NtMIXTA-like gene, encoding protein thereof, biological material and application of NtMIXTA-like gene in regulation and control of plant glandular hair generation

Abstract

The invention discloses an NtMIXTA-like gene, an encoding protein thereof, a biological material and application of the NtMIXTA-like gene in regulation and control of plant glandular trichome generation, and aims to solve the technical problem that an existing glandular trichome regulation and control gene is single in function. According to the application, the NtMIXTA-like gene is cloned from tobacco, a knockout plant and an overexpression plant of the NtMIXTA-like gene are respectively constructed, and the analysis on the leaf glandular hair of the NtMIXTA-like gene shows that the glandular hair density is obviously increased after the overexpression of the NtMIXTA-like gene, which indicates that the NtMIXTA-like gene can positively regulate and control the generation / development of the tobacco glandular hair. The application has important significance for researching a molecular regulatory network of plant glandular hair generation.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering breeding technology, and specifically to a NtMIXTA-like Genes, their encoded proteins, biomaterials and their applications in regulating plant glandular hair development. Background Art

[0002] Many plants (such as tobacco) are covered with a large number of epidermal hairs, among which the epidermal hairs with secretory functions are called glandular hairs. Among them, tobacco glandular hairs are further divided into long-stalked glandular hairs and short-stalked glandular hairs according to the number of stalk cells; long-stalked glandular hairs have multiple stalk cells and can synthesize and release secondary metabolites such as diterpenes and sucrose esters; while short-stalked glandular hairs contain only one stalk cell, which is responsible for synthesizing and secreting Phylloplain, a protein with antifungal properties.

[0003] Tobacco glandular hairs are of great significance in enhancing the environmental adaptability of tobacco plants and improving the aroma quality of tobacco leaves. First, as a natural physical barrier, they effectively block the movement path of pests, reduce the pests' feeding on tobacco leaves, and thus enhance the self-protection ability of tobacco plants; secondly, the chemicals secreted by tobacco glandular hairs have strong biological activity, which not only have a poisoning and expelling effect on pests, but also the resistance proteins such as Phylloplain can significantly reduce the probability of tobacco suffering from fungal diseases, further improving the disease resistance of tobacco plants. More importantly, these secretions are also rich in aroma precursors such as diterpenes and sucrose esters. During the processing, aging and burning of tobacco leaves, these precursors will gradually degrade and convert into small molecular volatile components, which are the important basis for the unique aroma of tobacco leaves. Therefore, it is very important to increase the density of tobacco glandular hairs. However, due to the tiny shape of tobacco glandular hairs, it is difficult to directly screen the density of glandular hairs in the field. Traditional breeding methods face great challenges in cultivating tobacco varieties with high glandular hair density.

[0004] Deeply exploring the genes that regulate the density of glandular hairs and using modern biotechnology such as genetic engineering to create new tobacco varieties with high density of glandular hairs will have far-reaching significance for tobacco production. Although some genes that regulate the development of glandular hairs have been found in tobacco, such as NtCycB2, NtHD9, NtHD12 However, these genes are only involved in the regulation of long-stalked glandular hairs and have no effect on the density of short-stalked glandular hairs. Therefore, finding genes that can simultaneously regulate the density of long-stalked glandular hairs and short-stalked glandular hairs in tobacco has extremely high application value for breeding new tobacco varieties with high glandular hair density.

[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0006] In view of at least one of the above technical problems, the present disclosure provides a NtMIXTA-like The genes, their encoded proteins, biological materials and their applications in the regulation of plant glandular hair development are intended to solve the technical problem that existing glandular hair regulatory genes have a single function (for example, they only participate in the regulation of long-stalked glandular hairs and have no effect on the density of short-stalked glandular hairs).

[0007] According to a first aspect of the present disclosure, there is provided a NtMIXTA-like The gene has a nucleotide sequence as shown in SEQ ID NO.1.

