Retinal non-long-process cell specific promoters and uses thereof

Abstract

The present invention relates to a nucleic acid sequence derived from a regulatory region of a human Lgr5 gene and having promoter activity in retina non-long-process cells. The invention also relates to an expression cassette or vector comprising the promoter, a viral particle or cell comprising the expression cassette or vector, and a pharmaceutical composition comprising the expression cassette or vector and the viral particle or cell. The invention also relates to the use of the expression cassette, vector, viral particle, cell or pharmaceutical composition in the treatment of eye diseases, especially diseases associated with retinal ganglion cell degeneration.

Description

Technical Field

[0001] The present invention relates to a nucleic acid sequence derived from the regulatory region of human Lgr5 gene and having promoter activity in retinal amacrine cells. Specifically, the present invention relates to a retinal amacrine cell-specific promoter and its use in medicine, especially in treating eye diseases. Background Art

[0002] Glaucoma is a type of blinding retinal neurodegenerative disease caused by lesions of retinal ganglion cells (RGCs). Ganglion cells are the only output neurons in the retina. The axons of these neurons converge at the retinal papilla and then pass through the optic nerve to the brain, establishing a neural connection between the retina and the brain. Therefore, when ganglion cells and their axons undergo degenerative lesions, the neural signals produced by upstream neurons in the retina will not be transmitted to the brain, leading to blindness.

[0003] The main cause of retinal ganglion cell disease in glaucoma patients is increased intraocular pressure. Increased intraocular pressure can cause damage to the cell bodies or axons of ganglion cells, causing ganglion cell disease or death. Existing glaucoma treatments focus on slowing down the progression of ganglion cell disease by lowering intraocular pressure. However, once ganglion cells die, there is currently no clinical treatment that can restore vision to blind patients.

[0004] Studies have shown that after ganglion cell disease and death, other neurons in the retina can survive for a long time and maintain the original neural circuit connection, which provides an opportunity to regenerate ganglion cells through regenerative medicine, reestablish the neural connection between the retina and the brain, and restore vision for blind patients. Theoretically, there are two ways to achieve ganglion cell regeneration: one is to transplant ganglion cell precursors differentiated from embryonic stem cells or other cell types in vitro into the retina through cell transplantation, so that they integrate with other retinal nerve cells in vivo and extend axons to the brain; the other is to use other cell types in the retina to regenerate retinal ganglion cells.

[0005] Muller cells are the main type of glial cells in the retina, with structural and functional support. In some non-mammals (such as zebrafish), Muller glial cells have shown the ability to regenerate RGCs. By studying the mechanisms of action in these animals, researchers have induced similar regenerative abilities in mammals. For example, using gene editing technology (such as CRISPR-Cas9 or overexpression systems) and specific transcription factors (such as Atoh7, Brn3b, etc.), Muller glial cells can be reprogrammed to differentiate into RGCs. Atoh7 is an important transcription factor for RGC development, while Brn3b is required to maintain RGC characteristics. The combined action of these factors can promote the transformation of Muller glial cells into RGCs. Other studies have shown that overexpression of NeuroD1, a neural transcription factor, can reprogram Muller cells into RGCs. Retinal amacrine cells (ACs) are a type of interneuron that plays an important role in visual signal processing and regulation. In recent years, researchers have begun to explore the possibility of using these cells to transdifferentiate into retinal ganglion cells (RGCs) to address the problem of vision loss caused by RGC damage. Reference may be made to Chinese patent application number CN113134076A (a method for regenerating functional retinal ganglion cells using transcription factors).

[0006] In order to achieve the transdifferentiation of other cell types into ganglion cells in the clinic, a specific and highly efficient promoter, i.e., a cell-specific promoter, is required. Cell-specific promoters are important elements in gene regulation and play a key role in maintaining cell specificity and tissue specificity in the body. The promoter is the regulatory region of a gene, which is responsible for initiating the process of gene transcription, thereby allowing gene expression to produce the corresponding protein. Cell-specific promoters have the ability to initiate gene expression in specific types of cells, thereby allowing the function of genes to be precisely regulated in specific cell types.

[0007] The characteristics of cell-specific promoters are mainly reflected in the following aspects:

[0008] Specific expression: Cell-specific promoters can ensure that genes are expressed in specific cell types, while being silenced in other cell types. This specific expression is the basis of cell differentiation and tissue development in organisms, ensuring the coordinated and orderly operation of various cell functions.

[0009] Regulatory elements: Cell-specific promoters usually contain multiple regulatory elements, such as enhancers and repressors, which interact with transcription factors to form a complex regulatory network. These regulatory elements play an important role in maintaining cell specificity and regulate promoter activity through interactions.

[0010] Signal transduction pathways: The activation of cell-specific promoters is often associated with extracellular signal transduction pathways. For example, the activity of some cell-specific promoters is regulated by extracellular factors, which activate specific signal transduction pathways and ultimately affect the activity of the promoter, thereby regulating gene expression.

[0011] Epigenetic regulation: In addition to traditional genetic regulation mechanisms, the activity of cell-specific promoters is also affected by epigenetic regulation. Epigenetic modifications such as DNA methylation and histone modification can play an important regulatory role in cell-specific gene expression.

[0012] Cell-specific promoters can be used as an important resource for gene therapy applications. Designing gene expression vectors using cell-specific promoters can achieve gene therapy and gene regulation for specific cell types. In addition, the specificity of promoters can also be used in gene editing technology to achieve precise editing and regulation of specific cell populations.

[0013] Therefore, the screening of cell-specific promoters is a complex and critical research task, and its results are of great significance for understanding the mechanism of cell fate determination, the occurrence and development of diseases, and especially for the development of new therapeutic strategies. There has always been a need in the art for promoters that allow target genes to be strongly, stably and specifically expressed in eye cells, especially retinal amacrine cells. Summary of the invention

[0014] The present invention provides a novel transcription promoter that can drive high-level gene expression specifically in retinal amacrine cells.

[0015] In a first aspect of the present invention, an isolated nucleic acid (hereinafter also referred to as a promoter) is provided, which has promoter activity in retinal amacrine cells and comprises a nucleotide sequence of SEQ ID NO: 1, or a functional variant having at least 80% identity with SEQ ID NO: 1.

[0016] In one embodiment, the isolated nucleic acid consists of the nucleotide sequence of SEQ ID NO:1, or a functional variant having at least 80% identity to SEQ ID NO:1.

[0017] In one embodiment, the isolated nucleic acid has retinal amacrine cell-specific promoter activity.

[0018] In one embodiment, the isolated nucleic acid also has promoter activity in Muller cells.

[0019] In one embodiment, the isolated nucleic acid may further comprise an enhancer. The enhancer includes, but is not limited to, a cytomegalovirus (CMV) enhancer, a simian virus 40 (SV40) enhancer, an elongation factor 1 alpha (EF1 alpha) enhancer, an ubiquitin C (UbC) enhancer, or a locus control region (LCR) enhancer.

[0020] In one embodiment, the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO:2, or a functional variant having at least 80% identity with SEQ ID NO:2; or the isolated nucleic acid consists of the nucleotide sequence of SEQ ID NO:2, or a functional variant having at least 80% identity with SEQ ID NO:2.

[0021] In a second aspect of the present invention, an expression cassette is provided, comprising the isolated nucleic acid according to the first aspect of the present invention.

[0022] In one embodiment, the expression cassette further comprises a nucleic acid of interest operably linked to the isolated nucleic acid of the present invention.

[0023] In one embodiment, the target nucleic acid is a nucleic acid encoding a target polypeptide.

[0024] In one embodiment, the polypeptide of interest is a transcription factor, a therapeutic protein, an optogenetic driver protein, or a reporter protein.

[0025] In one embodiment, the target polypeptide is a transcription factor, wherein the transcription factor is selected from Atoh7, brn3b, sox4, Isl1 and sox11, and any combination thereof.

[0026] In one embodiment, the target polypeptide is a therapeutic protein, wherein the therapeutic protein can be selected from MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7 and ACO2, or can be a neurotrophic factor selected from GDNF, VEGF, CNTF, FGF2, BDNF and EPO, an anti-apoptotic protein selected from BCL2 and BCL2L1, an anti-angiogenic factor selected from endostatin, angiostatin and sFlt, an anti-inflammatory factor selected from IL10, IL1R1, TGFBI and IL4, or a rod-derived cone activity factor (RdCVF).

[0027] In one embodiment, the polypeptide of interest is an optogenetic driver protein, wherein the optogenetic driver protein can be an optogenetic activator, which is preferably selected from rhodopsin, photopsin, melanopsin, pinealopsin, parapinealopsin, VA opsin, periopsin, neuroopsin, brainopsin, retinal pigment, RGR opsin, microbial opsins with red-shifted spectral properties (e.g., ReaChR, Chrimson or ChrimsonR), vertebrate opsins that recruit Gi / o signaling (e.g., short-wavelength vertebrate opsins or long-wavelength vertebrate opsins), The invention relates to an optogenetic inhibitor, which is preferably selected from halophilic rhodopsins (e.g., NpHR, eNpHR2.0, eNpHR3.0, and Halo57), archaeal rhodopsins (e.g., Arch and AR-3), bacterial rhodopsins (e.g., eBR, proteobacterial rhodopsins, and xanthomonas rhodopsins), sphaerocystis fungal opsin (Mac), great white shark cross halophilic rhodopsin, and variants of the above proteins.

[0028] In one embodiment, the target polypeptide is a reporter protein, wherein the reporter protein can be selected from fluorescent protein, calcium indicator, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase and variants of the above proteins.

