Fucoidin oligosaccharide as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological enzymes, and discloses fucoidin as well as a preparation method and application thereof. The preparation method of the fucoidin comprises the following steps: performing enzymolysis on fucoidin by taking alpha-1, 4-endo-fucoidin enzyme expressed by escherichia coli, and performing enzyme deactivation, centrifugation, alcohol precipitation, volatilization, redissolution, impurity removal and drying to obtain the fucoidin. The preparation method of the fucoidin is mild, does not destroy the activity of the product, and can directionally control the molecular weight of the product, so that the homogeneity of the product is high, and meanwhile, the prepared fucoidin is remarkable in antioxidant activity and moisture absorption activity, and has wide application prospects in the aspects of food, cosmetics and medicines.

Description

Technical Field

[0001] The present invention relates to the technical field of bioenzymes, and in particular to a fucoidan oligosaccharide and a preparation method and application thereof. Background Art

[0002] Fucoidan is a polysaccharide extracted from seaweed and is a type of oligosaccharide. It is mainly obtained from fucoidic acid molecules through enzymatic hydrolysis or acid hydrolysis, and has certain biological activities and health functions. Fucoidan is believed to have the benefits of regulating immune function, anti-oxidation, and lowering blood lipids, and is widely used in food, health products, and pharmaceutical products. However, although high-molecular-weight fucoidan has certain biological activities, its application is limited due to its large molecular weight, poor solubility, difficulty in absorption, and low oral bioavailability.

[0003] Fucoidooligosaccharides are generally prepared by chemical hydrolysis, physical degradation, enzymatic hydrolysis, etc. Acid hydrolysis can produce a large amount of products in a short time, but because of its mode of action, it sometimes causes the activity of fucoidooligosaccharides to be destroyed (sulfate groups, branched chain structures, etc.). In recent years, physical methods such as ultrasonic degradation have been used to prepare fucoidooligosaccharides. Although the effect is significant, the preparation cycle is short, the biological activity of the substance will not be destroyed, and no additional substances need to be added, the disadvantage is that the molecular weight of fucoidooligosaccharides cannot be controlled, and the biological activity is closely related to the molecular weight, which increases the uncertainty of the product.

[0004] Therefore, it is urgent to develop a method for preparing fucoidan oligosaccharides with mild conditions, concentrated product molecular weight distribution, and no destruction of the biological activity of the substance. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a fucoidan oligosaccharide and a preparation method and application thereof.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides an α-1,4-endo-fucoidanase, the amino acid sequence of which is shown in SEQ ID No: 3.

[0008] In a second aspect, the present invention provides a nucleic acid encoding α-1,4-endofucoidanase, the nucleotide sequence of which is shown in SEQ ID No:4.

[0009] In a third aspect, the present invention provides a method for preparing fucoidan, comprising the following steps:

[0010] (1) adding the α-1,4-endofucoidanase to the fucoidan solution, and performing enzymolysis to obtain an enzymolysis solution; the enzymolysis conditions are: pH 7-8, temperature 45° C.-55° C., and time 12 h-24 h;

[0011] (2) inactivating the enzyme in the enzymatic hydrolyzate, cooling it to room temperature, centrifuging it, and filtering it to obtain a supernatant 1;

[0012] (3) adding ethanol to the supernatant 1, and centrifuging to obtain supernatant 2 after precipitation is complete;

[0013] (4) completely volatilizing the ethanol in the supernatant 2 to obtain a solid; re-dissolving the solid with deionized water to obtain a supernatant 3;

[0014] (5) The supernatant 3 is dialyzed to remove impurities and freeze-dried to obtain fucoidan oligosaccharides.

[0015] The preparation method adopted by the present invention is mild, environmentally friendly, does not destroy the structure and biological activity of the product, and can control the molecular weight of the product. The molecular weight distribution of the fucoidan product has high concentration, good uniformity, good antioxidant and hygroscopicity, has application value, and can save the subsequent separation process steps to obtain different molecular weights.

