vibrio parahaemolyticus and Vibrio alginolyticus.

3. A feed additive, characterized in that: The feed additive comprises the bacterial body and fermentation liquid of Lactococcus lactis R3 according to claim 1.

4. The feed additive according to claim 3, characterized in that: The steps for preparing the bacterial cells and fermentation liquid of Lactococcus lactis R3 are as follows: Lactococcus lactis R3 was inoculated into MRS liquid medium and activated at 37°C for 12 h to obtain seed liquid; The seed liquid was transferred to a new MRS liquid culture medium at an inoculation rate of 1 vol%, and the culture was statically fermented at 37°C for 24 h. The culture was centrifuged at 5500 rpm for 10 min. The collected precipitate was the bacteria of Lactococcus lactis R3, and the collected supernatant was the fermentation broth of Lactococcus lactis R3.

5. The feed additive according to claim 3, characterized in that: When used, add the fermentation liquid of Lactococcus lactis R3 to the cells of Lactococcus lactis R3 and adjust the concentration to 3×10 9 CFU / mL is the feed additive.

6. Use of the feed additive according to claim 3 in biological control preparations for preventing and controlling aquatic diseases or in large yellow croaker feed.

Images