[0008] According to a second aspect of the present disclosure, there is provided a NtMIXTA-like The amino acid sequence of the encoded protein of the gene is shown in SEQ ID NO.2.

[0009] According to a third aspect of the present disclosure, a biomaterial is provided, comprising NtMIXTA-like genes or fragments thereof.

[0010] In some embodiments of the present disclosure, the biological material is any one of a nucleic acid molecule, an overexpression vector, a host cell, an engineered bacterium, and a transformed plant cell.

[0011] According to a fourth aspect of the present disclosure, NtMIXTA-like The gene, the encoded protein or the biological material is used in any one of the following (1) to (7): (1) Application in positively regulating the occurrence / development of plant glandular hairs or in preparing reagents for positively regulating the occurrence / development of plant glandular hairs; (2) Application in positively regulating the density of plant glandular hairs or in preparing reagents for positively regulating the density of plant glandular hairs; (3) Application in regulating the type of plant glandular hairs or in preparing reagents for regulating the development type of plant glandular hairs; (4) Application in breeding / identifying varieties / lines with traits related to plant glandular hair density; (5) Application in the construction or breeding of transgenic plants with increased glandular hair density; (6) Use in enhancing plant stress resistance or in preparing agents for enhancing plant stress resistance; (7) Application in improving the aroma quality of plants or breeding plant varieties / lines with high aroma quality.

[0012] In some embodiments of the present disclosure, overexpression or upregulation of the NtMIXTA-like Gene.

[0013] In some embodiments of the present disclosure, the plant comprises tobacco.

[0014] In some embodiments of the present disclosure, the plant glandular hairs include at least one of long-stalked glandular hairs and short-stalked glandular hairs.

[0015] According to a fifth aspect of the present disclosure, there is provided a method for improving tobacco glandular hair density / aroma quality, comprising the following steps: (1) Construct the NtMIXTA-like Gene overexpression vector; (2) transforming the overexpression vector into tobacco tissue or cells; (3) Make the NtMIXTA-like The gene is overexpressed in tobacco tissues or cells.

[0016] One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages: cloned from tobacco NtMIXTA-like The gene coding region is 1221 bp in length and encodes 406 amino acids. NtMIXTA-like The knockout and overexpression plants of the gene were analyzed and their leaf glandular hairs were found. NtMIXTA-like After overexpression, the density of glandular hairs increased significantly (especially the short-stalked glandular hairs, whose density increased by 317.6%~355.4% compared with the control), indicating that NtMIXTA-like The gene can positively regulate the occurrence / development of tobacco glandular hairs. This application provides a new approach to studying and understanding the molecular regulatory network of plant glandular hair occurrence. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 In one embodiment of the present application, tobacco NtMIXTA-like Cloning of gene CDS sequences.

[0018] Figure 2 This is the structure of the overexpression vector pC2300-35S-GFP-rbcs in one embodiment of the present application.

[0019] Figure 3 In one embodiment of this application NtMIXTA-like PCR identification of bacterial solution of overexpression vector; where M: marker; 1: negative control; 2: positive control; 3-8: positive monoclonal bacterial solution.

[0020] Figure 4 In one embodiment of the present application, the overexpression plant NtMIXTA-like Detection of gene expression levels.

[0021] Figure 5 This is a schematic diagram of the knockout vector structure in one embodiment of the present application.

[0022] Figure 6 In one embodiment of this application NtMIXTA-likePCR identification of bacterial solution of gene knockout vector; where M: marker; 1: negative control; 2: positive control; 3-8: bacterial solution.

[0023] Figure 7 In one embodiment of this application NtMIXTA-lik e Sequencing analysis of homozygous knockout single strain mutations.

[0024] Figure 8 In one embodiment of this application NtMIXTA-like Observation of glandular hairs on leaves of gene knockout and overexpression plants.

[0025] Fig. 9 In one embodiment of this application NtMIXTA-like Statistics of glandular hair density on leaves of gene knockout and overexpression plants. DETAILED DESCRIPTION

[0026] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents unless otherwise specified; the detection methods involved are all conventional methods unless otherwise specified.