[0016] As a preferred embodiment of the method for preparing fucoidan oligosaccharides of the present invention, in step (1): the concentration of the fucoidan solution is 10 g / L-15 g / L; the solvent of the solution is Tris-HCl buffer; and the addition amount of the α-1,4-endo-fucoidan hydrolase is 50-100 U / g fucoidan.

[0017] As a preferred embodiment of the method for preparing fucoidan oligosaccharides of the present invention, in step (1): the method for preparing the α-1,4-endo-fucoidanase is: recombinant Escherichia coli carrying the endo-fucoidan hydrolase gene is inoculated into a liquid culture medium to activate the seed liquid, and then the seed liquid is inoculated into a fermentation medium for fermentation to obtain a crude enzyme liquid.

[0018] The culture conditions of the seed liquid are: temperature 30°C-37°C, time 10h-16h; the conditions of the fermentation culture are: temperature 25°C-30°C, time 12h-24h.

[0019] As a preferred embodiment of the method for preparing fucoidan of the present invention, in step (2): the enzyme inactivation conditions are: 90°C-105°C, 10min-20min; the centrifugation conditions are: temperature 20°C-25°C, rotation speed 8000rpm-10000rpm, time 15min-20min.

[0020] As a preferred embodiment of the method for preparing fucoidan of the present invention, in step (3): the volume ratio of the supernatant 1 to the ethanol is 1:3-5; the temperature during the precipitation is 2°C-8°C; the centrifugal conditions are: temperature 4°C-10°C, rotation speed 8000rpm-10000rpm, time 10min-20min.

[0021] As a preferred embodiment of the method for preparing fucoidan of the present invention, in step (3): the concentration of ethanol is 50%-100%.

[0022] As a preferred embodiment of the method for preparing fucoidan of the present invention, in step (4): the volatilization temperature is 60°C-80°C, and the volatilization time is 1h-3h.

[0023] As a preferred embodiment of the method for preparing fucoidan of the present invention, in step (5): the dialysis adopts a 100Da-400Da dialysis bag; the dialysis conditions are: temperature 2°C-8°C, time 24h-36h.

[0024] In a fourth aspect, the present invention provides a fucoidan oligosaccharide prepared by the above-mentioned preparation method.

[0025] The fucoidan prepared by the present invention has a relatively small molecular weight (such as a number average molecular weight of 497 Da and a weight average molecular weight of 1356 Da), and has significant antioxidant, hygroscopic and moisturizing properties.

[0026] In a fifth aspect, the present invention applies the α-1,4-endo-fucoidanase, the nucleic acid, the preparation method, and the fucoid oligosaccharide in food, cosmetics, and medicine.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The preparation method of the fucoidan oligosaccharide of the present invention is mild, does not destroy the activity of the product, and can directionally control the molecular weight of the product, so that the product has high uniformity. At the same time, the prepared fucoidan oligosaccharide has significant antioxidant and hygroscopic activities and has broad application prospects in food, cosmetics, and medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a graph showing the ability of fucoidan to remove ABTS;

[0030] Figure 2 This is a diagram of the hygroscopic capacity determination (RH-81%) of the fucoidan sample of the present invention;

[0031] Figure 3 This is a graph showing the hygroscopic capacity of the fucoidan sample of the present invention (RH-43%). DETAILED DESCRIPTION

[0032] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0033] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial sources. The raw material of fucoidan used in the examples is brown algae, purchased from Qingdao Mingyue Hailin Fucoidan Biotechnology Co., Ltd., product batch number: 572212002; all other chemical reagents are analytically pure.