[0029] In one embodiment, the target nucleic acid encodes a nucleic acid selected from the group consisting of siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozyme and deoxyribozyme (DNAzyme).

[0030] In a third aspect of the present invention, a vector is provided, comprising the isolated nucleic acid according to the first aspect of the present invention or the expression cassette according to the second aspect of the present invention.

[0031] In one embodiment, the vector is a viral vector.

[0032] In one embodiment, the vector is a retroviral vector or a parvoviral vector. In one embodiment, the vector is a Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV or SNV vector, a lentiviral vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector, a simian virus 40 (SV-40) vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, a herpes virus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a mouse mammary tumor virus vector or a Rous sarcoma virus vector. In one embodiment, the vector is an adeno-associated virus (AAV) vector and may comprise two ITRs flanking the target nucleic acid.

[0033] In a fourth aspect of the present invention, a virus particle is provided, which comprises the vector according to the third aspect of the present invention.

[0034] In one embodiment, the vector is an AAV vector. In one embodiment, the viral particle further comprises an AAV-derived capsid. In one embodiment, AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj. In one embodiment, the AAV serotype is preferably selected from AAV-2, AAV-5, AAV2-7m8, AAV-9, and AAV-8, more preferably AAV-2 or AAV2-7m8.

[0035] In a fifth aspect of the present invention, a cell is provided, comprising the isolated nucleic acid according to the first aspect of the present invention, the expression cassette according to the second aspect of the present invention, the vector according to the third aspect of the present invention or the viral particle according to the fourth aspect of the present invention.

[0036] In one embodiment, the cell is a retinal amacrine cell or a Muller cell.

[0037] In the sixth aspect of the present invention, a pharmaceutical composition is provided, which comprises the isolated nucleic acid according to the first aspect of the present invention, the expression cassette according to the second aspect of the present invention, the vector according to the third aspect of the present invention, the viral particle according to the fourth aspect of the present invention or the cell according to the fifth aspect of the present invention, and a pharmaceutically acceptable excipient.

[0038] In the seventh aspect of the present invention, a method for treating an eye disease is provided, comprising administering to a patient in need thereof a therapeutically effective amount of an isolated nucleic acid according to the first aspect of the present invention, an expression cassette according to the second aspect of the present invention, a vector according to the third aspect of the present invention, a viral particle according to the fourth aspect of the present invention, a cell according to the fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention.

[0039] In one embodiment, the eye disease is a disease associated with retinal ganglion cell degeneration. In one embodiment, the eye disease is selected from hereditary optic neuropathy (Leber's hereditary optic neuropathy, dominant optic neuropathy), compressive optic neuropathy (orbital pseudotumor, thyroid eye disease), autoimmune optic neuropathy (lupus), diabetic retinopathy, glaucomatous optic neuropathy (GOND), glaucoma, arterial ischemic optic neuropathy (giant cell arteritis), non-arteritic ischemic optic neuropathy, infiltrative optic neuropathy (sarcoidosis), infectious optic neuropathies (syphilis, Lyme disease, toxoplasmosis, herpes zoster), optic neuritis from demyelinating diseases and radiation-induced optic neuropathy.

[0040] In another embodiment, the eye disease is a disease associated with photoreceptor cell degeneration. In one embodiment, the eye disease is selected from retinitis pigmentosa, age-related macular degeneration, Stargardt's disease, Leber's hereditary optic neuropathy, cone-rod dystrophy, Leber's congenital amaurosis, diabetic retinopathy, retinal detachment, Best's disease, choroideremia, and tapetal retinal degeneration.

[0041] In the eighth aspect of the present invention, there is provided use of an isolated nucleic acid according to the first aspect of the present invention, an expression cassette according to the second aspect of the present invention, a vector according to the third aspect of the present invention, a viral particle according to the fourth aspect of the present invention, a cell according to the fifth aspect of the present invention or a pharmaceutical composition according to the sixth aspect of the present invention in the preparation of a medicament for treating an eye disease.

[0042] In one embodiment, the eye disease is a disease associated with retinal ganglion cell degeneration. In one embodiment, the eye disease is selected from hereditary optic neuropathy (Leber's hereditary optic neuropathy, dominant optic neuropathy), compressive optic neuropathy (orbital pseudotumor, thyroid eye disease), autoimmune optic neuropathy (lupus), diabetic retinopathy, glaucomatous optic neuropathy (GOND), glaucoma, arterial ischemic optic neuropathy (giant cell arteritis), non-arteritic ischemic optic neuropathy, infiltrative optic neuropathy (sarcoidosis), infectious optic neuropathies (syphilis, Lyme disease, toxoplasmosis, herpes zoster), optic neuritis from demyelinating diseases and radiation-induced optic neuropathy.

[0043] In another embodiment, the eye disease is a disease associated with photoreceptor cell degeneration. In one embodiment, the eye disease is selected from retinitis pigmentosa, age-related macular degeneration, Stargardt's disease, cone-rod dystrophy, Leber's congenital amaurosis, diabetic retinopathy, retinal detachment, Best's disease, choroideremia, and tapetal retinal degeneration.

[0044] In the ninth aspect of the present invention, a method for expressing a target polypeptide or a target nucleic acid in a retinal amacrine cell or a Muller cell is provided, comprising introducing the isolated nucleic acid according to the first aspect of the present invention, the expression cassette according to the second aspect of the present invention, the vector according to the third aspect of the present invention, or the viral particle according to the fourth aspect of the present invention into a retinal amacrine cell or a Muller cell. In one embodiment, the method is an in vitro method.

[0045] In one embodiment, the expression is specific expression in retinal amacrine cells. In another embodiment, the expression is specific expression in Muller cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] The present invention will be better understood with reference to the accompanying drawings.

[0047] Figure 1 The expression of Lgr5 gene in mouse retina is verified. A: Schematic diagram of retinal cell structure. B: Lgr5 EGFP-IRES-CreERT2 Rosa26 CAG-LSL-tdTomato Schematic diagram of strain mice treated with tamoxifen. C: Confocal images of frozen sections of retina of adult mice (8 weeks old) treated with tamoxifen by oral gavage. Amacrine cells in the inner nuclear layer are labeled with EGFP and tdTomato, respectively. GCL, retinal ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; Scale bar = 30 μm.

[0048] Figure 2 An AAV-human Lgr5 promoter-EGFP plasmid construct is shown.

[0049] Figure 3 Images of HEK293T cells transfected with AAV-human Lgr5 promoter-EGFP plasmid are shown. Left: DIC image; Middle: EGFP fluorescence image; Right: merged image.

[0050] Figure 4The expression of EGFP in retinal amacrine cells after subvitreal injection of AAV in wild-type C57 mice is shown. After 2 weeks, EGFP was efficiently and relatively specifically expressed in retinal amacrine cells (thin arrows) and Muller cells (thick arrows) (C), while expression in retinal ganglion cells was relatively minimal (A and B). GCL, retinal ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; scale bar = 30 μm.

[0051] Figure 5 The expression of human SOX4 in retinal amacrine cells after subvitreal injection of AAV in wild-type C57 mice is shown. A: Schematic diagram of the vector AAV-human Lgr5 promoter-hSOX4-P2A-EGFP. B: SOX4 is efficiently and relatively specifically expressed in retinal amacrine cells (indicated by thin arrows) and Muller cells (indicated by thick arrows). GCL, retinal ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; Scale bar = 30 μm.

[0052] Figure 6 The ERG and VEP test results of wild-type C57 mice after AAV administration for >7 weeks are shown. The two lines in the ERG and VEP graphs represent the waveforms of the left and right eyes of the mice, respectively.

[0053] Figure 7 Shown are the results of a light-dark box passive escape test in glaucomatous C57 mice after subvitreal administration of human SOX4 using AAV. Specific implementation plan

[0054] Using in vivo cell lineage tracing technology, the inventors found in previous studies that Lgr5-positive amacrine cells (a type of retinal interneuron) in the retina of adult mice can transdifferentiate into retinal ganglion cells, and that the newly generated ganglion cells can grow axons and transmit visual signals over long distances to the visual nuclei of the brain. Furthermore, in a disease model where the original ganglion cells in the retina are completely damaged, the regenerated ganglion cells can still rebuild the visual circuit between the retina and the brain.

[0055] Furthermore, the inventors have identified a promoter sequence derived from the regulatory region of the human Lgr5 gene, which can specifically drive high-level gene expression in retinal amacrine cells. Using this promoter to express important transcription factors of ganglion cells such as Atoh7, brn3b, sox4, Isl1, and sox11 in retinal amacrine cells can promote the transdifferentiation of retinal amacrine cells into ganglion cells. Studies have shown that Muller also has the potential to transdifferentiate into ganglion cells. Using this promoter to express certain genes in other types of retinal cells, such as Muller cells, can achieve the transdifferentiation of Muller cells into ganglion cells. This study provides a new therapeutic strategy for restoring sight to blind patients by regenerating ganglion cells in the clinic.

[0056] The Lgr5 gene (Leucine-rich repeat-containing G-protein coupled receptor 5) is a gene that plays an important role in a variety of tissues and cell types. It encodes a G protein-coupled receptor that is mainly associated with stem cell and cancer research. Lgr5 is a recognized stem cell marker, especially in the crypt basal cells of the small intestine and colon. These cells have a high ability to self-renew, and the expression of Lgr5 is significant in these stem cells. Studies have found that Lgr5-positive cells can form intestinal organoids in vitro culture, further proving their stem cell properties. Lgr5 plays an important role in the Wnt signaling pathway. The Wnt signaling pathway plays a key role in regulating cell proliferation, differentiation, and migration. As a receptor for the Wnt signaling pathway, Lgr5 binds to R-spondins to enhance Wnt signals. This enhancement helps maintain the characteristics and functions of stem cells. Lgr5 is not only expressed in normal stem cells, but also highly expressed in certain cancers, especially in colorectal cancer. Lgr5-positive cells are considered to be part of cancer stem cells, which have the ability to self-renew and drive tumor growth. Therefore, Lgr5 is regarded as a potential target for cancer therapy, and targeting Lgr5-positive cells may help eliminate cancer stem cells and inhibit tumor recurrence.