[0027] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods. However, the following embodiments are only used to illustrate the present application in detail and do not limit the scope of the present application in any way.

[0028] Example 1: Tobacco NtMIXTA-like Gene cloning In this case, specific primers (F1: 5'-ATGGGTCGATCTCCATGTTG-3', R1: 5'-GAACATAGCCGAATCAG-3') were designed and PCR amplified in the cDNA of tobacco leaves to clone MIXTA - like Gene( Figure 1 ), the coding region of the gene is 1221 bp in length (as shown in SEQ ID NO.1) and encodes 406 amino acids (as shown in SEQ ID NO.2).

[0029] Embodiment 2 NtMIXTA-like Creation of gene overexpression materials To explore NtMIXTA-like The function of the gene, in this case NtMIXTA-like Creation of gene overexpression materials.

[0030] 1. Construct an overexpression vector. According to the overexpression vector pC2300-35S-GFP-rbcS ( Figure 2 ) multiple cloning site and NtMIXTA-likeThe restriction sites contained in the CDS sequence were designed with primers containing restriction linkers (F2: 5'-CGGGATCCATGGGTCGATCTCCATGTTG -3', R2: 5'- GCGTCGACGAACATAGCCGAATCAG -3'), and PCR amplification was performed in the cDNA of tobacco leaves. After the PCR amplification product was recovered from agarose gel, it was double-digested with the pC2300-35S-GFP-rbcS empty vector using BamHI and SalI, respectively. The PCR amplification product and the restriction product of the pC2300-35S-GFP-rbcS empty vector were recovered from agarose gel, and the two were connected using T4DNA ligase. The ligation product was transferred into Escherichia coli competent cells and screened by PCR ( Figure 3 ) and sequencing, and successfully screened and obtained positive monoclonal clones.

[0031] 2. Obtaining overexpression plants: Extract from the above positive monoclonal bacterial solution NtMIXTA-like The overexpression vector plasmid was used to infect the leaves of tobacco variety K326 by Agrobacterium-mediated method, and 29 positive transgenic plants were successfully obtained. RNA of positive transgenic plants was extracted, and specific primers (F3: 5'-TTAGGGAATAGGTGGTCGGC -3', R3: 5'-CCGTCATTGGACAAGAGGGT -3') were designed and detected by real-time fluorescence quantitative PCR. NtMIXTA-like The expression level of the gene was measured, and 9 transgenic plants with expression levels higher than the control were screened ( Figure 4 ). Three strains with the highest relative expression levels, No. 6 and No. 29, and No. 24 with a medium expression level, were selected and named NtMIXTA-like -OE6, NtMIXTA-like -OE29 and NtMIXTA-like -OE24, for subsequent experiments.

[0032] Embodiment 3 NtMIXTA-like Gene knockout material creation 1. Construction of knockout vector: Use online design tools (https: / / zlab.bio / guide-design-resources) to NtMIXTA-like Design gRNA target site sequence in the coding region of the gene (ACTGACCGTCATTGGACAAG AGG , the underlined region is the PAM region), and a BsaI restriction site was added. The target site sequence and its reverse complementary sequence were chemically synthesized and annealed to form an oligo dimer. The vector Cas-PF ( Figure 5) single enzyme digestion, gel excision recovery, use T4 DNA ligase to connect with the target sequence of oligo dimer, the ligation product was transferred into Escherichia coli competent cells, and the bacterial liquid PCR ( Figure 6 ) and sequencing screening, and successfully obtained positive monoclonal clones.