[0034] Example 1: Construction of recombinant bacteria expressing mutants

[0035] 1. Construction of recombinant Escherichia coli

[0036] The gene of fucoidan hydrolase (GeneBank No: WP_132216013) was commissioned to Tianlin Biotechnology (Shanghai) Co., Ltd. to synthesize a cloning vector, Pcola Duet, with kanamycin resistance and a gene of base sequence 6726pb. The plasmid was then introduced into competent Escherichia coli to obtain the recombinant bacteria BL21 (DE3) / pCOLA-Duet-FcnA.

[0037] 2. Site-directed mutagenesis of α-1,4-endofucoidanase

[0038] Primers for mutation sites were designed based on the gene encoding FcnA from Mariniflexile fucanivorans as shown in SEQ ID NO.1. The specific primers are as follows:

[0039] T368S-F:TGTCGAGTGG agc TCTACCGGTATTGTTAATGGCGG;

[0040] T368S-R:TAGA gct CCACTCGACAAACTGCTCGTCAGTC;

[0041] P418A-F:TTCCAGTCC gcg GGTAAGCCGAACTGGTCGCG;

[0042] P418A-R:TTACC cgc GGACTGGAACTCCTTCAGGTAGGT.

[0043] The underlined parts represent the codons corresponding to the mutation of threonine to serine at position 368 and the mutation of proline to alanine at position 418 of the protein encoded by the mutant gene.

[0044] The PCR amplification system is:

[0045] Table 1 Amplification system

[0046] system volume Prime STAR Max(2×) 10μL Cloning template (about 4-10 ng / μL) 1μL Upstream primer F 0.8μL Downstream primer R 0.8μL <![CDATA[ddH2O]]> 7.4μL Total volume 20μL

[0047] After PCR amplification, add 2 μL DpnⅠ restriction endonuclease (10U / μL) to the reaction solution and incubate at 37°C for 2 hours to eliminate the template. Transform the PCR product into E.coil DH5α cells, spread on LB plates, and culture at 37°C overnight. Pick a single colony from the plate into LB liquid culture medium, extract the plasmid, and obtain the correct mutant plasmid pCOLA-Duet-FcnA by sequencing. T368S / P418A The successfully constructed mutant plasmid was transformed into E.coil BL21(DE3) to obtain the recombinant cell BL21(DE3) / pCOLA-Duet-FcnA that can express the mutant T368S / P418A .

[0048] Example 2: Expression and purification of original enzyme and mutant enzyme

[0049] The original BL21(DE3) / pCOLA-Duet-FcnA and mutant BL21(DE3) / pCOLA-Duet-FcnA prepared in Example 2 were respectively selected. T368S / P418A A single colony was cultured in LB liquid medium containing 50 μg / mL kanamycin at 37°C and 200 r / min for 12 h, then transferred to LB medium containing 50 μg / mL kanamycin and cultured at 37°C and 200 r / min until OD 600 At 0.7, 1 mmol / L IPTG was added and induced overnight at 20°C and 200 r / min, and the fermentation broth was collected.

[0050] Centrifuge the collected fermentation broth at 8000r / min and 4°C for 10min, discard the supernatant, collect the cells, resuspend the cells with 10mL Tris-HCl buffer, and ultrasonically disrupt for 20min (power 30%, disruption for 1s, rest for 2s). Centrifuge at 8000r / min and 4°C for 10min, collect the supernatant, which is the crude enzyme solution. Use Binding Buffer to treat Ni 2+The chelating agar resin column is pre-balanced; the crude enzyme solution is added and balanced with Binding Buffer and Washing Buffer respectively; the enzyme solution is eluted with Elution Buffer and recovered; the recovered enzyme solution is dialyzed in dialysis buffer at 4°C to finally prepare a pure enzyme solution of α-1,4-endo-fucoidanase.

[0051] The specific enzyme activity of the obtained pure enzyme solution α-1,4-endo-fucoidanase was detected respectively:

[0052] Protein content determination: The protein content in the pure enzyme solution was determined using a BCA kit (Yazyme Biotechnology).

