Application of water bear secretory protein engineered modified stem cells to improvement of repair promotion of cells under complex cell resistance conditions

Abstract

The invention belongs to the field of medicines, and provides application of water bear secretory protein engineered modified stem cells to improvement of repair promotion under complex cell resistance conditions. According to the present invention, the effective transfection of the adipose-derived mesenchymal stem cells (ADSC) is achieved through the liposome transfection, such that the influence caused by the severe environment can be significantly resisted. Experiments prove that the adipose-derived stem cells capable of expressing the CAHS protein have high survival rate in the environment of ultraviolet radiation, resuscitation after freezing or dehydration, and further analysis finds that cell supernatant secreted by the adipose-derived stem cells can promote angiogenesis, cell proliferation, migration and the like of endothelial cells, reduce the content of active oxygen and effectively support wound healing.

Description

Technical Field

[0001] The invention belongs to the field of medicine, and specifically relates to the application of engineering modified stem cells with tardigrade secretory proteins to improve the resistance of cells to promote repair under complex conditions. Background Art

[0002] Tardigrades are micro-arthropods and are the common name for tardigrades. They are one of the most resilient creatures in the world, and can resist drought, heat, cold, pressure, radiation, and even vacuum. Scientists speculate that the reason why tardigrades can survive tenaciously is that there may be some special proteins in their bodies. Studies have found three specific protein families of tardigrades - Cytoplasmic abundant heat-soluble (CAHS) proteins, Mitochondrial abundant heat-soluble (MAHS) proteins, and Secretory abundant heat-soluble (SAHS) proteins. When in a dry environment, CAHS proteins can form cytoplasmic fiber condensates, which may enable tardigrades to adapt to extreme environments.

[0003] In recent decades, the application of mesenchymal stem cells (MSCs) in the biomedical field has attracted more and more attention. Adipose-derived stem cells (ADSCs), like other types of stem cell family members, have strong self-replication and multidirectional differentiation potential, and do not express significant tissue compatibility complexes and immunostimulatory molecules, so they have low adverse reactions and ectopic risks. At the same time, the "difficult to transfect" characteristics of ADSCs significantly limit their effective and safe reprogramming. Therefore, most previous studies are based on wild-type cells as therapeutic agents. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of engineering modified stem cells with tardigrade secretory proteins to enhance the resistance of cells to repair under complex conditions.

[0005] The present invention improves and develops various engineering strategies to increase the transfection efficiency of adipose-derived stem cells, thereby enhancing their protein production capacity and enabling them to truly exert better therapeutic effects. Specifically, the present invention can enhance tissue engineering and regeneration by in vitro transfection of adipose-derived mesenchymal stem cells with water bear cytoplasm-rich heat-soluble proteins, thereby making them more adaptable to extreme environments. Figure 6-8The results showed that adipose stem cells expressing tardigrade protein under ultraviolet irradiation, freezing and resuscitation or dehydration environment had a higher survival rate and were more resistant to the effects of external conditions.

[0006] Stem Cells

[0007] The present invention provides a stem cell, wherein the stem cell contains, expresses and / or secretes cytoplasmic-abundant heat-soluble protein (CAHS) secreted by tardigrades.

[0008] In some embodiments, the stem cell is selected from adult stem cells, mesenchymal stem cells, umbilical cord blood stem cells, hematopoietic stem cells, neural stem cells, adipose stem cells, skin stem cells or muscle stem cells. In some specific embodiments, the stem cell is adipose stem cell.

[0009] In some embodiments, the stem cells are isolated from cord blood, umbilical cord, placenta, adipose tissue, skin, neural tissue, bone marrow, etc.

[0010] In some embodiments, the amino acid sequence of the cytoplasmic abundant thermosoluble protein is as shown in SEQ ID NO:1.

[0011] In some embodiments, the stem cell contains ribonucleic acid that can be converted to obtain cytoplasmic abundant thermosoluble protein. In some embodiments, the ribonucleic acid is mRNA. In some specific embodiments, the sequence of the mRNA is shown in SEQ ID NO:2.

[0012] MPYEKHVEQT VVEKTEQPGH SSTHHAPAQR TVAREQEEVV HKEFTHTDIR VPHIDAPPPIIAASAVGLAE EIVSHGFQAS AARISGASTE VDMRPSPKLA EEARRDAERY QKEHEMINRQ AEATLQKKAEEYRHQTEAEA EKIRRELEKQ HERDIQFRKD LIDQTIEKQK REVDLEAKMA KRELDREAQL AKEALERSRMATNVEVTLDT AAGHTVSGGT TVSSVDKVET VRERKHH

[0013] SEQ ID NO:1

[0014] ATGCCCTACGAGAAGCACGTGGAGCAGACCGTGGTGGAGAAGACCGAGCAGCCCGGCCAC

[0015] AGCAGCACCCACCACGCCCCCGCCCAGAGGACCGTGGCCAGGGAGCAGGAGGAGGTGGTG

[0016] CACAAGGAGTTCACCCACACCGACATCAGGGTGCCCCACATCGACGCCCCCCCCCCATC

[0017] ATCGCCGCCAGCGCCGTGGGCCTGGCGAGGGATCGTGAGCCACGGCTTCCAGGCCAGC

[0018] GCCGCCAGGATCAGCGGCGCCAGCACCGAGGTGGACATGAGGCCCAGCCCCAAGCTGGCC

[0019] GAGGAGGCCAGGAGGGACGCCGAGAGGTACCAGAAGGAGCACGAGATGATCAACAGGCAG

[0020] GCCGAGGCCACCCTGCAGAAAGAGGCCGAGGAGTACAGGCACCAGACCGAGGCCGAGGCC

[0021] GAGAAGTCAGGAGGGAGCTGGAGAAGCAGCACGAGAGGGACATCCAGTTCAGGAAGGAC

[0022] CTGATCGACCAGACCATCGAGAAGCAGAAGGGGAGGTGGACCTGGAGGCCAAGATGGCC

[0023] AAGAGGGAGCTGGACAGGGAGGCCCAGCTGGCCAAGGAGGCCCTGGAGAGGAGCAGGATG

[0024] GCCACCAACGTGGAGGTGACCCTGGACACCGCCGCCGGCCACACCGTGAGCGGCGGCACC

[0025] ACCGTGAGCAGCGTGGACAAGGTGGAGACCGTGAGGGAGAGGAAGCACCAC

[0026] SEQ ID NO:2

[0027] In some embodiments, the mRNA is introduced into the stem cell by viral transfection, liposome transfection, electrotransfer, gene editing or mRNA transfection. In some embodiments, the mRNA is introduced into the stem cell by liposome transfection.