[0057] Due to the importance of Lgr5 in stem cell biology and cancer research, scientists have developed a variety of tools to study this gene. For example, the Lgr5-EGFP-IRES-CreERT2 mouse model is used to mark and track Lgr5-positive cells, helping to study its role in tissue regeneration and cancer. It was subsequently discovered that Lgr5 is also expressed in the retina of adult mice, and these Lgr5-positive retinal cells are a type of highly differentiated neural cells - amacrine cells.

[0058] In view of the fact that the Lgr5 gene can be expressed in the retina, it is particularly important to focus on the screening of the Lgr5 promoter sequence. The inventors designed a variety of human Lgr5 promoter sequences in combination with bioinformatics prediction and transcriptomics data analysis, and screened the promoter activity through experimental verification. This can be achieved by the construction method of promoter-reporter gene (such as EGFP). Human Lgr5 promoter-EGFP was transfected in cell lines or model organisms, and imaging proved that it can be efficiently and relatively specifically expressed in retinal amacrine cells, and the promoter was expressed in the retina of mice using this promoter, which did not cause significant changes in the waveform and amplitude of the mouse electroretinogram (ERG) and visual evoked potential (VEP), indicating that its activity did not cause functional changes to the retina.

[0059] In the present invention, unless specifically stated otherwise, the use of the singular includes the plural, the word "a" means "at least one", and the use of "or" means "and / or". In addition, the words "include" and "comprising" are open-ended terms, the scope of which includes the closed terms "consisting of" and "consisting essentially of".

[0060] As used herein, the term "about", when used with a percentage or other quantity, refers to all values ​​within the range of plus or minus 10% of the percentage or other quantity. For example, "about 80%" includes all values ​​within the range of 80% plus or minus 8%.

[0061] All documents cited in this application, including but not limited to patents, patent applications, articles, books and treaties, are hereby expressly incorporated by reference into the present invention for any purpose. If one or more of the incorporated literature and similar materials defines a term in conflict with the definition of the term in this application, the definition in this application shall prevail.

[0062] The term "nucleic acid" or "polynucleotide" used herein refers to the polymeric form of nucleotides of any length, and the nucleotides can be ribonucleotides or deoxyribonucleotides. Therefore, the term includes but is not limited to single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or polymers comprising non-natural or derived nucleotide bases of purine and pyrimidine bases or other natural, chemical or biochemical modifications. The backbone of the polynucleotide can include sugar and phosphate groups (as can be usually present in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can include synthetic subunits such as polymers of phosphoramidates, and therefore can be oligodeoxynucleoside phosphoramidates (P-NH2) or mixed phosphoramidate-phosphodiester oligomers. Nucleic acid of the present invention can be prepared by any technology known to those skilled in the art, including chemical synthesis, reorganization and mutation. In a preferred embodiment, nucleic acid of the present invention is a DNA molecule, which is preferably synthesized by recombinant methods well known to those skilled in the art.

[0063] The term "isolated nucleic acid" as used herein refers to a nucleic acid molecule that has been identified and separated and / or recovered from a component of its natural environment. In particular, the term refers to a nucleic acid molecule that is separated from other nucleic acid molecules present in its natural source. For example, for genomic DNA, the term "isolated" includes nucleic acid molecules separated from chromosomes that are naturally associated with the genomic DNA. Preferably, the "isolated" nucleic acid molecule does not contain sequences that naturally flank the nucleic acid molecule in the genomic DNA of the organism from which the nucleic acid molecule is derived.

[0064] The term "promoter" as used herein refers to a regulatory element that directs the transcription of a nucleic acid to which it is operably linked. A promoter can regulate both the transcription rate and efficiency of an operably linked nucleic acid. A promoter can also be operably linked to other regulatory elements that enhance ("enhancer") or repress ("repressor") promoter-dependent transcription of a nucleic acid.

[0065] The term "promoter activity" as used herein refers to the ability of a promoter to initiate transcription of a nucleic acid to which it is operably linked. Promoter activity can be measured using procedures known in the art. For example, promoter activity can be measured as the amount of transcribed mRNA using, for example, Northern blots or polymerase chain reaction (PCR). Alternatively, promoter activity can be measured as the amount of translated protein product, for example, by Western blots, ELISA, colorimetric assays, and various activity assays, including reporter gene assays.

[0066] As used herein, the term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid molecule such that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence when the promoter is capable of affecting the expression of the coding sequence, i.e., the coding sequence is under the transcriptional control of the promoter.

[0067] The terms "polypeptide" and "protein" used herein are used interchangeably and refer to polymers of amino acid residues and are not limited to a minimum length. These polymers of amino acid residues may contain natural or non-natural amino acid residues and include, but are not limited to, dimers, trimers and polymers of peptides, oligopeptides, amino acid residues. Both full-length proteins and fragments thereof are encompassed by this definition. The term also includes post-translational modifications of polypeptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. In addition, for the purposes of the present invention, "polypeptide" may refer to proteins including modifications such as deletions, additions and substitutions to the parent sequence, as long as the protein maintains the desired activity. These modifications may be carefully designed by site-directed mutagenesis, or may be accidental, such as by mutations in the host producing the protein or errors caused by PCR amplification.

[0068] The term "retinal amacrine cell" as used herein refers to a regulatory neuron in the retina, located in the inner nuclear layer, forming connections with bipolar cells, ganglion cells and other amacrine cells. Amacrine cells are responsible for complex processing of retinal images, especially regulating visual brightness and perception of motion.

[0069] The term "Muller cell" used in this article refers to the glial cells that make up more than 90% of the retina. It is a very slender cell that radially penetrates the entire retina. It does not directly transmit visual information, but has a strong ability to resist various injuries. When the retina is damaged, Muller cells are the main response cells and will participate in the repair process of the damage.

[0070] The term "sequence identity" or "identity" as used herein refers to the number (%) of position matches (identical nucleic acid residues) obtained from the alignment of two polynucleotide sequences. Sequence identity is determined by comparing the sequences while aligning so as to maximize overlap and identity and simultaneously minimize sequence gaps. In particular, sequence identity can be determined using any of a variety of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., the Needleman and Wunsch algorithm; Needleman and Wunsch, 1970) that optimally aligns the sequences over the entire length, while sequences of significantly different lengths are preferably aligned using a local alignment algorithm (e.g., the Smith and Waterman algorithm (Smith and Waterman, 1981) or the Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005)). Alignment for the purpose of determining the percentage of nucleic acid sequence identity can be achieved in a variety of different ways within the skill of the art, such as using the .

[0071] The publicly available computer software obtained at http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . Those skilled in the art can determine suitable parameters for measuring alignment, including any algorithm required for obtaining maximum alignment over the full length of the compared sequence. For purposes of the present invention, nucleic acid sequence identity percentage values ​​refer to the values ​​generated using the paired sequence alignment program EMBOSS Needle, which uses the Needleman-Wunsch algorithm to generate the best global alignment of two sequences, wherein all search parameters are set to default values, i.e., scoring matrix=BLOSUM62, gap opening penalty=10, gap extension penalty=0.5, terminal gap penalty=error, terminal gap opening penalty=10, terminal gap extension penalty=0.5.

[0072] As used herein, the term "subject" or "patient" refers to an animal having a retina, preferably a mammal, and even more preferably a human, including an adult, a child, and a human in the prenatal stage.

[0073] Promoter of the present invention

[0074] The present disclosure provides an isolated nucleic acid having promoter activity in retinal amacrine cells and comprising the nucleotide sequence of SEQ ID NO: 1, or a functional variant having at least 80% identity with SEQ ID NO: 1. In one embodiment, the isolated nucleic acid consists of the nucleotide sequence of SEQ ID NO: 1, or a functional variant having at least 80% identity with SEQ ID NO: 1.

[0075] The nucleic acid of the present invention exhibits promoter activity in retinal amacrine cells, i.e., when introduced into retinal amacrine cells, it can initiate transcription of a nucleic acid operably linked thereto. Preferably, the promoter activity is retinal amacrine cell specific. The term "retinal amacrine cell specific" as used herein should be understood to mean a promoter that is mainly active in retinal amacrine cells. It should be understood that residual expression, which is usually lower in other tissues or cells, cannot be completely excluded. Preferably, the activity of the promoter of the present invention in non-retinal amacrine cells is less than 90% of the activity in retinal amacrine cells, for example less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. In one embodiment, the activity of the promoter of the present invention in non-retinal amacrine cells is 1%-50% of the activity in retinal amacrine cells. In one embodiment, the promoter of the present invention is inactive in non-retinal amacrine cells. In a preferred embodiment, the promoter of the invention is inactive in ganglion cells, bipolar, horizontal, cone and rod photoreceptor cells.

[0076] In one embodiment, nucleic acid of the present invention also shows promoter activity or specific promoter activity in Muller cells. Preferably, the activity of the promoter of the present invention in non-Muller cells is less than 90% of the activity in Muller cells, for example, less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. In one embodiment, the activity of the promoter of the present invention in non-Muller cells is 1%-50% of the activity in Muller cells.

