An lncRNA inhibitor and its application in the preparation of a medicament for treating glaucoma
By developing inhibitors targeting lncRNA, the expression of TGF-β2 signaling pathway is inhibited, and the problem of difficulty in effectively controlling intraocular pressure in glaucoma patients in the prior art is solved, and the effect of reducing intraocular pressure and treating glaucoma is achieved.
Patent Information
- Application Number
- CN202510329914.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-03-20
AI Technical Summary
The prior art is difficult to effectively control the intraocular pressure in patients with glaucoma, resulting in optic nerve damage and potential permanent vision loss.
Develop an lncRNA inhibitor that uses antisense nucleic acids, siRNA, miRNA or shRNA, combined with pharmaceutically acceptable carriers (such as vesicles) to inhibit the expression of the TGF-β2 signaling pathway by targeting specific lncRNA sequences (such as lnc-BMPR2-AS1), using molecular forms such as antisense nucleic acids, siRNA, miRNA or shRNA, to inhibit the expression of the TGF-β2 signaling pathway, thereby reducing extracellular matrix deposition of trabecular reticulocytes in human eye and reducing intraocular pressure.
By successfully inhibiting the expression of lncRNA, the expression of TGF-β2 signaling pathway is inhibited, the deposition of extracellular matrix is reduced, and the intraocular pressure is effectively reduced, achieving the effect of treating glaucoma.
Smart Images

Figure CN119823994B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical technologies, and particularly to an lncRNA inhibitor and its application in the preparation of a medicament for treating glaucoma. Background Art
[0002] Glaucoma is a disease caused by pathological elevation of intraocular pressure, which seriously threatens and damages the visual function of the optic nerve. In severe cases, it can lead to permanent vision loss. It has now become the second leading cause of blindness globally and the first irreversible cause of blindness in the world. Primary open-angle glaucoma (POAG) is the most common type of glaucoma, and its pathogenesis remains unclear to date. Lowering intraocular pressure is an effective method clearly pointed out in the glaucoma diagnosis and treatment guidelines of various countries to delay and control the development of glaucoma. Drug treatment is the first choice for POAG patients, and most patients need to take drugs for life after diagnosis. However, neither drugs nor surgery can guarantee complete effective control of intraocular pressure and avoid optic nerve damage. Therefore, seeking an economical, safe, and effective drug treatment method has become a hot issue in medicine. Summary of the Invention
[0003] To solve the above technical problems, the present invention provides an lncRNA inhibitor and its application in the preparation of a medicament for treating glaucoma. The lncRNA inhibitor obtained by the present invention can successfully treat glaucoma.
[0004] The present invention provides an application of an lncRNA inhibitor in the preparation of a medicament for treating glaucoma, and the target sequence of the lncRNA inhibitor is as shown in SEQ ID NO:6.
[0005] Further, the lncRNA inhibitor includes antisense nucleic acid, siRNA, miRNA or shRNA; the target sequence of the antisense nucleic acid, siRNA, miRNA or shRNA is as shown in SEQ ID NO:6.
[0006] Further, SEQ ID NO:6 is TTCGGGAAGGGAGGCTGCTTTGA.
[0007] Further, the sense strand of the siRNA is as shown in SEQ ID NO:1; the antisense strand of the siRNA is as shown in SEQ ID NO:2.
[0008] Further, SEQ ID NO:1 is AAAGCAGCCUCCCUUCCCGAA.
[0009] Further, SEQ ID NO:2 is CGGGAAGGGAGGCUGCUUUGA.
[0010] Furthermore, the shRNA is constructed from siRNA targeting lncRNA, and the sense strand of the siRNA is as shown in SEQ ID NO:1; the antisense strand of the siRNA is as shown in SEQ ID NO:2.
[0011] The present invention also provides an lncRNA inhibitor, and a pharmaceutical composition for treating glaucoma includes the lncRNA inhibitor and a pharmaceutically acceptable carrier;
[0012] The sequence of the lncRNA is as shown in SEQ ID NO:3; the lncRNA inhibitor refers to a molecule having an inhibitory effect on lncRNA, and the inhibitor is selected from antisense nucleic acid, siRNA, miRNA or shRNA, and the target sequence of the antisense nucleic acid, siRNA, miRNA or shRNA is as shown in SEQ ID NO:6.
[0013] Furthermore, the pharmaceutically acceptable carrier includes one of lentivirus and vesicles.
