Application of Bs4C gene in bacterial wilt resistance and vector constructed by Bs4C gene

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of a Bs4C gene in bacterial wilt resistance and a vector constructed by the Bs4C gene. The invention discloses a novel application of a disease-resistant protein coding gene Bs4C in bacterial wilt resistance for the first time. Genetic transformation is carried out in tobacco by constructing a recombinant vector for tandem expression of an ADC1 promoter and a Bs4C gene. In a tobacco plant transformed by the recombinant vector, the Bs4C gene is inoculated, induced and expressed by a bacterial wilt pathogen ralstonia solanacearum. After inoculation of bacterial wilt, compared with a control group, a tobacco plant subjected to induction expression of the Bs4C gene shows relatively strong bacterial wilt resistance. And under normal growth conditions, the tobacco plant does not induce expression of the Bs4C gene, and the growth vigor is not obviously different from that of a wild type. In conclusion, the Bs4C gene plays an important positive regulation role in a tobacco bacterial wilt resistance regulation process, and a ralstonia solanacearum induced expression system constructed by utilizing the ADC1 promoter and the Bs4C gene can be applied to gene function research and genetic engineering breeding of tobacco bacterial wilt resistance improvement.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to an application of a Bs4C gene in resistance to bacterial wilt and a vector constructed thereof. Background Art

[0002] Ralstonia solanacearum is a devastating plant pathogen that can infect more than 400 species of plants from more than 50 families, causing bacterial wilt. The disease is particularly serious in important Solanaceae crops such as peppers, tomatoes, potatoes and eggplants, causing serious impacts on agricultural production. Based on its academic and economic importance, Ralstonia solanacearum is considered the second largest plant pathogen in the world. Ralstonia solanacearum can survive in the soil for many years and is difficult to eradicate. Once infected with bacterial wilt in the field, the diseased plants will quickly wilt and die under favorable conditions of high temperature and high humidity. So far, the prevention and control of bacterial wilt is mainly carried out from three aspects: biological, chemical and agricultural measures. Biological control mainly involves isolating microorganisms that have an inhibitory effect on bacterial wilt from the original soil of the pathogen and making them into microbial organic fertilizers or microbial agents; in terms of chemistry, fumigants are often used to treat the soil to prevent and control tobacco bacterial wilt; agricultural measures include the selection of disease-resistant varieties, seedbed disinfection, reasonable crop rotation, early sowing and early planting, attention to field hygiene and strengthening field management. Among them, chemical control is an important technical measure for the prevention and control of bacterial wilt. Compared with other prevention and control methods, it has the characteristics of being fast, effective and convenient, but chemical control can lead to problems such as drug resistance, rampant re-infestation and pesticide residues. While killing harmful pathogens, it will not only damage beneficial microorganisms, but also cause pesticide damage to humans, animals and other plants; agricultural measures have a long prevention and control cycle, are difficult to operate, and have unsatisfactory prevention and control effects; biological control is affected by environmental conditions and crops, has poor adaptability to the environment, has reduced colonization ability, is not yet mature, and has unstable prevention effects. Therefore, there are still many problems in the prevention and control of bacterial wilt. Due to the complexity of root infection and vascular colonization, field prevention and control of bacterial wilt is extremely challenging. In addition, there are many types of mutations in the bacterial wilt strain and the source of infection is relatively complex. There are currently no effective prevention and control measures. From the perspective of sustainable development, finding an efficient and green method for the prevention and control of bacterial wilt has become a difficult problem that researchers urgently need to solve.

[0003] The cultivation of disease-resistant varieties is an efficient, green and sustainable prevention and control measure. It has the advantages of low investment and easy promotion for the prevention and control of bacterial wilt. It can reduce the risk of disease at the source and is one of the more economical, environmentally friendly and effective methods for the prevention and control of bacterial wilt. One way to breed disease-resistant varieties is to use genetic engineering technology to transfer known exogenous disease-resistant genes into varieties with excellent comprehensive traits but susceptible to the disease, thereby obtaining resistant varieties with excellent comprehensive traits. The Bs4C gene is a disease-resistant protein from the Solanaceae plant pepper. It can be activated by the effector protein avrBs4 in Xanthomonas campestrispv. vesicatoria. avrBs4 can bind to the UPT-box on the Bs4C gene promoter, causing the Bs4C gene to be transcriptionally activated, thereby mediating resistance to Xanthomonas (Strauβet al., PNAS, 2012, 109: 19480-19485). However, it is still unclear whether the Bs4C gene can mediate resistance to bacterial wilt, especially tobacco bacterial wilt. Summary of the invention