[0077] In one embodiment, the promoter activity is specific for retinal amacrine cells and / or Muller cells. Preferably, the promoter is specific for retinal amacrine cells and Muller cells.

[0078] The promoter of the present invention may further comprise any element capable of enhancing the activity of the promoter. In one embodiment, the promoter of the present invention further comprises an enhancer.

[0079] The term "enhancer" as used herein refers to a non-coding DNA segment that acts by binding to a specific transcription factor to increase the activity of the adjacent gene promoter, thereby significantly increasing the transcription efficiency of the gene. The enhancer can act in any direction and any position (upstream or downstream) relative to the promoter. The enhancer may be located upstream or downstream of the gene, and is not necessarily close to the gene to be acted on.

[0080] Suitable enhancers include, but are not limited to, cell-specific enhancers and inducible enhancers. In one embodiment, the promoter of the present invention includes, but is not limited to, a cytomegalovirus (CMV) enhancer, a simian virus 40 (SV40) enhancer, an elongation factor 1α (EF1α) enhancer, an ubiquitin C (UbC) enhancer, a locus control region (LCR) enhancer, and the like. In one embodiment, the promoter of the present invention comprises a CMV enhancer. In one embodiment, the CMV enhancer has a nucleotide sequence shown in SEQ ID NO: 3. The sequences and uses of various enhancers are well known to those skilled in the art.

[0081] In one embodiment, the promoter of the present invention comprises the nucleotide sequence of SEQ ID NO: 2, or a functional variant having at least 80% identity with SEQ ID NO: 2. In one embodiment, the isolated nucleic acid consists of the nucleotide sequence of SEQ ID NO: 2, or a functional variant having at least 80% identity with SEQ ID NO: 2.

[0082] The term "variant" or "functional variant" as used herein refers to a nucleotide sequence that is different from the original sequence but retains its essential properties. In general, the variant is closely similar to the original polynucleotide overall and is identical in many regions. The sequence of the variant may differ in nucleotide substitutions, deletions or insertions of one or more nucleotides in the sequence that do not impair the promoter activity. The variant may have the same length as the original sequence, or may be shorter or longer.

[0083] In one embodiment, the functional variant has at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identity with SEQ ID NO: 1 or 2. In one embodiment, the functional variant may differ from SEQ ID NO: 1 or 2 by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 50, 100, 150, 200 or more 200 nucleotide substitutions, deletions and / or insertions.

[0084] In one embodiment, the functional variant is capable of hybridizing to the nucleotide sequence of SEQ ID NO: 1 or 2 or its complementary strand under low, medium or high stringency conditions.

[0085] The term "low stringency conditions" as used herein means that the probe is at least 100 nucleotides in length, prehybridized and hybridized in 5XSSPE, 0.3% SDS, 200 micrograms / mL sheared and denatured salmon sperm DNA and 25% formamide at 42°C, followed by a standard Southern blotting procedure for 12 to 24 hours. The carrier material is finally washed three times with 2X SSC, 0.2% SDS at 50°C for 15 minutes each time.

[0086] The term "moderate stringency conditions" as used herein means that the probe is at least 100 nucleotides in length, prehybridized and hybridized in 5XSSPE, 0.3% SDS, 200 micrograms / mL sheared and denatured salmon sperm DNA and 35% formamide at 42°C, followed by a standard Southern blotting procedure for 12 to 24 hours. The carrier material is finally washed three times with 2XSSC, 0.2% SDS at 55°C for 15 minutes each time.

[0087] The term "high stringency conditions" as used herein means that the probe is at least 100 nucleotides in length, prehybridized and hybridized in 5XSSPE, 0.3% SDS, 200 micrograms / mL sheared and denatured salmon sperm DNA and 50% formamide at 42°C, followed by a standard Southern blotting procedure for 12 to 24 hours. The carrier material is finally washed three times with 2X SSC, 0.2% SDS at 65°C for 15 minutes each time.

[0088] Expression cassette of the present invention

[0089] The present disclosure provides an expression cassette comprising the isolated nucleic acid of the present invention. In one embodiment, the expression cassette further comprises a target nucleic acid operably linked to the isolated nucleic acid of the present invention.

[0090] The term "expression cassette" used herein refers to a nucleic acid construct comprising one or more control sequences required for the expression of a coding sequence and the coding sequence. In particular, one of these control sequences is a promoter of the present invention. Typically, the expression cassette comprises the coding sequence required for expressing a selected gene product and regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. Therefore, the expression cassette typically comprises a promoter sequence, a coding sequence, and a 3' non-translated region that typically contains a polyadenylation site and / or a transcription terminator. The expression cassette may also include other regulatory elements, such as an enhancer sequence, a multiple cloning site sequence and / or a splicing signal sequence that is convenient for the insertion of a DNA fragment in a vector. The expression cassette is typically contained in a vector for ease of cloning and transformation.

[0091] In a preferred embodiment, the target nucleic acid is a heterologous nucleic acid. The term "heterologous" as used herein means a nucleic acid other than the nucleic acid to which the promoter is operably linked in a naturally occurring genome. In particular, in certain embodiments, the promoter of the present invention is not operably linked to an Lgr5 gene, particularly a human Lgr5 gene.

[0092] In one embodiment, the target nucleic acid is a nucleic acid encoding a target polypeptide. The target polypeptide can be any polypeptide that needs to be expressed in retinal amacrine cells or Muller cells. In particular, the target polypeptide can be a transcription factor, a therapeutic protein, an optogenetic driver protein, or a reporter protein.

[0093] In one embodiment, the target polypeptide is a transcription factor that promotes the transdifferentiation of retinal amacrine cells into ganglion cells. In another embodiment, the target polypeptide is a transcription factor that promotes the transdifferentiation of Muller cells into ganglion cells. Examples of the transcription factors include, but are not limited to, Atoh7, brn3b, sox4, Isl1, sox11, and any combination thereof.

[0094] In one embodiment, the target nucleic acid is a therapeutic gene, ie, a gene encoding a therapeutic protein.

[0095] The term "therapeutic gene" as used herein refers to a gene encoding a therapeutic protein useful in the treatment of a pathological condition. The therapeutic gene, when expressed, provides a beneficial effect to the cells or tissues in which it is present or to the patient in which the gene is expressed in the body. Examples of beneficial effects include improvement of signs or symptoms of a condition or disease, prevention or inhibition of a condition or disease, or provision of a desired characteristic. Therapeutic genes include genes that partially or completely correct genetic defects in patients. In particular, the therapeutic gene may be, but is not limited to, a nucleic acid sequence encoding a protein useful in gene therapy to alleviate defects caused by the absence, defect or suboptimal level of the protein in the cells or tissues of the subject. The therapeutic polypeptide may, for example, provide polypeptides and / or enzyme activities that are absent, defective or present at suboptimal levels in retinal amacrine cells or Muller cells, providing polypeptides and / or enzyme activities that indirectly offset imbalances in retinal amacrine cells or Muller cells. The therapeutic polypeptide may also be used to reduce the activity of a polypeptide by, for example, acting as a dominant negative polypeptide. Preferably, the therapeutic polypeptide provides a polypeptide and / or enzyme activity that is absent, deficient or present at a suboptimal level in retinal amacrine cells or Muller cells, more preferably a polypeptide and / or enzyme activity that is absent or deficient in retinal amacrine cells or Muller cells.

[0096] Examples of therapeutic genes include, but are not limited to, nucleic acids used to replace deleted or mutated genes known to cause retinal diseases, such as MT-ND4 (Gene ID: 4538), MT-ND1 (Gene ID: 4535), MT-ND6 (Gene ID: 4541), MT-CYB (Gene ID: 4519), MT-CO3 (Gene ID: 4514), MT-ND5 (Gene ID: 4540), MT-ND2 (Gene ID: 4536), MT-COI (Gene ID: 4512), MT-ATP6 (Gene ID: 4508), MT-ND4L (Gene ID: 4539), OPA1 (Gene ID: 4976), OPA3 (Gene ID: 80207), OPA7 (Gene ID: 84233) and ACO2 (Gene ID: 50).

[0097] The therapeutic gene can also encode neurotrophic factors, such as GDNF (Gene ID: 2668), CNTF (Gene ID: 1270), FGF2 (Gene ID: 2247), BDNF (Gene ID: 627) and EPO (Gene ID: 2056), anti-apoptotic genes such as BCL2 (Gene ID: 596) and BCL2L1 (Gene ID: 598), anti-angiogenic factors such as endostatin, angiostatin and sFlt, anti-inflammatory factors such as IL10 (Gene ID: 3586), IL1R1 (Gene ID: 3554), TGFBI (Gene ID: 7045) and IL4 (Gene ID: 3565), or rod-derived cone activity factor (RdCVF) (Gene ID: 115861).

[0098] Additional signal peptides may be added to therapeutic proteins, in particular in order to import them into certain organelles (eg mitochondria), to secrete them from the cell, or to insert them into the cell membrane.

[0099] In one embodiment, the target polypeptide is a tool enzyme used in a gene editing method. In one embodiment, the target polypeptide is a Cas9 protein.

[0100] In one embodiment, the target polypeptide is an optogenetic driver protein. The term "optogenetic driver protein" as used herein refers to a photochemically reactive polypeptide that uses vitamin A or its isoforms as a chromophore. Optogenetic driver proteins are light-gated ion pumps or channels that absorb light and are activated by light. The optogenetic driver protein can be from a prokaryotic organism or a eukaryotic organism. In particular, it can be a microbial opsin or a vertebrate opsin. The optogenetic driver protein can be an optogenetic activator or an optogenetic inhibitor.