[0014]
[0015] The embodiments of the present invention have the following technical effects:
[0016] By successfully inhibiting the expression of lncRNA, the present invention inhibits the expression of the TGF-β2 signaling pathway, and finally reduces the deposition of extracellular matrix in human trabecular meshwork cells (HTMCs), lowers intraocular pressure, and realizes the effect of treating glaucoma. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0018] Figure 1 It is a micrograph of the vesicles provided by the embodiments of the present invention.
[0019] Figure 2 It is the expression of the vesicle-producing protein in the present invention.
[0020] Figure 3 It is the effect of the siRAN inhibitor on the expression of TGF-β2 pathway proteins.
[0021] Figure 4 It is the effect of the siRAN inhibitor on the RNA expression of the TGF-β2 pathway.
[0022] Figure 5 It is the effect of overexpression of the lnc-BMPR2-AS1 gene on the expression of TGF-β2 pathway proteins.
[0023] Figure 6 It is the effect of overexpression of the lnc-BMPR2-AS1 gene on the RNA expression of the TGF-β2 pathway.
[0024] Figure 7 It is the effect of the vesicles on the expression of TGF-β2 pathway proteins.
[0025] Figure 8 It is the effect of the vesicles on the RNA expression of the TGF-β2 pathway.
[0026] Figure 9 It is the effect of overexpression of the lnc-BMPR2-AS1 gene on the expression of ECM gene-related proteins.
[0027] Figure 10 It is the effect of overexpression of the lnc-BMPR2-AS1 gene on the RNA expression of ECM gene-related.
[0028] Figure 11 It is the effect of vesicles on the protein expression related to ECM genes in cell experiments.
[0029] Figure 12 It is the effect of vesicles on the RNA expression related to ECM genes in cell experiments.
[0030] Figure 13 It is the test result of animal experiments.
[0031] Figure 14 It is the test result of the targeting of siRNA to lncRNA sequences in the present invention. Detailed implementation manners
[0032] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope protected by the present invention.
[0033] In a first aspect, some embodiments of the present invention provide an application of an lncRNA inhibitor in the preparation of a medicament for treating glaucoma, and the target sequence of the lncRNA inhibitor is as shown in SEQ ID NO: 6.
[0034] In some embodiments, the lncRNA inhibitor includes antisense nucleic acid, siRNA, miRNA or shRNA; the target sequences of the antisense nucleic acid, siRNA, miRNA or shRNA are as shown in SEQ ID NO: 6.
[0035] In some embodiments, SEQ ID NO: 6 is TTCGGGAAGGGAGGCTGCTTTGA.
[0036] In some embodiments, the sense strand of the siRNA is as shown in SEQ ID NO: 1; the antisense strand of the siRNA is as shown in SEQ ID NO: 2.
[0037] In some embodiments, SEQ ID NO: 1 is AAAGCAGCCUCCCUUCCCGAA.
[0038] In some embodiments, SEQ ID NO: 2 is CGGGAAGGGAGGCUGCUUUGA.
[0039] In some embodiments, the shRNA is obtained by constructing siRNA targeting lncRNA. The sense strand of the siRNA is as shown in SEQ ID NO:1; the antisense strand of the siRNA is as shown in SEQ ID NO:2.
[0040] In a second aspect, in some embodiments of the present invention, an lncRNA inhibitor is further provided. The lncRNA inhibitor and a pharmaceutically acceptable carrier are included in the preparation of a pharmaceutical composition for treating glaucoma;
[0041] The sequence of the lncRNA is as shown in SEQ ID NO:3; the lncRNA inhibitor refers to a molecule having an inhibitory effect on lncRNA. The inhibitor is selected from antisense nucleic acids, siRNA, miRNA or shRNA, and the target sequence of the antisense nucleic acid, siRNA, miRNA or shRNA is as shown in SEQ ID NO:6.
[0042] In some embodiments, the pharmaceutically acceptable carrier includes one of lentivirus and vesicles.
[0043]
[0044] The following is described in conjunction with specific embodiments:
[0045] Example 1:
[0046] (1) An H 2 O 2 oxidative stress model was established. Total RNA of human trabecular meshwork cells was extracted for lncRNA and mRNA sequencing. It was found that lncRNA and mRNA subpopulations closely related to TGF-β2 signaling were differentially regulated in human trabecular meshwork cells under oxidative stress. Therefore, a lncRNAs network of TGF-β2 co-localization and co-expression was constructed to study the effects and regulatory mechanisms of potential lncRNAs on the deposition of extracellular matrix (ECM) in human trabecular meshwork cells. Through gain-of-function and loss-of-function experiments, we screened out a lncRNA, as shown in SEQ ID NO:3 (lncRNA ID: TCONS_00079729, named lnc-BMPR2-AS1). The lncRNA has a negative feedback with the target gene BMPR2. In the prior art, BMPR2 is related to extracellular ECM deposition (in the case of BMPR2 deficiency, the expression of extracellular matrix proteins is significantly up-regulated, resulting in abnormal deposition of ECM). Inhibiting the expression of lnc-BMPR2-AS1 can reduce the excessive deposition of extracellular matrix caused by BMPR2 deficiency. Therefore, lnc-BMPR2-AS1 may be a potential therapeutic target for glaucoma.