[0028] The present invention also provides a method for preparing the stem cells, which comprises the following steps:

[0029] (1) preparing liposomes loaded with cytoplasmic abundant thermosoluble protein mRNA;

[0030] (2) Co-culturing the liposomes and stem cells.

[0031] In some embodiments, in the co-culture, the concentration of the liposomes loaded with cytoplasmic abundant thermosoluble protein mRNA is 0.096-0.48 mg / mL. In some embodiments, the concentration of the liposomes loaded with cytoplasmic abundant thermosoluble protein mRNA is 0.096-0.24 mg / mL. In some specific embodiments, the concentration of the liposomes loaded with cytoplasmic abundant thermosoluble protein mRNA is 0.192 mg / mL.

[0032] The present invention also provides an exosome or stem cell supernatant, wherein the exosome or stem cell supernatant is obtained after culturing the stem cells. In some embodiments, the culturing is for 1 to 48 hours.

[0033] Stem cells are defined as the organizational units of biological systems responsible for the development and regeneration of organs and tissues, and are an indispensable tool in advanced tissue engineering and cell therapy. Previous studies have confirmed that adipose-derived stem cells (ADSCs) have the functions of autocrine, paracrine, and proliferation to promote immune regulation, angiogenesis, and fibrosis. At the same time, they are relatively easy to obtain and are available in considerable quantities. Therefore, among adult stem cells, adipose tissue stem cells appear to be the most promising cell type. However, it also places higher requirements on the protein secretion capacity of ADSCs.

[0034] The present invention uses liposome transfection to enable ADSC to secrete proteins persistently, and the extracellular vesicles or stem cell supernatant secreted by ADSC cells after transfection can effectively promote angiogenesis, cell proliferation and migration, and reduce inflammation, so as to further and better serve as clinical therapeutic drugs. Fig. 9 and Fig.10The results showed that compared with the control group (ADSCs not transfected with cytoplasmic abundant thermosoluble proteins), the cell supernatant secreted by ADSC-WB transfected with cytoplasmic abundant thermosoluble proteins significantly promoted the migration and tube formation of HUVEC cells (endothelial cell line). At the same time, hyperglycemia, which is a hallmark of diabetes, produces high concentrations of reactive oxygen species (ROS), which can cause damage to normal cells and tissues, leading to persistent inflammation. According to the experimental results taken under confocal fluorescence microscopy (Examples 11, 12 and Fig.12 , 13 ), the cell supernatant secreted by ADSC-WB can maintain the normal mitochondrial membrane potential of HaCaT cells in the oxidative stress model and reduce cell apoptosis; at the same time, it can reduce the content of reactive oxygen in HaCaT cells in the oxidative stress model, reduce cellular oxidative stress and maintain a healthy state.

[0035] Liposomes

[0036] In some embodiments, the liposome comprises a carrier and the ribonucleic acid delivered within the carrier, wherein the carrier comprises a spherical cationic lipid and a negatively charged phospholipid.

[0037] In some embodiments, the cationic lipid is selected from DOTAP, DOTMA. In some embodiments, the cationic lipid is DOTAP.

[0038] In some embodiments, the negatively charged phospholipids include "glycerophospholipids" and "sphingomyelins", and their sources involve "natural", "semi-synthetic" and "fully synthetic", and the types involved include but are not limited to phosphatidic acid (PA), phosphatidylcholine (PC), phosphatidylglycerol (PG), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS). Specifically, soybean lecithin, egg yolk lecithin, egg yolk phosphatidylglycerol (EPG), hydrogenated soybean lecithin, hydrogenated egg yolk lecithin, dilauroyl phosphatidylcholine (DLPC), dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylcholine (DOPC), 1-palmitoyl-2-oleoyl phosphatidylcholine (POPC), dilinoleoyl phosphatidylcholine, dilauroyl phosphatidylglycerol (DLPG), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG), distearoylphosphatidylglycerol (DSPG), dierucoylphosphatidylglycerol (DEPG), dilinoleoylphosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), 1-palmitoyl-2-oleoylphosphatidylglycerol (POPG), dilauroylphosphatidylethanolamine (DLPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), distearoylphosphatidylethanolamine (DSPE), dioleoylphosphatidylethanolamine (DOPG), PE), dilinoleoylphosphatidylethanolamine, 1-palmitoyl-2-oleoylphosphatidylethanolamine (POPE), dilauroylphosphatidylinositol (DLPI), dipalmitoylphosphatidylinositol (DPPI), distearoylphosphatidylinositol (DSPI), dimyristoylphosphatidylinositol (DMPI), dioleoylphosphatidylinositol (DOPI), 1-palmitoyl-2-oleoylphosphatidylinositol (POPI), dilinoleoylphosphatidylinositol, dilauroylphosphatidylserine (DLPS), dimyristoylphosphatidylserine (DM In one embodiment, the phospholipid is 1-palmitoyl-2-oleoylphosphatidylserine (POPS), dilauroyl sphingomyelin, dilinoleoyl sphingomyelin, dimyristoyl sphingomyelin, dioleoyl sphingomyelin, dipalmitoyl sphingomyelin, distearoyl sphingomyelin, 1-palmitoyl-2-oleoyl sphingomyelin, egg sphingomyelin (ESM). In a specific embodiment, the phospholipid is 1-palmitoyl-2-oleoyl phosphatidylserine (POPS).

[0039] In some embodiments, the molar ratio of the cationic lipid to the negatively charged phospholipid is 10:0 to 0:10. In some embodiments, the molar ratio of the cationic lipid to the negatively charged phospholipid is 9:1 to 6:4. In some specific embodiments, the molar ratio of the cationic lipid to the negatively charged phospholipid is 7:3.

[0040] The present invention also provides a method for preparing the liposome, comprising the following steps:

[0041] (1-1) Weighing cationic lipids and negatively charged phospholipids, dissolving them in a certain amount of organic solvent, and mixing them in a molar ratio, and then rotary evaporating to obtain a uniform liposome film;

[0042] (1-2) mixing the mRNA RNase-free aqueous solution system with the liposome film to obtain a mixture;

[0043] (1-3) The mixture is sonicated to form a liposome / mRNA complex, i.e., the liposome loaded with the cytoplasmic abundant thermosoluble protein mRNA.

[0044] In some embodiments, the total liposome material to mRNA mass ratio (g / g) in the mixture in step (1-2) is 0.37-37 g / g. In some embodiments, the total liposome material to mRNA mass ratio (g / g) in the mixture is 0.444-35.556 g / g. In some embodiments, the mass ratio (g / g) is 0.889-26.667 g / g. In some embodiments, the total liposome material to nucleic acid mass ratio (g / g) is 7.111 g / g.