[0053] Enzyme activity assay conditions: The reaction system includes 200 μL of 100-fold diluted purified fermentation broth or supernatant, 200 μL of 15 g / L fucoidan solution (pH=7.5), react at 50°C for 30 min, boil for 15 min to inactivate the enzyme, cool and centrifuge, and then determine the reducing sugar content by DNS method, calculated using the fucose standard curve.

[0054] Enzyme activity unit (U): The amount of enzyme required to generate 1 μmol of fucose per minute at 50°C is one enzyme activity unit.

[0055] Among them, the calculation formula of α-fucoidanase specific enzyme activity is as follows:

[0056] Fucoidan specific enzyme activity (U·mg -1 )=1000AN / Mt / m

[0057] 1000 is the conversion coefficient from mmol to μmol; A is the reducing sugar content (mg); N is the dilution factor of the enzyme solution; M is the relative molecular mass of fucose (164.16); T is the reaction time (min); and m is the protein content (mg).

[0058] The results showed that the enzyme activity of the original BL21(DE3) / pCOLA-Duet-FcnA α-fucoidanase was 55.0 U·mg -1 , mutant BL21(DE3) / pCOLA-Duet-FcnA T368S / P418A The enzyme activity of α-fucoidanase was 133.65 U·mg -1 The enzyme activity of the mutant was 2.43 times that of the mutant.

[0059] Example 3: Preparation of fucoidan

[0060] Set up the experimental group and comparison group 1-8 as follows:

[0061] 1. The preparation method of fucoidan in the experimental group is:

[0062] (1) Dissolve solid fucoidan in Tris-HCl buffer (pH = 7.5) to obtain a 15 g / L fucoidan solution;

[0063] (2) Add the pure enzyme solution of α-1,4-endofucoidase prepared in Example 2 (mutant BL21 (DE3) / pCOLA-Duet-FcnA T368S / P418A ) for enzymolysis, with an enzyme dosage of 100 U / g fucoidan, an enzymolysis pH of 7.5, an enzymolysis temperature of 50° C., and an enzymolysis time of 12 h to obtain an enzymolysis solution;

[0064] (3) Inactivation of enzyme: inactivate the enzyme in a boiling water bath, cool the enzymatic solution to room temperature, centrifuge at 8000 rpm for 15 min, and filter to obtain supernatant 1;

[0065] (4) Alcohol precipitation: add three times the volume of anhydrous ethanol to supernatant 1, incubate at 4°C, wait for complete precipitation, and centrifuge at 8000 rpm for 15 min to obtain supernatant 2;

[0066] (5) Volatilization: The ethanol in the supernatant 2 is completely evaporated at 65°C;

[0067] (6) Redissolution: re-dissolve the substance obtained in step (5) with deionized water to obtain supernatant 3;

[0068] (7) Impurity removal: The supernatant 3 was dialyzed using a 300Da dialysis bag for desalting, and the retentate was freeze-dried at -80°C to obtain fucoidan oligosaccharides.

[0069] 2. The preparation method of fucoidan in comparison group 1 is:

[0070] Compared with the preparation method of the experimental group, the preparation method of the fucoidan in the comparative group 1 differs only in that:

[0071] In step (2), the enzymatic hydrolysis pH is 6.5.

[0072] 3. The preparation method of the comparison group 2 fucoidan is:

[0073] Compared with the preparation method of the experimental group, the preparation method of the fucoidan in the comparative group 2 differs only in that:

[0074] In step (2), the enzymatic hydrolysis pH is 8.5.

[0075] 4. The preparation method of the comparison group 3 fucoidan is:

[0076] Compared with the preparation method of the experimental group, the preparation method of the comparison group 3 fucoidan oligosaccharide differs only in that:

[0077] In step (2), the enzymatic hydrolysis temperature is 30°C.

[0078] 5. The preparation method of the comparison group 4 fucoidan is:

[0079] Compared with the preparation method of the experimental group, the preparation method of the comparison group 4 fucoidan oligosaccharide differs only in that:

[0080] In step (2), the enzymatic hydrolysis temperature is 70°C.