[0101] Optogenetic activators cause cells to depolarize after being exposed to light. When cells depolarize, the internal negative charge of cells becomes positive in a short term. The transition of the cell's internal environment from negative to positive allows both transmission of electrical pulses in cells and optionally between cells. The example of optogenetic activators includes but is not limited to rhodopsin, photopsin, melanopsin, pinealopsin, pinealopsin, VA opsin, periopsin, neuroopsin, brainopsin, retinal pigment, RGR opsin, microbial opsin (such as ReaChR, Chrimson or ChrimsonR) with red-shifted spectral properties, vertebrate opsin (such as short-wavelength vertebrate opsin or long-wavelength vertebrate opsin) summoning Gi / o signal transduction, channelrhodopsin (such as channelrhodopsin-1 and channelrhodopsin-2, from Chlamydomonas reinhardtii) and variants of the above-mentioned proteins from Chlamydomonas microalgae. A large number of variants of channelrhodopsin (such as codon-optimized variants, mutants, chimeras) are constantly produced to improve some features of these proteins. Examples of such variants include, but are not limited to, hChR2(L132C), ChR2(H134R), ChETA(E123T), C1V1(E122T), C1V1(E162T), C1V1(E122 / 162T), hChR2(C128A), hChR2(C128S), hChR2(C128T), hChR2(C128A / H134R), hCatch(T 159S), hChief, hChR2(C128S / D156A), hChR2(T159C), hChR2(E123T / T159C), hChR2c(C128T), ChR2c(C128T), ChR2e(Q117C) and SwitChR (for review, see Prakash et al., Nat Methods. 2012 Dec;9(12):1171-9).

[0102] Optogenetic inhibitors cause cell hyperpolarization after exposure to light. When a cell hyperpolarizes, the internal negative charge of the cell becomes more negative in the short term. The shift to a more negative level inhibits the action potential by increasing the stimulus required to shift the membrane potential toward the action potential threshold. In a particular embodiment, the optogenetic inhibitor is a light-gated ion pump that transports chloride ions inward and / or cations outward after absorbing photons. Any suitable light-gated, retina-dependent ion pump that transports chloride ions inward or cations outward after absorbing photons can be used as an optogenetic inhibitor. Examples of optogenetic inhibitors include, but are not limited to, halorhodopsins such as halorhodopsin (NpHR), enhanced halorhodopsin (eNpHR2.0 and eNpHR3.0) and red-shifted halorhodopsin Halo57, archaeal rhodopsin-3 (AR-3), archaeal rhodopsin (Arch), bacterial rhodopsins such as enhanced bacterial rhodopsin (eBR), proteobacterial rhodopsin, xanthomonas rhodopsin, Microcystis punctata fungal opsin (Mac), great white shark cross halorhodopsin, and variants of the above proteins.

[0103] In a particularly preferred embodiment, the optogenetic driver protein is an optogenetic activator, preferably selected from channelrhodopsin, ChrimsonR and variants thereof.

[0104] In one embodiment, the target polypeptide is a reporter protein. Preferably, the reporter protein is detectable in living retinal amacrine cells or Muller cells. The expression of the reporter protein under the control of the promoter of the present invention allows specific detection or identification of retinal amacrine cells or Muller cells. The reporter protein can be, for example, a fluorescent protein (such as GFP), a calcium indicator (such as GCamP), a luciferase, an alkaline phosphatase, a β-galactosidase, a β-lactamase, a horseradish peroxidase and variants thereof. In a specific embodiment, the reporter protein is selected from a fluorescent protein, a calcium indicator, an alkaline phosphatase, a β-galactosidase, a β-lactamase, a horseradish peroxidase and variants thereof.

[0105] In one embodiment, the target nucleic acid encodes any nucleic acid that needs to be expressed, for example, any nucleic acid that needs to be expressed in retinal amacrine cells or Muller cells. In particular, the nucleic acid that needs to be expressed can be a therapeutic nucleic acid. In one embodiment, the therapeutic nucleic acid is selected from siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozymes and deoxyribozymes (DNAzyme). In a specific embodiment, the target nucleic acid, when transcribed by the promoter of the present invention, can treat or prevent the disease by interfering with the translation or transcription of abnormal or excessive proteins associated with eye diseases. For example, the target nucleic acid can encode an RNA that treats the disease by highly specifically eliminating or reducing mRNA encoding abnormal and / or excessive proteins.

[0106] The vector of the present invention

[0107] The present disclosure provides a vector comprising a promoter or an expression cassette according to the present invention.

[0108] The term "vector" as used herein refers to a nucleic acid molecule used as a medium to transfer genetic material in vitro or in vivo, particularly to deliver nucleic acid to a host cell. Examples of vectors include, but are not limited to, plasmids, phagemids, cosmids, transposable elements, viruses, and artificial chromosomes (e.g., YACs). Preferably, the vector of the present invention is a vector suitable for gene or cell therapy, particularly a vector suitable for targeting retinal amacrine cells or Muller cells.

[0109] The vector of the present invention is preferably a viral vector, which includes any elements required to establish expression of the target polypeptide in a host cell, such as a promoter of the present invention, an additional promoter, ITRs, ribosome binding elements, terminators, enhancers, selection markers, introns, polyA signals and / or replication origins.

[0110] In certain embodiments, the vector is a viral vector, such as a vector derived from Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV or SNV, a lentiviral vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector, a simian virus 40 (SV-40) vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, a herpes virus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a mouse mammary tumor virus vector or a Rous sarcoma virus vector. In a specific embodiment, the vector is a retroviral vector, preferably a lentiviral vector, or a non-pathogenic parvoviral vector. As is known in the art, depending on the specific viral vector considered for use, appropriate sequences should be introduced into the vector of the invention to obtain a functional viral vector, such as AAV ITRs for AAV vectors or LTRs for lentiviral vectors. In one embodiment, the vector is an adeno-associated virus (AAV) vector.

[0111] Human parvovirus adeno-associated virus (AAV) is a dependent virus that is naturally defective in replication and can be integrated into the genome of infected cells to establish a latent infection. The last property seems to be unique among mammalian viruses because the integration occurs at a specific site (19q13.3-qter) called AAV S1 on chromosome 19 in the human genome. Therefore, AAV has aroused considerable interest as a potential vector for human gene therapy. The favorable properties of the virus include its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the ability to infect a wide range of cell lines derived from different tissues. The term "AAV vector" used herein refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequences that are not AAV-derived), and the heterologous sequence is flanked by at least one AAV terminal inverted repeat sequence (ITR), preferably two ITRs. This AAV vector can be replicated and packaged in infectious virus particles when present in a host cell that has been infected with a suitable helper virus (or a virus expressing a suitable helper virus function) and expresses AAVrep and cap gene products (i.e., AAV Rep and Cap proteins). "Terminal inverted repeats" or "ITR" sequences are well-known terms in the art and refer to relatively short sequences that are present at the ends of the viral genome and in opposite directions. The "AAV terminal inverted repeat (ITR)" sequence is a sequence of about 145 nucleotides present at both ends of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can exist in either of two optional orientations, causing heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter self-complementary regions (referred to as A, A', B, B', C, C and D regions), allowing intrachain base pairing to occur within this portion of the ITR. The AAV ITR used in the vector of the present invention may have a wild-type nucleotide sequence, or may be altered by insertion, deletion or substitution. The serotype of the inverted terminal repeat sequence (ITR) of the AAV vector may be selected from any known human or non-human AAV serotype. The promoter or expression cassette of the present invention may be introduced into the vector by any method known to the skilled person.

[0112] The vector may also include one or more nucleic acid sequences encoding selectable markers such as auxotrophic markers (e.g., LEU2, URA3, TRP 1 or HIS3), detectable tags such as fluorescent or luminescent proteins (e.g., GFP, eGFP, DsRed, CFP) or proteins providing resistance to chemical / toxic compounds (e.g., the MGMT gene providing resistance to temozolomide). These markers may be used to select or detect host cells comprising the vector and may be easily selected by a skilled person according to the host cell.

[0113] Virus particles of the present invention

[0114] The present disclosure provides a viral particle comprising a vector according to the present invention.

[0115] In a specific embodiment, the vector is an AAV vector and is packaged in an AAV-derived capsid to produce an "adeno-associated virus particle" or "AAV particle". Therefore, the term "AAV particle" used herein refers to a virus particle composed of at least one AAV capsid protein and an encapsidated AAV vector genome. AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj, etc. In addition, non-natural engineered variants and chimeric AAVs may also be useful. In particular, the capsid protein may be a variant comprising one or more amino acid substitutions that enhance transduction efficiency. In one embodiment, the capsid is preferably selected from AAV-2, AAV-5, AAV2-7m8, AAV-9 and AAV-8 serotype capsids, more preferably an AAV-2 derived capsid such as an AAV-2 or AAV2-7m8 capsid.

[0116] Different AAV serotypes are used to optimize the transduction of specific target cells or to target specific cell types (e.g., retinal amacrine cells or Muller cells) within specific target tissues. AAV particles can contain viral proteins and viral nucleic acids of the same serotype or any natural or artificial sequence variants of AAV. For example, the AAV particles can contain AAV2 capsid proteins and at least one, preferably two AAV2 ITRs. Any combination of AAV serotypes for producing AAV particles is provided herein. AAV viruses can be engineered using conventional molecular biology techniques so that these particles can be optimized for cell-specific delivery of nucleic acid sequences, for minimizing immunogenicity, for regulating stability and particle lifespan, for efficient degradation, and / or for accurate delivery to the nucleus.