[0045] The present invention also provides a nucleic acid delivery system, which includes a vector and ribonucleic acid delivered in the vector, wherein the delivered ribonucleic acid is selected from the ribonucleic acid of cytoplasmic abundant thermosoluble protein, and in some embodiments, the ribonucleic acid is the mRNA of cytoplasmic abundant thermosoluble protein.

[0046] The liposomes used in the present invention contain an effective dose of cationic lipid DOTAP and negatively charged phospholipid POPS. The use of the liposomes can effectively transfect ADSC cells, improve the transfection efficiency of cells, and further deliver Waterbear mRNA into ADSC cells. Figure 1 The results showed that at the cellular level, DOTAP / POPS-Waterbear mRNA has low cytotoxicity and high safety; Figure 2 and Figure 3 The results showed that the liposomes of the present invention can effectively transfect 293T cells and ADSC cells, and achieve efficient delivery of EGFP mRNA.

[0047] The present invention provides a pharmaceutical composition, which comprises the stem cells, the exosomes or stem cell supernatant, and the nucleic acid delivery system.

[0048] The present invention provides use of the stem cells, the exosomes or stem cell supernatant, the nucleic acid delivery system or the pharmaceutical composition in preparing drugs for treating diseases.

[0049] In some embodiments, the use includes use in the preparation of a medicament for promoting endothelial cell migration.

[0050] In some embodiments, the use includes use in the preparation of a medicament for promoting endothelial cell angiogenesis.

[0051] In some embodiments, the use comprises use in a medicament for promoting wound healing.

[0052] The present invention also provides a kit comprising the stem cells, the exosomes or stem cell supernatant, the nucleic acid delivery system or the pharmaceutical composition.

[0053] Aiming at the difficulty of transfection of adipose stem cells, the present invention provides a liposome that can effectively improve the efficiency of cell transfection and a preparation method thereof. Through experimental verification, when the concentration of the liposome is 0.096, 0.144, 0.192, and 0.24 mg / mL, the cell survival rate is above 90% on average, with no obvious cytotoxicity, and can effectively improve the transfection efficiency of 293T and ADSC cells, and achieve effective transfection of mRNA.

[0054] On this basis, the present invention transfects the mRNA of cytoplasmic-abundant heat-soluble (CAHS) secreted by tardigrades into adipose stem cells through liposomes for the first time. The liposomes engulfed by the cells can achieve lysosomal escape and release the mRNA in the liposomes into the cytoplasm, thereby achieving the successful expression of cytoplasmic-abundant heat-soluble proteins. It was unexpectedly found that compared with wild-type adipose stem cells, the survival rate of ADSC-WB cells expressing water bear protein after sucrose dehydration was significantly higher than that of the control group, and the survival rate after ultraviolet irradiation, freezing under different conditions and then resuscitation was also significantly higher than that of the control group, indicating that cells transfected with Waterbear mRNA are more resistant to the influence of external conditions, providing a new idea for subsequent cell therapy. Moreover, the present invention unexpectedly discovered that ADSC-WB cell supernatant can significantly promote endothelial cell migration, promote endothelial cell angiogenesis, and improve the cell survival rate of HUVEC cells treated with H2O2. It has a strong in vitro antioxidant capacity, and can also reduce the production of reactive oxygen species in HaCaT cells, reduce cellular oxidative stress and cell apoptosis, maintain normal mitochondrial membrane potential, and thus promote subsequent wound healing. It can be used as a therapeutic agent for chronic wound healing, and has achieved unexpected technical effects.

[0055] the term

[0056] Unless otherwise specified in the present invention,

[0057] "HaCaT" refers to human immortalized epidermal cells.

[0058] “ADSC” refers to human adipose-derived mesenchymal stem cells.

[0059] "Waterbear" is a common name for organisms in the phylum Tardigrades.

[0060] "Waterbear mRNA" refers to the mRNA sequence of a cytoplasmic-abundant heat-soluble protein (CAHS) secreted by tardigrades.

[0061] "DOTAP / POPS-Waterbear mRNA" refers to liposomes containing Waterbear mRNA.

[0062] "PBS" refers to phosphate buffered saline.

[0063] “OD value” refers to the absorbance value detected by an enzyme-labeled instrument.

[0064] "CCK-8" refers to a highly sensitive detection reagent based on the small molecule WST-8, which is widely used for rapid detection of cell proliferation and cytotoxicity.

[0065] "HUVEC" refers to human umbilical vein endothelial cells.

[0066] "Dihydrofluorescein diacetate" refers to a ROS probe, which is a fluorescent probe used to measure oxidative stress in cell-free systems and cell models.

[0067] "JC-1" is an ideal fluorescent probe widely used to detect mitochondrial membrane potential. JC-1 dye accumulates in mitochondria in a potential-dependent manner and can be used to detect the mitochondrial membrane potential of cells, tissues or purified mitochondria. In normal mitochondria, JC-1 aggregates in the mitochondrial matrix to form polymers, which emit strong red fluorescence (Ex=585nm, Em=590nm). When the mitochondrial membrane potential is low, JC-1 cannot aggregate in the mitochondrial matrix and produces green fluorescence (Ex=514nm, Em=529nm).

[0068] "Hoechst 33342" is a blue fluorescent dye that can penetrate the cell membrane. It releases strong blue fluorescence after embedding into double-stranded DNA and has low toxicity to cells. Hoechst 33342 is often used for apoptosis detection. After staining, it is observed with a fluorescence microscope or detected by flow cytometry. It can also be used for ordinary cell nucleus staining or conventional DNA staining.

[0069] "FBS" refers to fetal bovine serum.

[0070] "DMEM" refers to a basic culture medium widely used in the field of cell culture.

[0071] "min" refers to the time in minutes. "h" refers to the time in hours.

[0072] "rpm" is the abbreviation of Revolutions Per Minute, which means the number of rotations of the device per minute. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 To evaluate the cellular safety of DOTAP / POPS liposomes in vitro.

[0074] Figure 2 The EGFP fluorescence expression of 293T cells in different drug-treated groups after 24 hours in vitro.

[0075] Figure 3 This is the EGFP fluorescence expression of ADSC cells in different drug-treated groups after 24 hours in vitro.

[0076] Figure 4 The uptake of liposomes by ADSC cells at different time points (1, 2, 4, 6h).

[0077] Figure 5 Proliferation staining images of different groups of cells, proliferating cells (green), cell nuclei (blue).

[0078] Figure 6 Live cell staining images and corresponding quantitative data after cells were exposed to UV light for different time periods (0, 30, 60s).