[0033] 2. Obtaining knockout vector: Extract from the above positive monoclonal bacterial solution NtMIXTA-like The knockout vector plasmid was used to infect K326 leaves by Agrobacterium-mediated method, and 13 positive transgenic plants were successfully obtained. The genomic DNA of each plant was extracted, and primers (F4: TGACATTAAGATACGTCCAAAC, R4: GACTAGAAGGTGAAGTGGTAG) were designed upstream and downstream of the target site for PCR amplification. The PCR products were sequenced to screen for single plants with base mutations at the target site. The results showed that ( Figure 7 ), the 13 individual plants obtained NtMIXTA-like The genes all mutated in the sgRNA region, and three individuals underwent homozygous mutations: individual No. 29 had a T base inserted; individual No. 31 lacked the CA base; individual No. 34 lacked the GGAC base. They were named NtMIXTA-like-KO29, NtMIXTA-like-KO31, and NtMIXTA-like-KO34, respectively, and were used for subsequent experiments.

[0034] Embodiment 4: NtMIXTA-like Observation on the morphology and density analysis of glandular trichomes in transgenic plants In this example, the morphology and density of glandular hairs of the transgenic plants (overexpression strains and gene knockout strains) obtained in the above examples were observed phenotypically, and the normal growth and uniform size were selected. NtMIXTA-like Knockout and overexpression plants were cut from leaves of the same leaf position and size, and the glandular hairs on the leaves were observed under a microscope. The results were as follows Figure 8 , Fig. 9 As shown, compared with the control, the density of leaf glandular hairs in the three knockout lines was slightly less than that in the control, among which the density of long-stalked glandular hairs decreased by 12.3%-25.4%, and the density of short-stalked glandular hairs decreased by 23.5%-33.1%, while the density of leaf glandular hairs in the three overexpression lines increased significantly, and the density of long-stalked glandular hairs increased by 34.6%-40.2%, and the density of short-stalked glandular hairs increased by 317.6%-355.4%, indicating that NtMIXTA-like The gene is a positive regulatory gene for glandular hair formation in tobacco.

[0035] Although some preferred embodiments of the present application have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present application.

[0036] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the spirit and scope of the inventive concept. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A NtMIXTA-like The gene has a nucleotide sequence as shown in SEQ ID NO.

1.

2. The method according to claim 1 NtMIXTA-like The amino acid sequence of the encoded protein of the gene is shown in SEQ ID NO.

2.

3. A biomaterial comprising the NtMIXTA-like genes or fragments thereof.

4. The biomaterial according to claim 3, characterized in that: It is any one of nucleic acid molecules, overexpression vectors, host cells, engineered bacteria, and transformed plant cells.

5. The method according to claim 1 NtMIXTA-like Use of a gene, a coding protein according to claim 2 or a biological material according to claim 3 in any of the following (1) to (7): (1) Application in positively regulating the occurrence / development of plant glandular hairs or in preparing reagents for positively regulating the occurrence / development of plant glandular hairs; (2) Application in positively regulating the density of plant glandular hairs or in preparing reagents for positively regulating the density of plant glandular hairs; (3) Application in regulating the type of plant glandular hairs or in preparing reagents for regulating the development type of plant glandular hairs; (4) Application in breeding / identifying varieties / lines with traits related to plant glandular hair density; (5) Application in the construction or breeding of transgenic plants with increased glandular hair density; (6) Use in enhancing plant stress resistance or in preparing agents for enhancing plant stress resistance; (7) Application in improving the aroma quality of plants or breeding plant varieties / lines with high aroma quality.

6. The use according to claim 5, characterized in that: The plant glandular hairs include at least one of long-stalked glandular hairs and short-stalked glandular hairs.

7. The use according to claim 5, characterized in that: Overexpression or upregulation of the NtMIXTA-like Gene.

8. The use according to claim 5, characterized in that: The plants include tobacco.

9. A method for improving tobacco glandular hair density / aroma quality, characterized in that: The following steps are involved: (1) Construct the NtMIXTA-like Gene overexpression vector; (2) transforming the overexpression vector into tobacco tissue or cells; (3) Make the NtMIXTA-like The gene is overexpressed in tobacco tissues or cells.

Images