[0117] A large number of methods are known in the art for producing viral particles, particularly AAV particles, including transfection, stable cell line production and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpes virus-AAV hybrids (Conway, JE et al., (1997) Virology 71(11):8780-8789) and baculovirus-AAV hybrids. AAV production cultures for producing AAV viral particles require: 1) suitable host cells, including, for example, cell lines of human origin such as HeLa, A549 or 293T cells, or in the case of a baculovirus production system, cell lines of insect origin such as SF-9; 2) suitable helper virus functions, which are provided by wild-type or mutant adenovirus (e.g., temperature-sensitive adenovirus), herpes virus, baculovirus, or plasmid constructs that provide helper virus functions; 3) AAV rep and cap genes and gene products; 4) a target nucleic acid flanked by at least one AAV ITR sequence, such as a vector of the present invention; and 5) suitable culture medium and culture medium components that support AAV production as is known in the art.

[0118] In the present invention, host cells for producing AAV particles include mammalian cells, insect cells, plant cells, microorganisms and yeast. The host cell can be a packaging cell in which the AAV rep and cap genes are stably maintained in the host cell or a production cell in which the AAV vector genome is stably maintained. Exemplary packaging and production cells are derived from 293T, A549 or HeLa cells. The AAV particles are then purified and formulated using standard techniques known in the art.

[0119] Cells of the present invention

[0120] The present disclosure provides a cell comprising an isolated nucleic acid, expression cassette, vector or viral particle according to the present invention, or transformed with an isolated nucleic acid, expression cassette, vector or viral particle according to the present invention. The cell can be any animal cell, plant cell, bacterial cell or yeast. Preferably, the cell is a mammalian cell or an insect cell. More preferably, the cell is a human cell. In one embodiment, the cell is a retinal amacrine cell or a Muller cell.

[0121] The nucleic acid, expression cassette, vector or viral particle of the invention can be transferred into the host cell using any known technique, including but not limited to calcium phosphate-DNA precipitation, DEAE-Dextran transfection, electroporation, microinjection, gene gun, lipofection or viral infection, and the nucleic acid, expression cassette, vector or viral particle of the invention can be maintained in the host cell in an ectopic form, or can be integrated into the genome. In a preferred embodiment, the nucleic acid, expression cassette, vector or viral particle of the invention is transferred into the cell by viral infection, preferably using the viral particle of the invention, more preferably using the AAV particle of the invention.

[0122] Pharmaceutical composition

[0123] The present disclosure provides a pharmaceutical composition comprising an isolated nucleic acid, an expression cassette, a vector, a viral particle or a cell according to the present invention, and a pharmaceutically acceptable excipient.

[0124] As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency or recognized pharmacopoeia for use in animals and / or humans. The term "excipient" refers to a diluent, adjuvant, carrier or vehicle with which a therapeutic agent is administered.

[0125] As is well known in the art, pharmaceutically acceptable excipients are relatively inert substances that facilitate the administration of pharmacologically effective substances, and can be provided as liquid solutions or suspensions, emulsions, or solid forms suitable for dissolving or suspending in liquids before use. For example, excipients can provide shape or consistency, or act as diluents. Suitable excipients include, but are not limited to, stabilizers, wetting and emulsifying agents, salts for changing osmotic pressure, encapsulating agents, pH buffer substances, and buffers. Suitable excipients include any medicament suitable for direct delivery to the eye, which can be administered without excessive toxicity. Pharmaceutically acceptable excipients include, but are not limited to, any one of sorbitol, various tween compounds, and liquids such as water, saline, glycerol, and ethanol. Pharmaceutically acceptable salts can be included, such as inorganic acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, etc., and salts of organic acids such as acetates, propionates, malonates, benzoates, etc. A full discussion of pharmaceutically acceptable excipients can be obtained in Remington's Pharmaceutical Sciences, 15th edition.

[0126] Preferably, the composition is formulated for administration to the eye, in particular by intraocular injection, such as by subretinal and / or intravitreal administration. Thus, the composition can be administered with a pharmaceutically acceptable excipient such as saline, Ringer's balanced salt solution (pH 7.4), etc.

[0127] The pharmaceutical compositions described herein may be packaged in unit-dose or multi-dose form.

[0128] In another embodiment, the pharmaceutical composition comprises cells of the present invention, preferably human cells of the present invention, i.e. cells transformed or transfected with expression cassettes, vectors or viral particles of the present invention, preferably AAV particles. Optionally, the composition comprising cells can be stored frozen at any temperature suitable for storing cells. For example, the cells can be frozen at about -20°C, -80°C or any other suitable temperature. Cryogenically frozen cells can be stored in suitable containers and prepared for storage to reduce the risk of cell damage and maximize the possibility of survival when the cells are thawed. Alternatively, the cells can also be maintained at refrigerated room temperature, such as about 4°C.

[0129] The amount of the pharmaceutical composition to be administered can be determined by standard procedures known to those skilled in the art. To determine a suitable dose, the patient's physiological data (e.g. age, size and weight) and the type and severity of the disease to be treated must be taken into account. In a specific embodiment, the composition comprises the viral particles of the invention, and each unit dose comprises 10 8 Up to 10 13 Virus particles, preferably 10 9 Up to 10 12 The pharmaceutical composition may further comprise one or more other active compounds such as corticosteroids, antibiotics, analgesics, immunosuppressants, nutritional factors or any combination thereof.

[0130] Treatments and indications

[0131] The present disclosure provides a method of treating an eye disease comprising administering to a patient in need thereof a therapeutically effective amount of an isolated nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition according to the present invention.

[0132] As described above, the promoter of the present invention can efficiently drive gene expression in retinal amacrine cells or Muller cells, such as the expression of important transcription factors required for ganglion cell development, thereby promoting the transdifferentiation of retinal amacrine cells or Muller cells into ganglion cells. Therefore, in one aspect, the eye disease can be a disease associated with retinal ganglion cell degeneration.

[0133] Examples of diseases associated with retinal ganglion cell degeneration include, but are not limited to, hereditary optic neuropathies (Leber's hereditary optic neuropathy, dominant optic neuropathy), compressive optic neuropathies (orbital pseudotumor, thyroid eye disease), autoimmune optic neuropathies (lupus), diabetic retinopathy, glaucomatous optic neuropathy (GOND), glaucoma, arterial ischemic optic neuropathy (giant cell arteritis), non-arteritic ischemic optic neuropathy, infiltrative optic neuropathy (sarcoidosis), infectious optic neuropathies (syphilis, Lyme disease, toxoplasmosis, herpes zoster), optic neuritis from demyelinating diseases, and post-irradiation optic neuropathy.

[0134] In a preferred embodiment, the eye disease is selected from Leber's hereditary optic neuropathy and dominant optic neuropathy, preferably selected from optic atrophy, optic atrophy and cataract, and optic atrophy with or without auditory neuropathy, and the target polypeptide is selected from MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7 and ACO2.

[0135] Retinal neurodegenerative diseases such as retinitis pigmentosa and age-related macular degeneration eventually end with the degeneration and apoptosis of retinal photoreceptor cells, resulting in irreversible damage to vision. In the study and treatment of retinal neurodegenerative diseases, cell-specific promoters play an important role. These promoters have the ability to specifically initiate gene expression in eye cells and can be used to precisely regulate the expression of therapeutic genes. By utilizing these specific promoters, it is expected to play an important role in the treatment of retinal neurodegenerative diseases. Optogenetic gene therapy is a treatment strategy that has attracted widespread attention in recent years, especially showing great potential in the study of retinal neurodegenerative diseases. This method uses light-sensitive proteins, such as light-sensitive ion channels or receptors, to introduce their encoded genes into retinal amacrine cells or Muller cells, and regulate the activity of these proteins through light stimulation. This strategy can achieve precise manipulation of retinal amacrine cells or Muller cells in vivo, and is expected to make breakthrough progress in restoring visual function.

[0136] Therefore, in another aspect, the promoter of the present invention can efficiently drive gene expression in retinal amacrine cells or Muller cells, such as expressing proteins with photosensitivity, so that blind animals or patients regain vision. After the death of ganglion cells due to pathological changes, other cells in the retina, such as retinal amacrine cells or Muller cells, still persist for a long time. Therefore, retinal amacrine cells or Muller cells constitute a therapeutic target for restoring the retina using optogenetics. In this case, retinal amacrine cells or Muller cells are cell targets independent of degenerated cells, in which the expression of photosensitive proteins, i.e., optogenetic drivers, in a strong and restricted manner is essential for the success of vision restoration. Therefore, in another embodiment, the eye disease is a disease associated with photoreceptor cell degeneration. Preferably, in this embodiment, the target polypeptide is an optogenetic driver protein as described above, and the treatment is optogenetic treatment. Examples of diseases associated with photoreceptor cell degeneration include, but are not limited to, retinitis pigmentosa, age-related macular degeneration, Stargardt's disease, cone-rod dystrophy, Leber's congenital amaurosis, diabetic retinopathy, retinal detachment, Best's disease, choroideremia, and tapetal retinal degeneration.

[0137] Alternatively, the eye disease is selected from diseases that are not necessarily associated with retinal ganglion cell or photoreceptor cell degeneration but can be treated or prevented by specifically expressing a nucleic acid encoding a polypeptide or nucleic acid of interest in retinal ganglion cells.