[0079] Figure 7 Live cell staining images and corresponding quantitative data after cells were dehydrated with sucrose.

[0080] Figure 8 Live (green) / dead (red) staining images of cells after they were frozen and revived under different conditions.

[0081] Fig. 9 The photos and corresponding quantitative data of cell migration at different time points (0, 4, 8, 12h) are shown.

[0082] Fig.10 The photos and corresponding quantitative data of HUVEC cell angiogenesis at 6 hours.

[0083] Fig.11 Cell viability of HUVEC cells treated with H2O2.

[0084] Fig.12 Images of ROS probes in cells after establishing an oxidative stress model and incubating with different cell supernatants.

[0085] Fig.13 The JC-1 probe images of cells incubated with different cell supernatants after establishing an oxidative stress model. DETAILED DESCRIPTION

[0086] The embodiments of the present invention will be described clearly and completely below in conjunction with the examples. Obviously, the described examples are only some examples of the present invention, rather than all examples. The following description of at least one exemplary embodiment is actually only illustrative and is by no means intended to limit the present invention and its application or use. Based on the examples in the present invention, all other examples obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention.

[0087] Example 1: Synthesis of liposomes

[0088] 1. Experimental Methods

[0089] Preparation process: Preparation of liposomes by thin film ultrasound. Weigh cationic lipids (DOTAP) and negatively charged phospholipids (POPS) and dissolve them in a certain amount of chloroform, mix them in a molar ratio of 7:3, and make the total mass of lipids 96μg. Use a rotary evaporator to remove the organic solvent until a uniform film is formed on the chicken heart bottle. Take 13.5μL Waterbear mRNA (1mg / mL) (sequence as shown in SEQ ID NO:2) and dissolve it in 486.5μL RNase-free water. After mixing, add it to the rotary evaporated chicken heart bottle, and ultrasonicate it in an ultrasonicator for 5min to make the total concentration of liposomes 0.192mg / mL, and finally form the prepared DOTAP / POPS-WaterbearmRNA liposomes. Dilute the prepared liposome solution to an appropriate multiple, and determine its average particle size and Zeta potential on a Zeta particle size distribution instrument using dynamic light scattering.

[0090] (1) The experimental results are shown in Table 1, indicating that the obtained DOTAP / POPS and DOTAP / POPS-Waterbear mRNA liposomes have good particle size and potential characteristics.

[0091] Table 1 Particle size and potential characterization of DOTAP / POPS and DOTAP / POPS-Waterbear mRNA liposomes

[0092]

[0093] Example 2: In vitro evaluation of the cellular safety of DOTAP / POPS liposomes

[0094] (1) Experimental methods:

[0095] ① Cell seeding. ADSC cells were cultured in mesenchymal stem cell culture medium in the presence of 10% FBS and 1% double antibody. The seeding density in a 96-well plate was 5×10 4 The culture plate was incubated in an incubator for 24 h (37° C., 5% CO 2 ).

[0096] ② Liposome preparation: Weigh lipids DOTAP and POPS separately, dissolve each in a certain amount of chloroform, mix at a molar ratio of 7:3, and use a rotary evaporator to remove the organic solvent until a uniform film is formed on the heart-shaped bottle. Add RNase-free water and sonicate in an ultrasonicator for 5 minutes to make the concentration of the liposome after mixing 2.88 mg / mL. The liposome particles were diluted 6 times with a mesenchymal stem cell culture medium containing 10% FBS and 1% double antibody to obtain a dilution with a concentration of 0.48 mg / mL, and then the dilution was further diluted with the culture medium to 0.7, 0.6, 0.5, 0.4, 0.3, and 0.2 times the original concentration, that is, the concentrations of the liposomes were 0.336, 0.288, 0.24, 0.192, 0.144, and 0.096 mg / mL, respectively. The control group was a commercially available transfection reagent PolyFast with different volumes (the recommended usage ratio of DNA / RNA (μg): PolyFast transfection reagent (μL) is 1:3, and the normal usage of the transfection reagent is 5-10 μL).

[0097] ③Cell survival rate. Adipose-derived stem cells were exposed to complete culture medium with different concentrations of DOTAP / POPS lipid solution for 24 hours. Subsequently, the original culture medium was removed, and 110 μL of CCK-8 solution diluted with a culture medium volume ratio of 10:1 was added to each well. The culture plate was incubated in an incubator for 2 hours, and the absorbance OD value at 450 nm was measured with an ELISA reader, and the cell viability was calculated according to the formula.

[0098] (2) Experimental results: Figure 1 The results of in vitro evaluation of the cell safety of DOTAP / POPS liposomes. Figure 1 It can be seen that the liposomes formed by mixing DOTAP and POPS at a molar ratio of 7:3 have low cytotoxicity when the concentration is 0.096-0.336 mg / mL. When the liposome concentration is 0.096, 0.144, 0.192, and 0.24 mg / mL, the cell survival rate is above 90% on average, with no obvious cytotoxicity. The control group is a commercially available transfection reagent with poor safety.

[0099] Example 3: Evaluation of the effect of nanoparticles constructed with different delivery systems on transfection efficacy

[0100] (1) Experimental methods

[0101] ① Cell seeding. 293T cells were cultured in DMEM medium in the presence of 10% FBS and 1% double antibody. Adipose-derived stem cells (ADSCs) were cultured in mesenchymal stem cell medium in the presence of 10% FBS and 1% double antibody. The seeding density in a 96-well plate was 5×10 4 The culture plate was incubated in an incubator for 24 h (37° C., 5% CO 2 ).

[0102] ② Liposome preparation

[0103] Thin film ultrasound method: Weigh lipids DOTAP and POPS separately, dissolve each in a certain amount of chloroform, mix at a molar ratio of 7:3, and use a rotary evaporator to remove the organic solvent until a uniform film is formed on the chicken heart bottle. Take 13.5μL of enhanced green fluorescent protein (Enhanced Green Fluorescent Protein) EGFP mRNA (1mg / mL) and dissolve it in 486.5μL of RNase-free water, mix well, add it to the rotary evaporated chicken heart bottle, and ultrasonicate it in an ultrasound machine for 5 minutes to finally form the prepared DOTAP / POPS-EGFP mRNA liposomes.