[0004] The primary purpose of the present invention is to provide an application of the Bs4C gene in resistance to bacterial wilt, wherein the Bs4C gene sequence is shown in SEQ ID NO. 1. The present invention is the first to discover a new application of a disease resistance protein Bs4C gene from the Solanaceae plant pepper in resistance to bacterial wilt. In particular, the effect in resistance to tobacco bacterial wilt is very prominent.

[0005] Furthermore, the Bs4C gene is constructed into a vector and transformed into plants using the Agrobacterium transformation method to obtain plants resistant to bacterial wilt.

[0006] Furthermore, a promoter induced by Ralstonia solanacearum was cloned upstream of the disease-resistant gene Bs4C to construct a transgenic vector in which the promoter drives the expression of the Bs4C gene.

[0007] The promoter whose expression is induced by Ralstonia solanacearum specifically refers to a promoter whose expression is induced by activation of Ralstonia solanacearum effector factors.

[0008] Furthermore, the ADC1 gene promoter was cloned upstream of the disease-resistant gene Bs4C to construct a recombinant vector ADC1p_Bs4C in which the ADC1 gene promoter drives the expression of the Bs4C gene.

[0009] The gene sequence of the ADC1 gene promoter is shown in SEQ ID NO.2.

[0010] The second aspect of the present invention aims to provide a vector for expression induced by Ralstonia solanacearum, wherein a promoter for expression induced by Ralstonia solanacearum is cloned upstream of the disease resistance gene Bs4C to form a recombinant vector for the expression of the Bs4C gene driven by the inducible promoter;

[0011] The promoter whose expression is induced by Ralstonia solanacearum specifically refers to a promoter whose expression is induced by activation of Ralstonia solanacearum effector factors.

[0012] Furthermore, the ADC1 gene promoter was cloned upstream of the disease-resistant gene Bs4C to construct a recombinant vector ADC1p_Bs4C in which the ADC1 gene promoter drives the expression of the Bs4C gene.

[0013] The gene sequence of the ADC1 gene promoter is shown in SEQ ID NO.2.

[0014] Beneficial effects of the present invention:

[0015] (1) The present invention confirms for the first time that the Bs4C disease resistance gene significantly improves the disease resistance of plants to bacterial wilt, especially in tobacco.

[0016] (2) The expression of the Bs4C gene in the inducible expression vector constructed by the present invention is specifically induced by Ralstonia solanacearum in transformed tobacco; in the absence of bacterial wilt infection, the gene will not be induced to express, thus avoiding excessive impact on the plant as much as possible.

[0017] (3) Even if the Bs4C inducible expression vector constructed by the present invention is induced to express, it will not affect the normal growth of the transgenic plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 :Design of recombinant vector for inducible expression of Bs4C gene by Ralstonia solanacearum;

[0019] Figure 2 : PCR identification of tobacco strains transformed with recombinant vectors;

[0020] Figure 3 :Analysis of Bs4C gene expression in tobacco recombinant vector transformed plants under bacterial wilt inoculation and control conditions;

[0021] Figure 4 :Analysis of bacterial wilt resistance in tobacco plants expressing tobacco Bs4C gene and K326 wild type control;

[0022] Figure 5 : Biomass analysis of tobacco plants expressing Bs4C gene induced by tobacco and K326 wild type control;

[0023] Figure 6 : Leaf number analysis of tobacco plants expressing Bs4C gene induced by Bs4C and K326 wild type control. DETAILED DESCRIPTION

[0024] The present application will be further explained below in conjunction with the embodiments. Before introducing the specific embodiments, the basic information of some biological materials, experimental reagents, experimental instruments, etc. involved in the following embodiments is briefly introduced as follows.