[0138] The term "treatment" as used herein refers to any action intended to improve the patient's health, such as therapy, prevention, prevention and retardation of the disease. In certain embodiments, this term refers to the improvement or eradication of a disease or a symptom associated with the disease. In other embodiments, the term refers to the minimization of the spread or deterioration of the disease caused by administering one or more therapeutic agents to a subject suffering from the disease. In particular, the term "treatment of eye diseases" may refer to providing improved vision, preventing the disease from developing to complete blindness, preventing damage from spreading to uninjured eye cells, improving damage in injured eye cells, preventing the occurrence of retinal damage, or saving the treatment of an eye with mild or advanced disease. In certain embodiments, the term refers to the treatment of preventing, alleviating, stopping or restoring retinal ganglion cell degeneration by providing a therapeutic protein that corrects the patient's genetic defects. In certain other embodiments, the term refers to the treatment of restoring the retina or restoring vision using optogenetics.

[0139] As used herein, "therapeutically effective amount" means an amount of a nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition of the invention administered to a subject sufficient to constitute a treatment for an eye disease as defined above. The nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition may be administered as a single dose or in multiple doses.

[0140] In the method for treating an eye disease of the present invention, the nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition of the present invention is preferably administered intraocularly, more preferably by subretinal or intravitreal administration.

[0141] The method of the present invention may further comprise administering to the subject at least one additional therapeutic agent. In particular, the therapeutic agent may be selected from corticosteroids, antibiotics, analgesics, immunosuppressants or nutritional factors or any combination thereof.

[0142] The nucleic acids, expression cassettes, vectors, viral particles, cells or pharmaceutical compositions of the invention can be administered before or after the disease becomes symptomatic, e.g., before or after partial or complete degeneration of retinal ganglion cells or photoreceptor cells and / or before or after partial or complete loss of vision.

[0143] Therefore, the promoter of the present invention has application prospects in at least the following aspects:

[0144] -Use this promoter to express important transcription factors in the development of ganglion cells in retinal amacrine cells or Muller cells, so that retinal amacrine cells or Muller cells can be transdifferentiated into ganglion cells, thereby treating retinal neurodegenerative diseases such as glaucoma.

[0145] -Use this promoter to express therapeutic proteins, such as photosensitive proteins, in retinal amacrine cells or Muller cells, thereby treating retinal neurodegenerative diseases.

[0146] -Using this promoter to design gene expression vectors, gene therapy and gene regulation of specific cell populations can be achieved.

[0147] -Using this promoter for gene editing technology, precise editing and regulation of specific cell populations can be achieved.

[0148] The following examples partly provide further details about various specific embodiments. It will be appreciated by those skilled in the art that the disclosed technology in the following examples represents the technology and / or composition that the inventor has found to work well. However, according to the present invention, it will be appreciated by those skilled in the art that many modifications may be made to the disclosed specific embodiments without departing from the spirit and scope of the present invention, and these modifications still may obtain similar or approximate results. These embodiments are merely for illustrative purposes, rather than to limit the scope of the present invention.

[0149] Example 1: Verification of Lgr5 gene expression in mouse retina

[0150] Lgr5 EGFP-IRES-CreERT2 and Rosa26 CAG-LSL-tdTomato The mouse strain was purchased from Jackson Laboratory. The two mouse strains were hybridized to obtain Lgr5 EGFP-IRES-CreERT2 Rosa26 CAG-LSL-tdTomato All mice were housed in an SPF animal facility with a 12-h light and 12-h dark cycle.

[0151] After 8-week-old mice were gavaged with tamoxifen (0.2 mg / g body weight) 4 times, the amacrine cells in the retina were able to express the green fluorescent protein EGFP and the red fluorescent protein tdTomato, so that the amacrine cells showed yellow fluorescence, that is, the amacrine cells were marked by yellow fluorescence. Figure 1 .

[0152] Example 2: Expression vector construction

[0153] The human Lgr5 promoter sequence SEQ ID NO: 1 was synthesized at Nanjing GenScript Biotech Co., Ltd., and the reporter gene EGFP was cloned into the AAV2 expression vector driven by the promoter.

[0154] AAV-human Lgr5 promoter-EGFP construct schematic diagram is shown in Figure 2 .

[0155] Example 3: Verification of promoter activity in HEK293T cells

[0156] HEK293T cells (human embryonic kidney cell line) were transfected in vitro with AAV-human Lgr5 promoter-EGFP plasmid. Two days later, imaging revealed that the reporter gene EGFP was highly expressed in this cell line (see Figure 3 ), indicating that the promoter sequence has the potential to express certain genes, especially in humans.

[0157] Example 4: Verification of promoter activity in mice

[0158] AAV-human Lgr5 promoter-EGFP AAV particles (AAV2 / 7m8) were produced by Heyuan Biotechnology (Shanghai) Co., Ltd. Wild-type C57 mice (12 weeks old, male) were selected for subvitreous injection, and the dosage was 1.5×10 9 Virus particles (VG) / eye (1.5ul, 1×10 12 VG / ml). Specifically, mice were anesthetized by intraperitoneal injection of a mixture of ketamine (80 mg / kg) and xylazine (8 mg / kg). After the mice were anesthetized, benlephrine hydrochloride eye drops (2.5%) were dripped onto the surface of the eyes to dilate the pupils of the mice, and 0.5% procaine hydrochloride eye drops were used to briefly anesthetize the surface of the animal's eyes, and then a sterile needle was used to puncture a small hole at the edge of the cornea to release aqueous humor and reduce intraocular pressure. A 34-gauge needle was used to inject 1.5u1 of AAV virus particle suspension into the vitreous cavity.

[0159] Imaging 2 weeks later revealed that EGFP was highly and relatively specifically expressed in retinal amacrine cells (see Figure 4 C, thin arrows), and is also expressed in Muller cells (see Figure 4 C, as indicated by thick arrows). Figure 4 A) and optic nerve ( Figure 4 B) Confocal imaging showed that the promoter was expressed relatively little in retinal ganglion cells.

[0160] Additional verification experiments:

[0161] Construction of another vector AAV-human Lgr5 promoter-hSOX4-P2A-EGFP, see Figure 5 A. The promoter of the present invention was used to express the human sox4 gene (SEQ ID NO: 4), and the reporter gene EGFP behind the gene was used to indicate its expression. AAV particles (AAV2 / 7m8) were produced by Heyuan Biotechnology (Shanghai) Co., Ltd. Wild-type C57 mice (12 weeks old, male) were selected for subvitreal injection and the dosage was 1.5×10 9 Virus particles (VG) / eye (1.5ul, 1×10 12 VG / ml). Specifically, mice were anesthetized by intraperitoneal injection of a mixture of ketamine (80 mg / kg) and xylazine (8 mg / kg). After the mice were anesthetized, phenylephrine hydrochloride eye drops (2.5%) were dripped onto the surface of the eyes to dilate the pupils of the mice, and 0.5% procaine hydrochloride eye drops were used to briefly anesthetize the surface of the animal's eyes, and then a sterile needle was used to puncture a small hole at the edge of the cornea to release aqueous humor and reduce intraocular pressure. A 34-gauge needle was used to inject 1.5u1 of AAV virus particle suspension into the vitreous cavity.

[0162] Imaging 2 weeks later revealed that SOX4 was highly and relatively specifically expressed in retinal amacrine cells (see Figure 5 B, thin arrows), and is also expressed in Muller cells (thick arrows).

[0163] Example 5: Effects of promoter expression of reporter gene on mouse ERG and VEP

[0164] AAV particles containing AAV-human Lgr5 promoter-EGFP as described in Example 4 were injected into the subvitreal cavity of wild-type C57 mice for more than 7 weeks, and then ERG and VEP tests were performed.

[0165] Specifically, C3H mice were dark-adapted for 12 hours in advance after 7 weeks of administration, and the mice were anesthetized by intraperitoneal injection of Zoletil (25 mg / kg) and xylazine (2.5 mg / kg). A drop of phenylephrine hydrochloride eye drops (2.5%) was dripped on the mouse eyes. After the mouse pupils were dilated, the corneal electrode was close to the cornea, and the reference electrode was fixed near the mouse tail and the mouse eyelids. EGR data was collected (a wave + b wave) using a light intensity of 0.1 cd*s / m2. Subsequently, the recording electrode was inserted into the visual cortex of the mouse brain for VEP testing (visual evoked potential).

[0166] The results showed that the expression of the reporter gene using this promoter did not cause significant changes in the waveform and amplitude of the mouse's own ERG (a wave + b wave) and VEP (N1) (see Figure 6 ), indicating that when using this promoter to express the target protein in retinal ganglion cells, regardless of the protein gene factor, the promoter activity itself is safe.

[0167] Example 6: Verification of the efficacy of human SOX4 after subvitreal injection of AAV in glaucomatous C57 mice

[0168] The glaucoma mouse model was established by increasing intraocular pressure through retinal ischemia-reperfusion (I / R) to induce retinal ganglion cell damage. The intraocular pressure was temporarily increased by perfusing normal saline into the anterior chamber, which reduced the blood flow to the optic nerve head, causing structural and functional damage, leading to irreversible rupture of retinal ganglion cell axons and inducing glaucoma.

[0169] The retinal ischemia reperfusion method is briefly described as follows: anesthetize mice with 1% sodium pentobarbital (10 μl / g) by intraperitoneal injection, drip a drop of phenylephrine hydrochloride eye drops (2.5%) on the mouse's eyes, and place the mouse under a stereo microscope after the mouse pupil is dilated. Raise the mouse's head to the level of the eye's corneal limbus, and drip a drop of 0.5% proparacaine hydrochloride eye drops on the mouse's eyes for a short period of surface anesthesia. Insert a No. 7 scalp needle connected to a saline infusion tube into the mouse's anterior chamber, and raise the saline to 150 cm above the eye (to prevent saline from overflowing from the needle hole. If liquid overflows, it means that the operation is unsuccessful and the mouse needs to be replaced for reperfusion), causing blood flow in the retina to stop (ischemia) and the red reflection of the fundus to disappear. Remove the scalp needle after 60 minutes of perfusion. This operation can cause axonal degeneration of almost all retinal ganglion cells and death of a few other retinal neurons.