[0047] Table 1 Information of the lncRNA of the present invention
[0048]
[0049] (1) Vesicle isolation:
[0050] Sample pretreatment: After culturing in serum-free medium for 48 hours, the cell culture medium was collected and centrifuged at 4°C with a centrifugal force of 300g for 10 minutes to remove suspended cells, and the cell supernatant was obtained.
[0051] (2) Differential centrifugation was then used:
[0052] Low-speed centrifugation (removing cell debris): Centrifuged at 4°C with a centrifugal force of 2000g for 15 minutes to remove cell debris and large particles, and the supernatant was collected.
[0053] Medium-speed centrifugation (removing large particles and microvesicles): Centrifuged at 4°C with a centrifugal force of 10000g for 30 minutes to remove residual organelles (such as mitochondria) and larger vesicles, and the supernatant was retained.
[0054] High-speed centrifugation (for enriching small extracellular vesicles): At 4°C, with a centrifugal force of 100,000 g for 90 minutes, collect the precipitate after centrifugation, which contains small extracellular vesicles (exosomes).
[0055] (3) Wash the precipitate:
[0056] Resuspend the precipitate in 1 mL of PBS buffer, and at 4°C, centrifuge again at a centrifugal force of 100,000 g for 60 minutes to remove contaminants. Collect the final precipitate and resuspend it in an appropriate amount of PBS buffer solution, and store it at -80°C for later use. The obtained vesicles are as Figure 1 shown.
[0057] (4) Self-designed siRNA targeting lncRNA, denoted as si-lnc-BMPR2-AS1-1. The sense strand sequence is as follows: AAAGCAGCCUCCCUUCCCGAA, and the antisense strand sequence is as follows: CGGGAAGGGAGGCUGCUUUGA; among them, the targeting position of si-lnc-BMPR2-AS1-1 is the 2912 - 2934 interval in the lncRNA sequence. Then entrust Shanghai GenePharma Co., Ltd. to synthesize the siRNA. At the same time, other siRNAs were also prepared and synthesized for comparison, denoted as si-lnc-BMPR2-AS1-2. The sense strand sequence is as follows (SEQ ID NO:4): UCUUCAAAUGGCUUUACCCUC, and the antisense strand sequence is as follows (SEQ ID NO:5): GGGUAAAGCCAUUUGAAGAAU.
[0058] (5) Experiment of treating human trabecular meshwork cells under oxidative stress with the vesicles encapsulating the siRNA of the present invention: Transfect the plasmid ring containing the siRNA sequence (si-lnc-BMPR2-AS1-1) (denoted as: pcDNA3.1+si-lnc-BMPR2-AS1) or the empty vector (denoted as: pcDNA3.1+si-NC) into human trabecular meshwork cells, and use the plasmid ring overexpressing the lnc-BMPR2-AS1 gene (denoted as: pcDNA3.1+lnc-BMPR2-AS1) as a control.
[0059] (7) Detect the RNA level by qRT-PCR:
[0060] The RNA levels of lnc-BMPR2-AS1, COL1α1 (alpha-1 chain of type I collagen), COL4α1 (alpha-1 chain of type IV collagen), MMP2 (matrix metalloproteinase 2), and VIM (vimentin) were detected using quantitative real-time polymerase chain reaction (qRT-PCR), a technique that can quantify gene expression levels. GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as an internal reference to normalize the data and ensure that any changes in gene expression were not due to variations in RNA loading or reverse transcription efficiency.
[0061] (8) Protein levels were detected by Western blot:
[0062] Western blot analysis was used to detect the protein levels of Collagen1 (COL1A1 is Collagen1, mainly composed of COL1A1 and COL1A2, with COL1A1 being the main component), MMP2, and VIM. Again, GAPDH was used as an internal reference to ensure consistent protein loading in all samples.