[0025] Biomaterials:

[0026] Tobacco materials, cultivated tobacco ( Nicotiana tabacum ) variety K326, were purchased from Yuxi China Tobacco Seed Co., Ltd.;

[0027] The vector plasmids used for recombinant genes: pPZP211 was purchased from Shanghai Zeye Biotechnology Co., Ltd.;

[0028] Gene sequencing, gene fragment and primer synthesis were completed by BGI.

[0029] Experimental reagents:

[0030] The reagents and kits used in this experiment are as follows:

[0031] Restriction endonucleases, dNTPs, PrimerSTAR GXL DNA polymerase, MiniBEST Agarose Gel DNA Extraction Kit, MiniBEST Plasmidpurification Kit, and TRIZOL reagent for RNA extraction were purchased from Invitrogen; the reverse transcription kit was purchased from Roche; the DNAase enzyme was purchased from Fermentas; and antibiotics such as kanamycin and rifampicin were purchased from Shanghai Shenggong Biotechnology Co., Ltd.

[0032] Example 1

[0033] This example briefly introduces the process of obtaining the tobacco transformation strain of the ADC1p_Bs4C recombinant expression vector as follows.

[0034] 1. Design of recombinant expression vector for Bs4C gene driven by ADC1 promoter

[0035] The ADC1 (Arginine Decarboxylase 1) gene is a conservative gene in plants. Previous studies have shown that the expression of this gene is induced by transcriptional activator effector proteins in Ralstonia solanacearum (Wu et al., Cell Host & Microbe, 2019, 26: 638-649). Based on this, the tomato ADC1 gene promoter was cloned upstream of the disease resistance gene Bs4C (SEQ ID NO.1) to form a recombinant expression vector ADC1p_Bs4C (see SEQ ID NO.2) driven by the tomato ADC1 gene promoter to express the Bs4C gene. Figure 1 ).

[0036] 2. Acquisition and identification of tobacco plants transformed with ADC1p_Bs4C recombinant expression vector

[0037] The full-length DNA sequence of ADC1p_Bs4C with a 3*FLAG tag at the C-terminus was artificially synthesized at BGI, and then the primers ADC1p-F: ATGACCATGATTACGAATTCGTGATTATCTTTTGATTAAG and 3*FLAG-R: GATCCCCGGGTACCGAGCTCAGTGACTCCGTCTCTTCA were used to amplify the full-length ADC1p_Bs4C_3*FLAG. The reaction system was as follows: 2*Phanta MaxBuffer 12.5μl; ADC1p-F 0.5μl; 3*FLAG-R 0.5μl; Plasmid DNA 1μl; dNTP mix (10mMeach) 0.5μl; Phanta Max DNA Polymerase 0.5μl; ddH2O up to 25μl.

[0038] Mix the above reaction solutions evenly and put them into the PCR instrument, and react according to the following steps: Step 1: 95℃, 5min; Step 2: 95℃, 15s; Step 3: 58℃, 15s; Step 4: 72℃, 1min 30s; go to Step 2for35cycles; Step 5: 72℃, 10min; Step 6: 12℃, 5min.

[0039] After the reaction, the PCR product was detected by agarose gel electrophoresis, and the PCR product was recovered using an agarose gel recovery kit. At the same time, the vector pPZP211 was double-digested with EcoRI and KpnI and then detected by agarose gel electrophoresis. The recovered PCR product was homologously recombined with the vector using the homologous recombination method, transformed into Escherichia coli Top10 competent cells, and coated on LB plates containing kanamycin (100μg / ml) resistance, and incubated in an inverted incubator at 37℃ overnight. On the second day, a single colony was picked for positive PCR detection and the correct colony was expanded in liquid LB culture medium for plasmid extraction and sequencing verification.