[0081] 6. The preparation method of the fucoidan in the comparative group 5 is:

[0082] Compared with the preparation method of the experimental group, the preparation method of the comparison group 5 fucoidan oligosaccharide differs only in that:

[0083] In step (2), the amount of enzyme added is 20 U / g fucoidan.

[0084] 7. The preparation method of fucoidan in comparison group 6 is:

[0085] Compared with the preparation method of the experimental group, the preparation method of the fucoidan in the comparative group 6 differs only in that:

[0086] In step (2), the amount of enzyme added is 5 U / g fucoidan.

[0087] 8. The preparation method of the fucoidan in the comparative group 7 is:

[0088] Compared with the preparation method of the experimental group, the preparation method of the fucoidan in the control group 7 differs only in that:

[0089] In step (4), three volumes of 75% ethanol were added to the supernatant 1.

[0090] 9. The preparation method of the fucoidan in the comparative group 8 is:

[0091] Compared with the preparation method of the experimental group, the preparation method of the fucoidan in the comparative group 8 differs only in that:

[0092] In step (4), three volumes of 50% ethanol were added to the supernatant 1.

[0093] Test Example 1: Detection of total sugar yield, number average molecular weight, weight average molecular weight and area of ​​fucoidooligosaccharides

[0094] The fucoidan oligosaccharides prepared from the experimental group of Example 3 and comparative groups 1-8 were taken to detect the total sugar yield, number average molecular weight, weight average molecular weight and fucoidan oligosaccharide area.

[0095] (1) Total sugar yield of fucoidan

[0096] The yield of fucoidan oligosaccharide is the ratio of the total sugar content in the product to the total sugar content in the reaction mixture (fucoidan solution and pure enzyme solution of fucoidanase), expressed as a percentage.

[0097]

[0098] Total sugar determination test method: phenol-sulfuric acid method. The specific method is: draw 1mL of sample solution diluted to an appropriate concentration into a stoppered test tube, add 1mL of 6% phenol solution, mix thoroughly, then quickly add 5mL of concentrated sulfuric acid and shake well. Let the reaction stand at room temperature for 30 minutes, and measure the absorbance at 490nm in an enzyme reader.

[0099] Standard curve determination method: pipette fucose standard solutions diluted to different concentrations into test tubes respectively and perform determination according to the above method.

[0100] The results are shown in Table 2:

[0101] Table 2 Total sugar yield of fucoidan in each group

[0102]

[0103]

[0104] (2) Number average molecular weight, weight average molecular weight and area of ​​fucoidan

[0105] The freeze-dried fucoidan product was dissolved in pure water to prepare an aqueous solution with a concentration of 5 mg / mL, filtered with a 0.22 μm membrane, and the molecular weight distribution of each group of fucoidan was determined by gel permeation chromatography (GPC). The chromatographic conditions were: chromatographic column TSKgel G3000SWXL (7.8 mm × 300 mm), mobile phase 0.1 M Na2SO4-0.1 M Na3PO4 (pH 6.7), flow rate 0.5 mL / min, column temperature 30°C, 2487 UV detector UV 220 nm.

[0106] High performance gel permeation chromatography (HPGPC) was used to determine the number average molecular weight (Mn) and weight average molecular weight (Mw) of each component, and the area % of fucoidan was obtained according to the high performance liquid phase area normalization method. Chromatographic column: UltrahydrogelTMLinear (300mm×7.8mm id×2), mobile phase: 0.1mol·L-1NaNO3, flow rate: 0.9mL·min-1, column temperature: 45℃, detector: differential detector.