[0063] (9) Extraction of si-lnc-BMPR2-AS1-1 and construction of vesicle carriers: Extracellular vesicles were isolated by differential centrifugation, and siRNA was loaded into the vesicles by incubation.
[0064] Cell culture: Trabecular meshwork cells were seeded in 6-well or 24-well plates and cultured until 70%-80% confluence. Antibiotic-free medium was used to ensure good cell condition.
[0065] Addition of siRNA vesicles:
[0066] Vesicles loaded with siRNA were added according to the well plate specifications: 6-well plate: The mass concentration of the vesicles was 100 µg / mL, and 2 mL of antibiotic-free medium (500 mL of cell basal medium, plus 10 mL of fetal bovine serum (FBS; Gibco, Gaithersburg, MD) and 5 mL of TM cell growth supplement (product number No. 6592, ScienCell)) was added. Incubate at 37 °C for 24 - 48 hours.
[0067] Negative control group: Vesicles without siRNA were added.
[0068] A DBA / 2J hereditary glaucoma mouse model was purchased, 9 months old, with 10 males and 10 females. Five male and five female mice were injected with vesicles loaded with the siRNA of the present invention into the tail vein, and the rest were used as the control group.
[0069] (10)Testing the targeting of siRNA to lncRNA sequences: Establish a glaucoma model, set up siRNA targeting lncRNA (si-lnc-BMPR2-AS1-1), another siRNA is si-lnc-BMPR2-AS1-2, and a control group (si-NC) is also set up. The control group does not add siRNA. Use PCR to test the RNA expression levels of NG_085727.1 sequence, lnc-BMPR2-AS1 sequence and TGF-β2. The test results are as Figure 14 shown.
[0070] Results and analysis:
[0071] In Figure 2 , the expression of exosome markers CD9 protein and CD63 protein produced by the vesicles obtained in Example 1 was identified, proving that the target vesicles were successfully obtained in the present invention.
[0072] In order to further evaluate the effect of lncRNA on the TGF-β2 signaling pathway in the present invention, two siRNAs were used for comparison in the present invention. One is siRNA targeting lncRNA according to the present invention (si-lnc-BMPR2-AS1-1), and the other siRNA is si-lnc-BMPR2-AS1-2 to verify whether it inhibits the expression of TGF-β2 signal; a control group (si-NC) is also set up. The control group does not add siRNA. TGF-β2 is the most common TGF-β subtype related to the eye. It promotes the expression of a variety of ECM proteins (extracellular matrix proteins), which can promote the occurrence of the extracellular matrix, thereby increasing the resistance of aqueous humor to flow out through the TM (trabecular meshwork), resulting in increased intraocular pressure. Therefore, the protein expression levels and RNA levels of TGF-β2, pSMAD2 / 3 and SMAD2 / 3 were detected in the present invention. The results are as Figure 3 and Figure 4 shown. In Figure 3 , the results show that it can be found that after siRNA successfully inhibits the expression of lnc-BMPR2-AS1 gene, the RNA and protein levels of TGF-β2 are significantly decreased, inhibiting the expression of TGF-β2 signal, while SMAD2 / 3 does not decrease. In addition, immunoblot analysis shows that after inhibiting the expression of lnc-BMPR2-AS1 gene, the phosphorylation level of SMAD2 / 3 is decreased. In Figure 4 , by verifying the expression of the RNA of related proteins, the results are consistent with Figure 3 . siRNA inhibits the expression of TGF-β2 signal by inhibiting the expression of lnc-BMPR2-AS1 gene.
[0073] The effect of siRNA was further verified by overexpressing the lnc-BMPR2-AS1 gene. One group was added with the lnc-BMPR2-AS1 gene (denoted as: pc-lnc-BMPR2-AS1), and the other group was the blank control group without adding the lnc-BMPR2-AS1 gene (denoted as: pcDNA3.1). The results are as Figure 5 and Figure 6 shown. In the results of Figure 5 and Figure 6 it was found that when the lnc-BMPR2-AS1 gene was overexpressed, the expression of TGF-β2 was significantly upregulated, rather than the expression of SMAD2 / 3, and the phosphorylation of SMAD2 / 3 was promoted, further verifying that lncRNA affects glaucoma by influencing the expression level of TGF-β2.