[0040] The positive plasmid pPZP211::ADC1p_Bs4C_3*FLAG was transformed into the Agrobacterium LBA4404 strain. The transformation method was as follows: take the competent Agrobacterium stored at -80℃ and wait for it to partially melt at room temperature or in the palm of your hand for a while, and insert it into ice when it is in an ice-water mixing state; add 0.01-1μg plasmid DNA for every 100μl competent state, stir the bottom of the tube by hand to mix, and let it stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37℃ water bath for 5 minutes, and ice bath for 5 minutes in sequence; add 700μl YEB liquid culture medium without antibiotics , culture at 28°C with shaking for 2-3 hours; collect the bacteria by centrifugation at 6000rpm for one minute at room temperature, retain about 100μl of the supernatant, gently blow and resuspend the bacteria, spread it on a YEB plate containing kanamycin (100μg / ml) and rifampicin (25μg / ml) resistance, and culture it upside down in a 28°C incubator for 2-3 days; pick a single colony for colony PCR identification, pick the correct colony in the liquid YEB culture medium, and culture it in a shaker at 28°C overnight, add an equal ratio of 60% glycerol to the cultured bacterial solution and store it at -80°C.

[0041] Use the stored Agrobacterium LBA4404 containing the plasmid pPZP211::ADC1p_Bs4C_3*FLAG to perform stable genetic transformation of tobacco, as follows. Activate the Agrobacterium culture stored at -80°C on a solid YEB medium with resistance to kanamycin (100μg / ml) and rifampicin (25μg / ml), and invert and culture at 28°C for two days; pick the activated Agrobacterium and place it in 50mL of liquid YEB medium containing resistance to kanamycin (100μg / ml) and rifampicin (25μg / ml), and culture it at 28°C, 180rpm, and shake until the OD600 is close to 0.6; transfer the culture to a pre-sterilized and pre-cooled 50mL centrifuge tube, centrifuge at 4000rpm for 10min, discard the supernatant and collect the bacteria; resuspend the bacteria in 20mL of pre-cooled MS liquid culture medium, centrifuge at 4000rpm for 10min again, and discard the supernatant; Collect the bacteria from the supernatant; resuspend the bacteria in pre-cooled MS liquid medium until the OD600 is close to 0.6, then add AS with a final concentration of 20 mg / L to prepare for infection; cut the edges of the sterile leaves with scissors on the clean bench, cut the leaves into 1.0×1.0 cm leaf discs along the main veins and put them into the Agrobacterium infection solution for infection for 5-6 minutes; co-cultivation: remove the infected leaves, dry the Agrobacterium solution on sterile filter paper, spread them flat on the co-cultivation medium with the leaf surface facing down, and place them in an artificial climate room (temperature 26°C, humidity 40%) for dark cultivation for 3 days; S1 subculture: transfer the leaves with the leaf surface facing up after 3 days of co-cultivation to the S1 differentiation medium. If the explants carry more Agrobacterium, wash them with sterile water, dry them with sterile filter paper, and then transfer them to the S1 medium. Place 5-8 pieces per dish, culture in the dark in the artificial climate room for about 1 week, and continue to culture under light until cluster buds grow on the edge of the leaves and the buds grow to about 0.5 cm; S2 subculture: Use tweezers to transfer the cluster buds grown on S1 to the S2 differentiation medium. If the cluster buds can be broken off, inoculate them directly. If they cannot be broken off directly, inoculate them together with the leaves, and remove the leaves that have not grown cluster buds. Culture in light for 1-2 weeks until the cluster buds grow into seedlings; S3 subculture: Transfer the seedlings on S2 to the S3 differentiation medium and culture in light for 1-2 weeks. In this process, the seedlings grow stronger; Rooting culture: Remove the bottom swollen part and the yellowed leaves on the bottom of the strong seedlings on S3, and then inoculate them into a tissue culture bottle containing rooting medium R, and culture in light for 2 weeks to make the seedlings take root as soon as possible; Obtaining transformed tobacco: When the seedlings have 3-10 roots and the roots are about 2-3 cm long, open the lid of the culture bottle for seedling hardening. After about 3 days, the seedlings are transplanted into a nutrient pot filled with sterile soil and covered with plastic film for moisture retention. After about a week, the plastic wrap can be removed according to the growth of the seedlings to allow them to grow rapidly under natural conditions, and the transformed tobacco of the T0 generation is obtained.The T0 generation tobacco was harvested and sown as T1 generation plants. After the T1 generation transformed tobacco seeds were collected, they were sown in the soil. When they grew for about four weeks, the DNA of the transformed tobacco leaves was extracted and PCR identification was performed. The primers for PCR identification were pPZP211-F: GCGGATAACAATTTCACACA and pPZP211-R: CGTTGTCGAAACCGATGATA.