[0104] Microfluidics method: weigh appropriate amounts of DLin-MC3, DSPC, and DSPE-PEG 2000 and CHOL were mixed and dissolved in anhydrous ethanol at a ratio of 50:10:1.5:38.5, respectively, so that the concentration of all lipids in ethanol was 12mM. EGFP mRNA (1mg / mL) was dissolved in sodium citrate buffer at pH=4 to form a 0.108mg / mL solution, which was the aqueous phase. The volume ratio of the ethanol phase to the aqueous phase was 1:3. The two phases were quickly mixed at a flow rate of 1:3 using a microfluidic device. The mixed product was diluted with PBS to prevent the lipids from dissolving in ethanol, and then placed in a 30kD ultrafiltration tube. The ethanol was removed by centrifugation in a low-temperature high-speed centrifuge to finally obtain LNP-EGFP mRNA.

[0105] ③ Detect fluorescence intensity. Add the prepared DOTAP / POPS-EGFP mRNA and LNP-EGFP mRNA to the cultured cells, and set up a positive control. Set up 3 replicate wells for each experimental group. Continue to culture in a cell culture incubator for 24 hours. Use an ELISA reader (excitation 470nm, emission 510nm) to detect the fluorescence intensity of EGFP expressed by cells.

[0106] Table 2 Components of different groups

[0107] Group Components Control Blank Group LNP LNP-EGFP mRNA 7：3 DOTAP / POPS-EGFP mRNA Positive Control PolyFast Transfection Reagent

[0108] (2) Experimental results: Figure 2 This is the EGFP fluorescence expression of 293T cells in different drug-administered groups after 24 h in vitro; Figure 3 The EGFP fluorescence expression of ADSC cells in different drug-treated groups after 24 hours in vitro. Figure 2 It can be seen that the preparation prepared by thin film ultrasound method can achieve more effective transfection of EGFP in 293T cells and has the highest fluorescence transfection efficiency among all groups; Figure 3It can be seen that green fluorescence is almost undetectable in ADSC cells using lipid nanoparticles prepared by microfluidics, while the fluorescence intensity of the group prepared by thin film ultrasound is significantly improved, achieving effective transfection of EGFP mRNA.

[0109] Example 4: Confocal imaging of ADSC cell uptake

[0110] (1) Experimental methods:

[0111] ① Cell seeding plate. ADSC cells were cultured in mesenchymal stem cell culture medium in the presence of 10% FBS and 1% double antibody. The seeding density in the confocal dish was 5×10 4 The confocal dish was incubated in an incubator for 24 h (37° C., 5% CO 2 ).

[0112] ②Using the lipid-soluble Cy3-labeled liposome bilayer and the water-soluble Flu dye-labeled liposome aqueous phase, DOTAP / POPS (M / M 7:3) blank liposomes (without mRNA) were prepared by thin-film ultrasound. They were added to the cultured cells and cultured for 1, 2, 4, and 6 hours, and finally the cell nuclei were stained with Hoechst 33342.

[0113] (2) Experimental results: Figure 4 The uptake of liposomes by ADSC cells at different time points (1, 2, 4 and 6h). The blue fluorescence in the figure is the cell nucleus stained with Hoechst, the green fluorescence represents the aqueous phase in the liposomes labeled with flu, and the red fluorescence represents the liposome bilayer labeled with Cy3. The red fluorescence expression in the cytoplasm is enhanced at 1-2h, and the red fluorescence around the cell nucleus can be clearly observed at 2h and 4h, indicating that the liposomes can enter the cell with the phagocytosis of the cell. Normal free flu will not enter the cell. The area of ​​green fluorescence at 1h and 2h is smaller than that of red fluorescence. The increase in green fluorescence intensity lags behind that of red fluorescence. The green fluorescence expression in the cytoplasm is the strongest at 4h, indicating that the liposomes engulfed by the cells can achieve lysosomal escape and release substances in the aqueous phase in the liposomes into the cytoplasm. The green fluorescence in the cytoplasm comes from the aqueous phase in the liposomes that are internalized by the cells.

[0114] Example 5: Confocal imaging of cell proliferation after ADSC transfection

[0115] (1) Experimental groups: ADSC group (not transfected with Waterbear mRNA) and ADSC-WB group (transfected with Waterbear mRNA).

[0116] (2) Experimental methods

[0117] ① Cell seeding plate. ADSC cells were cultured in mesenchymal stem cell culture medium in the presence of 10% FBS and 1% double antibody. The seeding density in the confocal dish was 5×10 4 The confocal dish was incubated in an incubator for 24 h (37° C., 5% CO 2 ).

[0118] ② Cell transfection. Preparation of liposomes by thin film ultrasound. Weigh DOTAP and POPS and dissolve them in a certain amount of chloroform. Mix them in a molar ratio of 7:3 to make the total mass of lipids 96μg. Use a rotary evaporator to remove the organic solvent until a uniform thin film is formed on the chicken heart bottle. Take 13.5μL Waterbear mRNA (1mg / mL) and dissolve it in 486.5μL RNase-free water. After mixing, add it to the rotary evaporated chicken heart bottle, and ultrasonicate it in an ultrasonicator for 5 minutes to finally form the prepared DOTAP / POPS-Waterbear mRNA solution. Add the prepared DOTAP / POPS-Waterbear mRNA to the above-mentioned cultured cells and continue to culture them in a cell culture incubator for 24 hours.

[0119] ③Detect cell proliferation.

[0120] a. Follow BeyoClick TM EdU-488 instruction manual: Use complete culture medium to dilute EdU (10mM) 1:500 to prepare 2× EdU (20μM) working solution, add an equal volume to the confocal dish and continue incubation for 2h to make the final EdU concentration in the dish become 1× (10μM).

[0121] b. After EdU labeling, remove the culture medium and add 1 mL of fixative solution for 15 min at room temperature. Remove the fixative solution and wash the cells 3 times with 1 mL of PBS per well, 3-5 min each time.

[0122] c. Remove the washing solution, use 1 mL of permeabilization solution (0.3% TritonX-100 in PBS) per well, and incubate at room temperature for 10-15 min. Remove the permeabilization solution, and wash the cells 1-2 times with 1 mL of PBS per well, each time for 3-5 min.

[0123] d. Follow BeyoClick TM Prepare Click reaction solution according to the EdU-488 instruction manual.

[0124] e. Remove the washing solution from the previous step, add 0.5 mL of Click reaction solution to each well, shake gently to ensure that the reaction mixture can evenly cover the cells. Incubate at room temperature in the dark for 30 minutes.

[0125] f. Remove the Click reaction solution and wash with PBS for 3 times, 3-5 min each time. Finally, use Hoechst 33342 to stain the cell nucleus.

[0126] (3) Experimental results: Figure 5 The proliferation staining images of different groups of cells are shown, including proliferating cells (green) and cell nuclei (blue). During DNA synthesis, EdU can replace thymidine deoxynucleoside and be incorporated into newly synthesized DNA, thereby detecting cell proliferation. Figure 5 It can be seen that the green fluorescence signal of new proliferation in the ADSC-WB group (transfected with Waterbear mRNA) was significantly increased compared with the ADSC group (not transfected with Waterbear mRNA), indicating that cells transfected with Waterbear mRNA can better promote their proliferation.