[0074] In Figure 7 , in the cell experiment, the siRNA (si-lnc-BMPR2-AS1-1) of the present invention and other siRNAs (si-lnc-BMPR2-AS1-2) were used to inhibit the expression of TGF-β2 signal, and a control group (si-NC) was also set up, and the control group did not add siRNA. The expression levels of MMP2 protein and VIM protein were successfully inhibited by siRNA. In Figure 8 , it was further studied whether using vesicles as carriers in the present invention would affect the siRNA from exerting its effect. The siRNA of the present invention was carried by vesicles (denoted as: si-lnc-BMPR2-AS1-sEVs). The expression levels of lnc-BMPR2-AS1, COL1ɑ1, COL4ɑ1, MMP2 and VIM, these RNAs related to extracellular matrix proteins, were also detected in all three groups. Figure 8 The results showed that the protein expression levels of lnc-BMPR2-AS1, COL1ɑ1, COL4ɑ1, MMP2 and VIM RNAs were successfully inhibited by adding siRNA, indicating that the expression of related ECM genes was decreased after inhibiting the expression of the lnc-BMPR2-AS1 gene. It was also verified that using vesicles as carriers for the coating inhibitor would not affect the inhibitor from exerting its effect.
[0075] By further detecting the RNA and protein levels of lnc-BMPR2-AS1, COL1ɑ1, COL4ɑ1, MMP2 and VIM, these ECM genes, by overexpressing the lnc-BMPR2-AS1 gene, the results are as Figure 9 and Figure 10 shown. It can be found that when the lnc-BMPR2-AS1 gene is overexpressed, the expression of related ECM genes will be upregulated, indicating that the expression of lnc-BMPR2-AS1 will promote the occurrence and development of glaucoma.
[0076] The siRNA in the present invention was encapsulated with vesicles and a cell experiment was conducted. The results are as Figure 11 and Figure 12 shown. pcDNA3.1+si-NC was used as a control group (a plasmid loop without lnc-BMPR2-AS1), pcDNA3.1+lnc-BMPR2-AS1 (a plasmid loop containing lnc-BMPR2-AS1), pcDNA3.1+si-lnc-BMPR2-AS1 (a plasmid loop containing the siRNA of the present invention), pcDNA3.1+si-lnc-BMPR2-AS1-sEVs (vesicles encapsulating a plasmid loop containing the siRNA of the present invention). In Figure 11 Figure 12 the results shown, the vesicles did not affect the inhibitory effect of the siRNA on the target site, and the siRNA successfully inhibited the target site.
[0077] The siRNA encapsulated with vesicles was used in an animal experiment. The results are as Figure 13 shown, and it can be found that the inhibitor of the present invention can successfully reduce the intraocular pressure of mice. It can be seen that the inhibitor of the present invention can successfully treat glaucoma.
[0078] In Figure 14 it was found that the siRNA (si-lnc-BMPR2-AS1-1) of the present invention has good targeting and can successfully act on the 2912-2934 sites in the lncRNA sequence, thereby reducing the expression of the lnc-BMPR2-AS1 sequence.
[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the technical solutions of the embodiments of the present invention.
Claims
1. Use of a lncRNA inhibitor in the preparation of a drug for treating glaucoma, characterized in that: The target sequence of the lncRNA inhibitor is shown in SEQ ID NO: 6; The sequence of the lncRNA is shown in SEQ ID NO: 3; The lncRNA inhibitor is selected from antisense nucleic acid, siRNA or shRNA; The sense strand of the siRNA is shown in SEQ ID NO: 1; the antisense strand of the siRNA is shown in SEQ ID NO:
2.
2. The use according to claim 1, characterized in that: The shRNA is constructed from siRNA targeting lncRNA, the sense strand of the siRNA is shown in SEQ ID NO: 1; the antisense strand of the siRNA is shown in SEQ ID NO:
2.
3. A lncRNA inhibitor, characterized in that The preparation of a pharmaceutical composition for treating glaucoma includes a lncRNA inhibitor and a pharmaceutically acceptable carrier; The sequence of the lncRNA is shown in SEQ ID NO: 3; the lncRNA inhibitor refers to a molecule that has an inhibitory effect on lncRNA, and the inhibitor is selected from antisense nucleic acid, siRNA or shRNA, and the target sequence of the antisense nucleic acid, siRNA or shRNA is shown in SEQ ID NO: 6; The sense strand of the siRNA is shown in SEQ ID NO: 1; the antisense strand of the siRNA is shown in SEQ ID NO:
2.
4. The lncRNA inhibitor according to claim 3, characterized in that The pharmaceutically acceptable carrier includes one of a lentivirus and a vesicle.
Citation Information
Patent Citations
Application of 1ncRNAs ENST00000607393 SiRNA in preparation of preparation for treating glaucoma
CN107028972A
Glaucoma image detection method and system based on artificial intelligence model
CN117541547A