[0042] The above transformation tissue culture methods and processes are all referenced to (Li et al., Frontiers in Plant Science, 2022, 13: 817106)

[0043] Results and analysis: A total of 7 ADC1p_Bs4C transformed strains were tested, and it was found that strain 3 showed obvious positive PCR bands, while the wild type and the other 5 strains did not show bands ( Figure 2 ), and subsequently transformed strain No. 3 was used as an experimental object for research.

[0044] Example 2

[0045] This example mainly introduces the gene expression pattern of Bs4C in the tobacco transformed strain of the ADC1p_Bs4C recombinant expression vector in Example 1 as follows.

[0046] The No. 3 transformed strain of the recombinant vector pPZP211::ADC1p_Bs4C was sown in the soil. When it grew to four weeks old, the tobacco leaves were inoculated with Ralstonia solanacearum by injection. The specific method of inoculation was as follows: inject OD 600 =0.1 of Ralstonia solanacearum CQPS-1 suspension as the experimental group, and the right half of the leaf injected with ddH2O at the same position as the control group. There were three plants in each group, and each plant was injected with two leaves of appropriate size. The injected tobacco was placed in a growth room and cultured at 28°C for long days. After 24 hours, the leaf tissues injected with ddH2O or Ralstonia solanacearum were removed and quick-frozen in liquid nitrogen, RNA was extracted, and reverse transcribed to synthesize cDNA, and the expression level of Bs4C was detected using Bs4C gene-specific quantitative primers qBs4C-F:TGGATTGGCAATACATGGGC and qBs4C-R:CGAGCAGGCGATTTGTTTGA.

[0047] Results and analysis: In the control group, when injected with ddH2O (Mock), the Bs4C gene was expressed in very small amounts. In the experimental group, the expression of the Bs4C gene increased significantly 24 hours after the injection of Ralstonia solanacearum CQPS-1 ( Figure 3 ), indicating that the expression of Bs4C gene in ADC1p_Bs4C transformed tobacco plants depends on the infection of Ralstonia solanacearum, which is consistent with the experimental expectations.

[0048] Example 3

[0049] This example mainly introduces the identification of bacterial wilt resistance and comprehensive traits of tobacco transformed strains expressing the ADC1p_Bs4C recombinant expression vector in Example 1 as follows.

[0050] The positive ADC1p_Bs4C transformed strains and wild-type tobacco were sown in the soil. When they grew to 18 days old, they were inoculated with Ralstonia solanacearum CQPS-1 by root irrigation. The specific inoculation method was: the OD of Ralstonia solanacearum suspension was 0.1447 W / cm2. 600 The concentration was adjusted to 0.2, and 15 mL of Ralstonia solanacearum suspension was poured into the root of each tobacco plant. The inoculated tobacco was placed in a 28°C greenhouse, and the disease condition of the tobacco was observed daily. Photos were taken on the 12th day to record the disease phenotype. The positive ADC1p_Bs4C transformed strains were the experimental group, and the wild-type tobacco was the control group. 16 tobacco plants were treated in each group.

[0051] Results and analysis: On the 14th day after inoculation, almost all tobacco plants in the control group became diseased and wilted, while the Bs4C transformed strains in the experimental group showed obvious resistance to bacterial wilt, with only a few plants showing disease characteristics such as wilting ( Figure 4 ), therefore, ADC1p_Bs4C transformation of tobacco can significantly improve tobacco resistance to bacterial wilt.

[0052] Example 4

[0053] This example mainly introduces the growth of the tobacco transformed strain of the ADC1p_Bs4C recombinant expression vector in Example 1 as follows.

[0054] The recombinant vector ADC1p_Bs4C transformed tobacco and wild-type tobacco were sown in the soil. When they grew for four weeks, the growth potential of the tobacco was observed and the fresh weight of each plant was weighed. The recombinant vector transformed tobacco was the experimental group, and the wild-type tobacco was the control group. Ten seedlings were taken from each group as experimental replicates.