[0127] Example 6: Confocal imaging of the anti-UV and anti-dehydration status of ADSC-transfected cells

[0128] (1) Experimental groups: ADSC group (not transfected with Waterbear mRNA) and ADSC-WB group (transfected with Waterbear mRNA).

[0129] (2) Experimental methods

[0130] ① Cell seeding plate. ADSC cells were cultured in mesenchymal stem cell culture medium in the presence of 10% FBS and 1% double antibody. The seeding density in the confocal dish was 5×10 4 The confocal dish was incubated in an incubator for 24 h (37° C., 5% CO 2 ).

[0131] ② Cell transfection. Preparation of liposome nanoparticles by thin film ultrasound. Weigh DOTAP and POPS and dissolve them in a certain amount of chloroform, mix them in a molar ratio of 7:3, so that the total mass of lipids is 96μg, and use a rotary evaporator to remove the organic solvent until a uniform thin film is formed on the chicken heart bottle. Take 13.5μL Waterbear mRNA (1mg / mL) and dissolve it in 486.5μL RNase-free water. After mixing, add it to the rotary evaporated chicken heart bottle, and ultrasonicate it in an ultrasonicator for 5min to finally form the prepared DOTAP / POPS-Waterbear mRNA solution. Add the prepared DOTAP / POPS-Waterbear mRNA to the above-mentioned cultured cells and continue to culture them in a cell culture incubator for 24h.

[0132] ③ Cell anti-ultraviolet experiment. The culture medium in the dish was removed and replaced with PBS solution after digestion. The confocal dish was irradiated with blue-violet light for 30 or 60 seconds from the top. After standing for a period of time, calcein (AM, 2 μM) was used for staining. After incubation at 37°C for 15 minutes, confocal imaging was used to detect living cells.

[0133] ④ Cell dehydration resistance experiment. Remove the culture medium in the dish, add 1 mL of the prepared 10% sucrose solution, and incubate for 30 minutes. Remove the sucrose solution, add 1 mL of calcein (AM, 2 μM) staining solution to each dish, and incubate at 37°C for 15 minutes. After washing, use confocal imaging to detect living cells.

[0134] (3) Experimental results: Figure 6 Live cell staining images and corresponding quantitative data after cells were irradiated with UV light for different time periods (0, 30, 60s); Figure 7 The live cell staining images and corresponding quantitative data of cells after sucrose dehydration treatment (ADSC group, ADSC-WB group) and without sucrose treatment (control group). Figure 6 and Figure 7 It can be seen that the survival rate of the ADSC-WB group cells after ultraviolet irradiation and sucrose dehydration was significantly higher than that of the ADSC group, indicating that cells transfected with Waterbear mRNA are more resistant to the influence of external conditions.

[0135] Example 7 Confocal imaging of cell freezing and resuscitation survival rate after ADSC transfection

[0136] (1) Experimental groups: ADSC group (not transfected with Waterbear mRNA) and ADSC-WB group (transfected with Waterbear mRNA).

[0137] (2) Experimental methods

[0138] ① Cell seeding. ADSC cells were cultured in mesenchymal stem cell culture medium in the presence of 10% FBS and 1% double antibody. The seeding density in a 6-well plate was 5×10 4 The 6-well plate was incubated in an incubator for 24 h (37° C., 5% CO 2 ).

[0139] ② Cell transfection: Same as Example 6. Culture for 24 hours for later use.

[0140] ③ Cell-encapsulated hydrogels are frozen and then revived.

[0141] Preparation of hydrogel: A high-porosity hydrogel solution with a concentration of 7% was prepared using a freezing medium (freezing medium: 2.5% DMSO+100 mM sucrose in PBS buffer solution), and sterilized by passing through a 0.22 μM microporous filter for later use.

[0142] The ADSC cells of each group were digested with trypsin, centrifuged at 1000 rpm for 5 min, and then resuspended in the prepared hydrogel solution to a cell density of 5 × 10 5 cells / mL, and commercially available serum-free cryopreservation solution was used as a control to cryopreserve cells, which were placed in a gradient cooling cryopreservation box and frozen at -80°C overnight.

[0143] ④ Cell live and dead staining. Take out the frozen cells the next day, shake them in a 37°C water bath to revive, add an equal volume of PBS and centrifuge at 1000rpm for 5 minutes, remove the supernatant, resuspend with PBS and centrifuge again to eliminate the esterase activity in the culture medium. Resuspend the cells in the prepared propidium iodide (PI, 4.5μM) and calcein (AM, 2μM) staining solution and inoculate them in a confocal dish, 1mL of cell suspension per dish, and incubate at 37°C for 15min. Use confocal imaging to detect live cells (yellow-green fluorescence) and dead cells (red fluorescence).

[0144] (3) Experimental results: Figure 8 Live (green) / dead (red) staining images of cells after they were frozen and revived under different conditions; Figure 8 The results showed that the cell survival rate of the ADSC-WB group after cryopreservation under different conditions was better than that of the ADSC group.

[0145] Example 8 Evaluation of scratch test of HUVEC incubated with different cell supernatants at the cellular level

[0146] (1) Experimental groups: ADSC group (ADSC supernatant) and ADSC-WB group (supernatant after ADSC transfection with Waterbear mRNA).

[0147] (2) Experimental methods

[0148] ① Extraction of cell supernatant. The cell seeding and cell transfection are the same as in Example 6. After culturing for 24 hours, the cell supernatant is extracted for use.

[0149] ② Cell scratch test. Use a marker pen to draw three horizontal lines evenly on the back of the 6-well plate with a ruler, approximately one line every 0.5 to 1 cm, across the holes. Take HUVEC cells in good condition, digest them with trypsin, and inoculate them in the 6-well plate. Add about 1×10 5 Cells were cultured overnight in an incubator until the cells grew to 80-90% confluence. A 10 μL sterile pipette tip was used to vertically measure the ruler and scratch the hole as perpendicularly as possible. The cells were rinsed with PBS three times to remove the scratched cells, and the extracted cell supernatant was added to continue culturing for 0, 4, 8, and 12 hours. The migration of cells at specific locations was observed using an inverted microscope and photographed and recorded, and analyzed using Image J software.