[0107] The results are shown in Table 3:

[0108] Table 3 Number average molecular weight, weight average molecular weight and fucoidan area of ​​each group

[0109] Group Number average molecular weight Mn(Da) Weight average molecular weight Mw (Da) Fucoidan area (%) Experimental Group 497 1356 94.9 Comparison group 1 508 1428 82.3 Comparison group 2 514 1518 80.4 Comparison group 3 511 1427 89.7 Comparison group 4 509 1358 80.5 Comparison group 5 556 1610 85.4 Comparison group 6 589 1958 89.8 Comparison group 7 517 1310 70.8 Comparison group 8 519 1258 70.46

[0110] The larger the area % value of fucoidan, the higher the degree of removal of high molecular weight fucoidan. As can be seen from Table 3, after the supernatant 1 was treated with 100% ethanol for alcohol precipitation, the number average molecular weight of fucoidan was relatively small, and the substrate area accounted for a large proportion; this shows that compared with the other two treatment methods, the removal of high molecular weight substances was more thorough and the effect was better. From the results of the two groups of 75% and 50% alcohol precipitation, the difference between the number average molecular weight and weight average molecular weight of the two is not large.

[0111] Test Example 2: Detection of Antioxidant Activity

[0112] The fucoidan oligosaccharides obtained from the experimental group of Example 3 and comparison groups 1-8 were taken to detect the antioxidant activity.

[0113] The antioxidant activity was determined by:

[0114] Prepare 7mmol / L ABTS and 2.45mmol / L K2S2O8 for later use. Take 2mL ABTS and 2mL K2S2O8 solution and mix them in an EP tube, wrap it with tin foil, and place it in a light-proof environment at room temperature for 14 hours to prepare ABTS free radical stock solution. Dilute the ABTS free radical stock solution with deionized water to make its absorbance at 734nm band 0.70±0.02.

[0115] Take 2.9mL ABTS free radical determination solution, add 0.1mL of each group of fucoid oligosaccharide sample or fucoidan dilution solution, react in the dark for 10min, and the absorbance value at 734nm is A1. Use K2S2O8 solution instead of ABTS free radical determination solution to measure the absorbance value A2, then use deionized water instead of sample and measure the absorbance value A3 according to the same steps. Use antioxidant Vc as positive control, and each sample is tested three times in parallel.

[0116] The ABTS free radical scavenging ability is expressed by the scavenging rate R%: R% = ((A3-A1+A2) / A3)×100%.

[0117] Test results see Figure 1The results showed that the fucoidan oligosaccharide had a significant ability to scavenge ABTS free radicals, and was positively correlated with the concentration of fucoidan oligosaccharide. When the concentration of fucoidan oligosaccharide was 1.5 mg / mL, the free radical scavenging ability was 100%. However, the antioxidant ascorbic acid still had a higher ability to scavenge ABTS free radicals. At a concentration of 0.2 mg / mL, the ABTS scavenging rate reached 100%. However, when the ABTS free radical scavenging ability of fucoidan oligosaccharide was compared with that of the original large molecular weight fucoidan, the scavenging rate was only 9.2% when the fucoidan concentration was 3 mg / mL. It was proved that the molecular weight of polysaccharide plays an important role in its ability to scavenge ABTS free radicals, and low molecular weight polysaccharides will improve its antioxidant activity.

[0118] Test Example 3: Detection of hygroscopic activity

[0119] The fucoido-oligosaccharides obtained from the experimental group of Example 3 and comparative groups 1-8 were taken to detect the hygroscopic activity.

[0120] The hygroscopic activity was determined by:

[0121] Weigh 0.1000g of fucoidan or each group of fucoidan samples and glycerol (positive control) respectively, add them to a weighing bottle, record the initial weight of the sample as Wo, place it in a desiccator, replace the silica gel with saturated (NH4)2SO4 solution and saturated K2CO3 or sodium carbonate solution, make the humidity in the desiccator 81% and 43% respectively, control the temperature at 25℃, measure the weight of the sample at 2h, 5h, 8h, 12h, 24h, 36h, 48h, 60h respectively and record it as Wn, and conduct three parallel experiments for each sample. The moisture absorption rate calculation formula is as follows:

[0122] Moisture absorption rate % = (Wn-Wo) / Wo×100%.