[0055] Results and analysis: The growth potential of the positive strains transformed with the ADC1p_Bs4C recombinant vector was basically the same as that of the wild-type tobacco. Statistical analysis of the fresh weight and leaf number of each plant showed that there was no significant difference between the recombinant vector transformed tobacco and the wild-type tobacco ( Figure 5 , Figure 6 ), which does not affect the normal growth of tobacco.

[0056] Sequence Listing

[0057] SEQ ID NO: 1

[0058] (Bs4C_CDS)

[0059] ATGGAGTTTGATCTCAGATACTTGATCTTGATTTTGGCTAACATGCTCAAATCAATATTATCCATTTCTGATAACTGGGATCCTTTCCATATATTTCATGACCATCCCAGTTTCATCGTCTTCATCAATAAGCTCTTCTTTCTTTTCATATTTTCCTTTATTTTCTCCATCACTCGTATAACACTTCATCATCCAAATATACGAATACGTGTACGTACTACTACTTCAGCAGATCTCTCCAAGTCCTTTAATATCTTGTGTCTAGCTTCTCTTCTACTCCCACAAATGTTGTTCTGGTACTTTTTCGTCATTATCATTGCACTTTCCTCATGTTCTTCTTGGATTGGCAATACATGGGCTAGTTTTCGACAACGGATTCTGCATATTTTCTCAACAATAATATTTCCAGCAGTCAGCATTTTCATCAATGTGGAGTTTGACAGAAATAATGTGAGCCAGCAACATGAAACTCAAACAAATCGCCTGCTCGTC

[0060] SEQ ID NO.2

[0061] (ADC1_Pmt)

[0062] GTGATTATCTTTTGATTAAGTTCTTTTTTTGCTTCTTTTGAGGGGGTAGCCGGGGCTCTGGCCTCGGCGGGTTCTAAAGCCCCCAGCTATTACAACATTGGTCAACAAATCATTTCTGTATAATTAGTTTTACACATTCTTTGATTCTTTTTTTTTTGTGAAGATTTTACGAG。

Claims

1. Application of Bs4C gene in resistance to bacterial wilt, the Bs4C gene sequence is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: Used to resist tobacco bacterial wilt.

3. The use according to claim 1, characterized in that: The Bs4C gene was constructed into a recombinant vector and transformed into tobacco using the Agrobacterium transformation method to obtain plants resistant to bacterial wilt.

4. The use according to claim 3, characterized in that: The promoter induced by Ralstonia solanacearum is cloned upstream of the disease-resistant gene Bs4C to construct a recombinant vector in which the promoter drives the expression of the Bs4C gene.

5. The use according to claim 4, characterized in that: The promoter whose expression is induced by Ralstonia solanacearum specifically refers to a promoter whose expression is induced by activation of Ralstonia solanacearum effector factors.

6. The use according to claim 5, characterized in that: The ADC1 gene promoter was cloned upstream of the disease resistance gene Bs4C to construct a recombinant expression vector ADC1p_Bs4C in which the ADC1 gene promoter drives the expression of the Bs4C gene.

7. The use according to claim 6, characterized in that: The nucleic acid sequence of the ADC1 promoter is shown in SEQ ID NO.

2.

8. A vector for expression induced by Ralstonia solanacearum, characterized in that: The promoter induced by Ralstonia solanacearum is cloned upstream of the disease resistance gene Bs4C to form a recombinant vector for promoter-driven Bs4C gene expression; the promoter induced by Ralstonia solanacearum specifically refers to the promoter induced by the activation of Ralstonia solanacearum effector factors.

9. The carrier according to claim 7, characterized in that The ADC1 gene promoter was cloned upstream of the disease-resistant gene Bs4C to construct a recombinant vector ADC1p_Bs4C in which the ADC1 gene promoter drives the expression of the Bs4C gene.

10. The carrier according to claim 9, characterized in that The nucleic acid sequence of the ADC1 gene promoter is shown in SEQ ID NO.2.

Images