[0150] (3) Experimental results: Fig. 9 The following are photos of cell migration at different time points (0, 4, 8, and 12 hours) and the corresponding quantitative data. As shown in the figure, there is little difference between the ADSC group and the initial scratch 4 hours after the scratch, while the cells in the ADSC-WB group clearly cross the scratch; at 8 hours, there is a significant difference between the two groups, indicating that the cell supernatant of the ADSC-WB group has the best effect in promoting endothelial cell migration.

[0151] Example 9 Evaluation of HUVEC tube formation at the cell level by incubation with different cell supernatants

[0152] 1. Experimental groups: ADSC group (ADSC supernatant), ADSC-WB group (supernatant after ADSC transfection with Waterbear mRNA).

[0153] 2. Experimental Methods

[0154] ① Extraction of cell supernatant. The cell seeding and cell transfection were the same as in Example 8. After culturing for 24 hours, the cell supernatant was extracted for use.

[0155] ②Cell tube formation experiment.

[0156] a. Culture of HUVEC cells: HUVEC cells were cultured in DMEM medium containing 10% FBS and 1% double antibody, and the cells were starved one day before the experiment.

[0157] b. Preparation of Matrigel: 1) Place the frozen Matrigel in an ice box one day in advance and put it in a 4°C refrigerator to melt overnight. Pre-cool the consumables (such as gun tips, 1.5mL EP tubes) that will be used. 2) Place the melted Matrigel and pre-cooled consumables in a clean bench the next day. Dilute the Matrigel with blank DMEM culture medium (volume ratio of 1:1). Add 50μL of Matrigel solution to each well of the pre-cooled 96-well plate with the gun tip inserted straight to the bottom to prevent the Matrigel from hanging on the side wall. Gently tap the 96-well plate to make the liquid surface even and flat, and place it in a cell culture incubator for 1 hour.

[0158] c. Use trypsin to digest HUVEC cells, centrifuge at 1000 rpm for 5 min, and then use the supernatant to resuspend the cells and count the cells. After the matrix gel solidifies, gently add about 50 μL of cell suspension to each well of the 96-well plate, so that each well has about 3.0×10 4 Do not use too much force to damage the smooth surface of the matrix gel. Set up 3 replicate wells for each experimental group. Put the 96-well plate with cells into the cell culture incubator for tube formation experiment.

[0159] d. 6 hours after the cells were laid, the image acquisition device was used to directly collect the tube images under bright field. The image J software angioanalyzer was used for image analysis.

[0160] 3. Experimental results: Fig.10 The photos and corresponding quantitative data of HUVEC cell angiogenesis at 6 hours. Compared with the ADSC group, the ADSC-WB group showed a better effect in promoting the angiogenesis of endothelial cells.

[0161] Example 10 Evaluation of the therapeutic effects of different cell supernatant incubation groups after HUVEC established oxidative stress model at the cellular level

[0162] (1) Experimental groups: Normal group (normal cells), Control group (DMEM culture medium), ADSC group (ADSC supernatant), ADSC-WB (supernatant after ADSC transfection with Waterbear mRNA).

[0163] (2) Experimental methods

[0164] ① Cell seeding. HUVEC cells were cultured in DMEM medium in the presence of 10% FBS and 1% double antibody. The seeding density in a 96-well plate was 5×10 4 The culture plate was incubated in an incubator for 24 h (37° C., 5% CO 2 ).

[0165] ②Evaluate cell viability. Remove the culture medium and divide the cells into 4 groups with 6 replicates in each group. Add culture medium containing 300μM H2O2 to each group except the Normal group and continue culturing for 0.5h. After removing the culture medium, add different cell supernatants and incubate for 12h. Then remove the original culture medium, add 110μL CCK-8 solution diluted with a culture medium volume ratio of 10:1 to each well, incubate the culture plate in the incubator for 1h, and measure the absorbance OD value at 450nm with an enzyme marker.

[0166] (3) Experimental results: Fig.11 Cell survival rate of HUVEC cells treated with H2O2. Compared with the Normal group, the OD values ​​of the Control group and the ADSC group were significantly reduced, with survival rates of 35.74% and 57.07%, respectively, and more dead cells were observed under the microscope. The OD value of the ADSC-WB group decreased less, with an average survival rate of 76.27%.

[0167] Example 11 Confocal imaging of the ROS (Reactive Oxygen Species) content in different cell supernatant incubation groups after establishing an oxidative stress model with HaCaT

[0168] (1) Experimental groups: Normal group (normal cells), Control group (DMEM culture medium), ADSC group (ADSC supernatant), and ADSC-WB group (supernatant after ADSC transfection with Waterbear mRNA).

[0169] (2) Experimental methods

[0170] ① Cell seeding. HaCaT cells were cultured in DMEM medium in the presence of 10% FBS and 1% double antibody. The seeding density in the confocal dish was 5×10 4 The confocal dish was incubated in an incubator for 24 h (37° C., 5% CO 2 ).

[0171] ②Evaluate the expression of cellular ROS. Remove the original culture medium from the cells in each group, add 1 mL of culture medium containing 300 μM H2O2 to each group except the Normal group, and continue to culture for 4 hours. After removing the culture medium, add different cell supernatants and incubate for 12 hours. Remove the culture medium, rinse the cells lightly with PBS 3 times, add 1 mL of 5 μM ROS probe solution (Dihydrofluorescein diacetate), incubate for 30 minutes, and then wash the cells lightly with PBS 3 times to remove the unstained probe dye. Finally, use Hoechst 33342 to stain the cell nuclei.

[0172] (3) Experimental results: Fig.12 The ROS probe images of each group of cells after establishing an oxidative stress model and incubating with different cell supernatants. Fig.12 As shown, compared with the Control group, the ROS content in the ADSC-WB group was low, indicating that the supernatant secreted by ADSC-WB can reduce the production of reactive oxygen species in HaCaT cells, reduce cellular oxidative stress and cell apoptosis, and thus promote subsequent wound healing.

[0173] Example 12 Confocal imaging of mitochondrial membrane potential of different cell supernatant incubation groups after establishing an oxidative stress model with HaCaT

[0174] (1) Experimental groups: Normal group (normal cells), Control group (DMEM culture medium), ADSC group (ADSC supernatant), and ADSC-WB group (supernatant after ADSC transfection with Waterbear mRNA).

[0175] (2) Experimental methods

[0176] ① Cell seeding. HaCaT cells were cultured in DMEM medium in the presence of 10% FBS and 1% double antibody. The seeding density in the confocal dish was 5×10 4The confocal dish was incubated in an incubator for 24 h (37° C., 5% CO 2 ).