[0123] Test results see Figure 2 and Figure 3 The results showed that under high humidity conditions (81%), the hygroscopicity of fucoidan did not change much, while the hygroscopicity of fucoidan oligosaccharides increased rapidly from 0 to 12 hours, and then reached a saturated state at 24 hours. In the first 5 hours, the hygroscopicity of the sample was not much different from that of glycerol, but after 5 hours, the gap between the two gradually increased with the extension of time; under low humidity conditions (43%), the hygroscopicity of fucoidan oligosaccharides increased from 0 to 10 hours, and then gradually stabilized; while the hygroscopicity of fucoidan had almost no upward trend within 2 to 60 hours. Under high humidity and low humidity conditions, the highest hygroscopicity of fucoidan was 22.1% and 3.4%, respectively; the hygroscopicity of fucoidan oligosaccharides in saturated state was 59.5% and 10.15%, respectively, which could reach 62.32% and 42.29% of the hygroscopicity of glycerol in saturated state, indicating that fucoidan oligosaccharides have good hygroscopicity.

[0124] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. An α-1,4-endofucoidanase, characterized in that Its amino acid sequence is shown in SEQ ID No:

3.

2. A nucleic acid encoding α-1,4-endofucoidanase, characterized in that: The nucleotide sequence thereof is shown in SEQ ID No:

4.

3. A method for preparing fucoidan, characterized in that: The following steps are involved: (1) adding the α-1,4-endofucoidanase of claim 1 to a fucoidan solution, and performing enzymolysis to obtain an enzymolysis solution; the enzymolysis conditions are: pH 7-8, temperature 45° C.-55° C., and time 12 h-24 h; (2) inactivating the enzyme in the enzymatic hydrolyzate, cooling it to room temperature, centrifuging it, and filtering it to obtain a supernatant 1; (3) adding ethanol to the supernatant 1, and centrifuging to obtain supernatant 2 after precipitation is complete; (4) completely volatilizing the ethanol in the supernatant 2 to obtain a solid; re-dissolving the solid with deionized water to obtain a supernatant 3; (5) The supernatant 3 is dialyzed to remove impurities and freeze-dried to obtain fucoidan oligosaccharides.

4. The method for preparing fucoidan according to claim 3, characterized in that: In step (1): the concentration of the fucoidan solution is 10 g / L-15 g / L; the solvent of the solution is Tris-HCl buffer; the added amount of the α-1,4-endo-fucoidan hydrolase is 50-100 U / g fucoidan.

5. The method for preparing fucoidan according to claim 3, characterized in that: In step (2), the enzyme inactivation conditions are: 90°C-105°C, 10 min-20 min; the centrifugation conditions are: temperature 20°C-25°C, rotation speed 8000rpm-10000rpm, time 15min-20min.

6. The method for preparing fucoidan according to claim 3, characterized in that: In step (3), the volume ratio of the supernatant 1 to the ethanol is 1:3-5; the temperature during precipitation is 2°C-8°C; the centrifugal conditions are: temperature 4°C-10°C, rotation speed 8000rpm-10000rpm, time 10min-20min.

7. The method for preparing fucoidan according to claim 3, characterized in that: In step (4): the volatilization temperature is 60°C-80°C, and the time is 1h-3h.

8. The method for preparing fucoidan according to claim 3, characterized in that: In step (5): the dialysis adopts a 100Da-400Da dialysis bag; the dialysis conditions are: temperature 2°C-8°C, time 24h-36h.

9. A fucoidan oligosaccharide, characterized in that: Prepared by the preparation method described in any one of claims 3-8.

10. Use of the α-1,4-endofucoidase according to claim 1, the nucleic acid according to claim 2, the preparation method according to any one of claims 3 to 8, and the fucoidan according to claim 9 in food, cosmetics, and medicine.

Images