[0170] After retinal ischemia and reperfusion, AAV particles of AAV-human Lgr5 promoter-hSOX4-P2A-EGFP were administered to the glaucoma mouse model as described in Example 4. After 7 weeks, a light-dark box passive escape test was performed. In brief, the test mouse was placed on one side of the box, and the bottom of the box was electrically stimulated while the light was given (5s). If the mouse has good vision, it can escape to the adjacent box through the hole between the connected boxes; repeat this operation in the other box, and record the cycle for 3 minutes. The probability of successful escape of the mouse was counted.

[0171] like Figure 7 As shown, compared with the control group of glaucoma C57 mice, the probability of successfully escaping electrical stimulation in glaucoma C57 mice given AAV-human Lgr5 promoter-hSOX4-P2A-EGFP was increased, indicating that expressing human SOX4 in the retina of glaucoma mice using the human Lgr5 promoter can partially restore the vision of glaucoma mice.

[0172] Sequence information:

[0173] SEQ ID NO: 1: Promoter of the present invention

[0174] TAAACCACTTTTAAAAAACAAATGAGTCACTTCGACTTCCTCACCCCGCAAGAGATAGGAAGGCAGCAGTGGAGTGCTCGCTCAGGAGCTGTATTTGTTTAGCGATTAGCCTAGAGCTTTGATTTTAGGGCAAAAGCGAGCCAGACAGTGCGGCAGACGTAAGGATCAAAAAGGCCACCTATCATTCGCCGGGGACGCCTGCCTCCTTACCCTGATAACGTAACTATTTCTCTGCATAGGATTTTAGTTTTTGTGTTTTTGTTTTGTTTTATTCTGTTTAATCACTTCAAGTATCTCATCCATTATTTGAAGCGGGCTCGGAGGAAACGTGCCGCATCCTCCAGTCCTTGTGCGTCTGTTTAGGTCTCTCCGAAGCAGGTCCCTCTCGACTCTTAGATCTGGGTCTCCAGCACGCATGAAGGGGTAAGGGTGGGGGGGTCCCCTATTCCGGCGCGCGGCGTTGAGCACTGAATCTTCCAGGCGGAGGCTCAGTGGGAGCGCCGAGAACTCGCCAGTACCGCGCGCTGCCTGCTGCCTGCTGCCTCCCAGCCCAGGACTTGGGAAAGGAGGGAGGGGACAAGTGGAGGGAAAGTGGGGCCGGGCGGGGGGTGCCTGGGAAGCCAGGCTGCGCTGACGTCACTGGGCGCGCAATTCGGGCTGGAGCGCTTTAAAAAACGAGCGTGCAAGCAGAGATGCTGCTCCACACCGCTCAGGCCGCGAGCAGCAGCAAGGCGCACCGCCACTGTCGCCGCTGCAGCCAGGGCTGCTCCGAAGGCCGGCGTGGCGGCAACCGGCACCTCTGTCCCCGCCGCGCTTCTCCTCGCCGCCCACGCCGTGGGGTCAGGAACGCGGCGTCTGGCGCTGCAGACGCCCGCTGAGTTGCAGAAGCCCACGGAGCGGCGCCCGGCGCGCCACGGCCCGTAGCAGTCCGGTGCTGCTCTCCGCCCGCGTCCGGCTCGTGGCCCCCTACTTCGGGCACC

[0175] SEQ ID NO:2: CMV enhancer + promoter

[0176]

[0177] SEQ ID NO:3: CMV enhancer

[0178] GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG

[0179] SEQ ID NO:4: Human SOX4 nucleotide sequence

[0180]

Claims

1. An isolated nucleic acid having promoter activity in retinal amacrine cells, characterized in that The isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 1, or a functional variant having at least 80% identity with SEQ ID NO: 1; or The isolated nucleic acid consists of the nucleotide sequence of SEQ ID NO:1, or a functional variant having at least 80% identity with SEQ ID NO:

1.

2. The isolated nucleic acid according to claim 1, characterized in that The isolated nucleic acid has retinal amacrine cell-specific promoter activity; and / or The isolated nucleic acid has promoter activity in Muller cells.

3. The isolated nucleic acid according to claim 1 or 2, characterized in that The isolated nucleic acid further comprises an enhancer; optionally, the enhancer includes but is not limited to a cytomegalovirus (CMV) enhancer, a simian virus 40 (SV40) enhancer, an elongation factor 1 alpha (EF1 alpha) enhancer, an ubiquitin C (UbC) enhancer, or a locus control region (LCR) enhancer; or The isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 2, or a functional variant having at least 80% identity with SEQ ID NO: 2; or the isolated nucleic acid consists of the nucleotide sequence of SEQ ID NO: 2, or a functional variant having at least 80% identity with SEQ ID NO:

2.

4. An expression cassette, characterized in that The expression cassette comprises the isolated nucleic acid according to any one of claims 1 to 3; Optionally, the expression cassette further comprises a nucleic acid of interest operably linked to the isolated nucleic acid according to any one of claims 1-4.

5. The expression cassette according to claim 4, characterized in that The target nucleic acid is a nucleic acid encoding a target polypeptide, or the target nucleic acid encodes a nucleic acid selected from siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozyme and deoxyribozyme; Optionally, the target polypeptide is a transcription factor, a therapeutic protein, an optogenetic driver protein, or a reporter protein; Optionally, the transcription factor is selected from Atoh7, brn3b, sox4, Isl1 and sox11, and any combination thereof; Optionally, the therapeutic protein is selected from MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7, ACO2, GDNF, VEGF, CNTF, FGF2, BDNF, EPO, BCL2, BCL2L1, endostatin, angiostatin, sFlt, IL10, IL1R1, TGFBI, IL4 and RdCVF, and any combination thereof; Optionally, the optogenetic driver protein is an optogenetic activator, which is preferably selected from rhodopsin, photopsin, melanopsin, pinealopsin, parapinealopsin, VA opsin, periopsin, neuroopsin, brain opsin, retinal pigment, RGR opsin, microbial opsin with red-shifted spectral properties, vertebrate opsin that summons Gi / o signaling, channel rhodopsin from Chlamydomonas microalgae, and variants of the above proteins, and any combination thereof; or an optogenetic inhibitor, which is preferably selected from halophilic rhodopsin, archaeal rhodopsin, bacterial rhodopsin, sphaerocystis fungal opsin, great white shark cross halophilic rhodopsin, and variants of the above proteins, and any combination thereof; and / or Optionally, the reporter protein is selected from fluorescent protein, calcium indicator, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase and variants of the above proteins, and any combination thereof.

6. A carrier characterized in that The vector comprises the isolated nucleic acid according to any one of claims 1 to 3 or the expression cassette according to any one of claims 4 to 5; Optionally, the vector is a viral vector; Optionally, the vector is a retroviral vector or a parvoviral vector; or Optionally, the vector is a MoMLV vector, an MSCV vector, an SFFV vector, an MPSV vector, an SNV vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a simian virus 40 vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, a herpes virus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a mouse mammary tumor virus vector or a Rous sarcoma virus vector.

7. A virus particle characterized by The viral particle comprises the vector according to claim 6; Optionally, the vector is an AAV vector, preferably wherein the AAV serotype is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74 and AAVdj, more preferably selected from AAV-2, AAV-5, AAV2-7m8, AAV-9 and AAV-8, more preferably AAV-2 or AAV2-7m8.

8. A cell characterized by The cell comprises the isolated nucleic acid of any one of claims 1-3, the expression cassette of any one of claims 4-5, the vector of claim 6 or the viral particle of claim 7; Optionally, the cell is a retinal amacrine cell or a Muller cell.

9. A pharmaceutical composition characterized in that The pharmaceutical composition comprises the isolated nucleic acid according to any one of claims 1-3, the expression cassette according to any one of claims 4-5, the vector according to claim 6, the viral particle according to claim 7 or the cell according to claim 8, and a pharmaceutically acceptable excipient.

10. Use of the isolated nucleic acid according to any one of claims 1 to 3, the expression cassette according to any one of claims 4 to 5, the vector according to claim 6, the viral particle according to claim 7, the cell according to claim 8 or the pharmaceutical composition according to claim 9 in the preparation of a medicament for treating an eye disease; Optionally, the eye disease is a disease associated with retinal ganglion cell degeneration; Optionally, the eye disease is selected from hereditary optic neuropathy, compressive optic neuropathy, autoimmune optic neuropathy, diabetic retinopathy, glaucomatous optic neuropathy, glaucoma, arterial ischemic optic neuropathy, non-arteritic ischemic optic neuropathy, infiltrative optic neuropathy, infectious optic neuropathy, optic neuritis from demyelinating disease, and post-irradiation optic neuropathy; Optionally, the eye disease is a disease associated with photoreceptor cell degeneration; or Optionally, the eye disease is selected from retinitis pigmentosa, age-related macular degeneration, Stargardt's disease, cone-rod dystrophy, Leber's congenital amaurosis, diabetic retinopathy, retinal detachment, Best's disease, choroideremia, and tapetal retinal degeneration.

11. An in vitro method for expressing a target polypeptide or nucleic acid in retinal amacrine cells or Muller cells, characterized in that the method comprises introducing the isolated nucleic acid according to any one of claims 1 to 3, the expression cassette according to any one of claims 4 to 5, the vector according to claim 6 or the viral particle according to claim 7 into retinal amacrine cells or Muller cells.

Images