[0177] ② Evaluate the mitochondrial membrane potential of cells. Remove the original culture medium from each group of cells, add 1 mL of culture medium containing 300 μM H2O2 to each group except the Normal group, and continue to culture for 4 hours. After removing the culture medium, add different cell supernatants and incubate for 12 hours. Remove the culture medium, rinse the cells lightly with PBS 3 times, add 1 mL of 10 μM mitochondrial membrane potential probe solution (JC-1), incubate for 30 minutes, and then wash the cells lightly with PBS 3 times to remove the unstained probe dye. Finally, use Hoechst 33342 to stain the cell nuclei.

[0178] (3) Experimental results: Fig.13 The JC-1 probe images of different cell supernatant incubation groups after establishing an oxidative stress model for each group of cells. JC-1 dye is an ideal fluorescent probe dye widely used to detect mitochondrial membrane potential. In normal mitochondria, JC-1 aggregates in the mitochondrial matrix to form polymers, which emit strong red fluorescence (Ex = 585nm, Em = 590nm); when the mitochondrial membrane potential is low, JC-1 cannot aggregate in the mitochondrial matrix and produces green fluorescence (Ex = 514nm, Em = 529nm). The results are shown in Fig.13 As shown, compared with the Control group, the membrane potential of the ADSC-WB group was normal, indicating that the supernatant secreted by ADSC-WB can maintain the normal membrane potential of mitochondria, reduce cell apoptosis, and promote subsequent wound healing.

[0179] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A stem cell, characterized in that The stem cells contain, express and / or secrete cytoplasmic-abundant heat-soluble protein (CAHS) secreted by tardigrades; Preferably, the stem cells are selected from adult stem cells, mesenchymal stem cells, umbilical cord blood stem cells, hematopoietic stem cells, neural stem cells, adipose stem cells, skin stem cells or muscle stem cells; more preferably, the stem cells are adipose stem cells; Preferably, the amino acid sequence of the cytoplasmic abundant thermosoluble protein is as shown in SEQ ID NO:

1.

2. The stem cell according to claim 1, characterized in that The stem cells contain ribonucleic acid that can be converted into cytoplasmic abundant heat-soluble proteins; Preferably, the ribonucleic acid is mRNA; more preferably, the sequence of the mRNA is as shown in SEQ ID NO: 2; Preferably, the mRNA is introduced into the stem cells by viral transfection, liposome transfection, electrotransfer, gene editing or mRNA transfection; more preferably, the mRNA is introduced into the stem cells by liposome transfection.

3. The stem cell according to claim 2, characterized in that The liposome comprises a carrier and the ribonucleic acid delivered in the carrier, wherein the carrier comprises a spherical cationic lipid and a negatively charged phospholipid; Preferably, the cationic lipid is selected from DOTAP and DOTMA, and more preferably DOTAP; Preferably, the negatively charged phospholipid is selected from phosphatidylserine (PS), more preferably 1-palmitoyl-2-oleoylphosphatidylserine (POPS); Preferably, the molar ratio of the cationic lipid to the negatively charged phospholipid is 10:0 to 0:10, preferably 9:1 to 6:4, and more preferably 7:

3.

4. The method for preparing stem cells according to any one of claims 1 to 3, characterized in that: The preparation method comprises the following steps: (1) preparing liposomes loaded with cytoplasmic abundant thermosoluble protein mRNA; (2) co-culturing the liposomes and stem cells; Preferably, the method for preparing the liposome in step (1) comprises the following steps: (1-1) Weighing cationic lipids and negatively charged phospholipids, dissolving them in a certain amount of organic solvent, and mixing them in a molar ratio, and then rotary evaporating to obtain a uniform liposome film; (1-2) mixing the mRNA RNase-free aqueous solution system with the liposome film to obtain a mixture; (1-3) sonicating the mixture to form a liposome / mRNA complex, i.e., the liposome loaded with the cytoplasmic abundant thermosoluble protein mRNA; Preferably, in the co-culture of step (2), the concentration of the liposomes loaded with the cytoplasmic abundant thermosoluble protein mRNA is 0.096-0.48 mg / mL; preferably 0.096-0.24 mg / mL, and more preferably 0.192 mg / mL.

5. The preparation method according to claim 4, characterized in that: In step (1-1), the cationic lipid is selected from DOTAP and DOTMA, and more preferably DOTAP; Preferably, the negatively charged phospholipid is selected from phosphatidylserine (PS), more preferably 1-palmitoyl-2-oleoylphosphatidylserine (POPS); Preferably, the molar ratio of the cationic lipid to the negatively charged phospholipid is 10:0 to 0:10, preferably 9:1 to 6:4, and more preferably 7:3; and / or The mass ratio (g / g) of total liposome material to mRNA in the mixture in step (1-2) is 0.37-37 g / g, preferably 0.444-35.556 g / g, further preferably 0.889-26.667 g / g, and more preferably, the mass ratio (g / g) of total liposome material to nucleic acid is 7.111 g / g.

6. An exosome or stem cell supernatant, characterized in that: The extracellular vesicles or stem cell supernatant are obtained after culturing the stem cells according to any one of claims 1 to 3; preferably, the culturing is for 1 to 48 hours.

7. A nucleic acid delivery system, characterized in that: The nucleic acid delivery system comprises a vector and ribonucleic acid delivered in the vector, wherein the delivered ribonucleic acid is selected from ribonucleic acid of cytoplasmic abundant heat-soluble protein, preferably mRNA of cytoplasmic abundant heat-soluble protein; Preferably, the carrier comprises spherical cationic lipids and negatively charged phospholipids; More preferably, the cationic lipid is selected from DOTAP and DOTMA, and more preferably DOTAP; the negatively charged phospholipid is selected from phosphatidylserine (PS), and more preferably 1-palmitoyl-2-oleoylphosphatidylserine (POPS); Preferably, the molar ratio of the cationic lipid to the negatively charged phospholipid is 10:0 to 0:10, preferably 9:1 to 6:4, and more preferably 7:

3.

8. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the stem cells according to any one of claims 1 to 3, the extracellular vesicles or stem cell supernatant according to claim 6, or the nucleic acid delivery system according to claim 7.

9. Use of the stem cells according to any one of claims 1 to 3, the exosomes or stem cell supernatant according to claim 6, the nucleic acid delivery system according to claim 7 or the pharmaceutical composition according to claim 8 in the preparation of a drug for treating a disease; Preferably, the use includes use in preparing a drug for promoting endothelial cell migration; Preferably, the use includes use in preparing a drug for promoting endothelial cell angiogenesis; Preferably, the use includes use in a medicament for promoting wound healing.

10. A kit comprising the stem cells according to any one of claims 1 to 3, the exosomes or stem cell supernatant according to claim 6, the nucleic acid delivery system according to claim 7 or the pharmaceutical composition according to claim 8.

Images